|
CFSAN/Office of Plant and Dairy Foods
March 18, 2005
Memorandum
Attachment A:
Detection and Isolation of Shigella species From Produce, Revised 8/2/05
Attachment B:
Soak Method for the Detection of Salmonella in Basil,
Cilantro, Green Onions, Loose-Leaf Lettuce, Parsley, and Spinach
Attachment C:
Soak Method for Salmonella analysis in Cantaloupe
Attachment D:
Soak Method for Salmonella analysis in Tomatoes
Attachment E:
Protocol for the Detection of Viruses in Produce
Attachment F:
Detection of Cyclospora from Fresh Produce:
Isolation and Identification by Polymerase Chain Reaction (PCR)
Date: | March 18, 2005 |
From: | Consumer Safety Officer, Division of Field Programs Through: Chief, Compliance Programs Branch, HFS-636 /s/ |
Subject: | Import Produce Assignment (DFP # 05-16) - HIGH Priority ORA Concurrence # 2005031601 |
To: |
District Directors: (#) Directors, Regional Laboratory: (#) Import Program Managers: (#) Director, Laboratory Branch: (#) Director, Microbiology Branch: (#) Directors, Compliance Branch: (#) |
Info: |
Regional Food and Drug Directors: ALL Directors, Investigations Branch: (#) Field Food Committee Chairperson (#) Field Food Program Monitors: (#) |
Note: Material that is not releasable under the Freedom of Information Act (FOIA) has been redacted/deleted from this electronic version of the program. Deletions are marked as follows: (#) denotes one or more words were deleted; (&) denotes one or more paragraphs were deleted; and (%) denotes an entire attachment was deleted.
Over the past decade, the number of foodborne illnesses associated with fresh fruits and vegetables has increased. Fresh fruits and vegetables are grown in fields and orchards. Consequently, surfaces of produce during growth become contaminated with non-pathogenic and possibly pathogenic microorganisms. In addition to growing conditions, packaging and further processing (e.g., cutting, slicing, packaging) under insanitary conditions provides additional opportunities for contamination of harvested produce with pathogens. Fresh produce is of special concern because it is likely to be consumed without further treatment to "destroy or remove" microorganisms. The increase in foodborne illnesses associated with fresh produce may be due, in part, to increased ability to detect foodborne illness outbreaks and to an increase in the consumption of fresh produce. CFSAN has conducted a number of surveys since 1999 to gather data on the incidence and extent of pathogen contamination on selected produce, both imported and domestic. This assignment is being issued to continue this effort and is specified in the FY05 WorkPlan under Import and Domestic Micro Assignments.
Produce commodities are selected for sampling based on results of previous assignments, recent foodborne illness outbreaks, and other data needs. The elements of the assignment including pathogens targeted and analytical methods are kept as constant as possible for continuity between assignments and to facilitate completion of the assignment. Where changes from previous versions are necessary, they will be noted.
Over the past few years, there have been several studies involving the ability to recover and detect pathogen contamination of fresh produce. Most often, analyses involve rinsing the outside of the fruit or vegetable and analyzing the rinse water for pathogens. However, for some commodities and pathogens, the rinse method has a very low incidence of pathogen recovery and detection. For example, it is difficult to recover pathogens from the rough surface of cantaloupe. Pathogen recovery is significantly improved if cantaloupe is soaked rather than rinsed. If pathogens have been internalized into the product, a surface rinse may again fail to detect their presence. Internalization is a particular concern for microbiological analysis of tomatoes. Prior to the most recent assignment, a study was done within CFSAN to analyze the accuracy of two different Salmonella soak methods, one for cantaloupe and another for whole tomatoes. The study determined that the soak methods yielded more accurate results than when these two commodities were examined by the rinse method (fewer false negative results). In this assignment, the soak methods will be used for the Salmonella analyses of all commodities, with modified soak methods for cantaloupe and for tomatoes.
This assignment is to be implemented upon receipt. Each district should collect samples as seasonally available. The assignment will continue through September 30, 2005 if needed to meet sampling goals.
Sample Schedule
The following table shows the collecting districts, products to be collected, and the number of requested samples per commodity per district.
Commodity | District |
---|---|
Cantaloupe | (#) |
Tomatoes | |
Loose-leaf lettuce | |
Green Onions - split sample | |
Spinach | |
Cilantro | |
Basil - split sample | |
Parsley | |
Snow Peas | |
Totals per district |
Each district should collect samples indicated as available in that district as per OASIS. If product availability requires districts to substitute commodities between others from the table to meet overall sampling obligations, this will be acceptable. Districts should attempt to meet the totals per district. All samples should be field grown commodities where microbial contamination may be of concern due to poor agricultural practices on the field and/or poor manufacturing practices, such as at packing houses, i.e., districts should not knowingly collect hot house or greenhouse produce. Identified commodities from all countries of origin (except US Goods returned) are acceptable for sampling under this assignment except that no samples of Mexican cantaloupe (except for the exception noted below) are to be collected because they are covered by Import Alert #22-01. Exempt growers/importers that are on IA #22-01 may be sampled once during the course of this assignment. Districts should continue to collect samples until their obligation is fulfilled or until September 30, 2005.
For all products, a sample will consist of ten (10) sub-samples (no 702(b) required). For all products except cantaloupe and tomato, each sub-sample will consist of 454 grams (1 pound). For cantaloupe, each sub-sample will consist of two cantaloupes. For tomatoes, each sub-sample will consist of 900 grams (2 pounds).
NOTE: Split sample indicates one portion of the sample is sent to one science unit and another portion is sent to another science unit. Each split sample must consist of ten sub-samples.
Coordinate shipment and analysis of samples with the analyzing laboratories before collecting to ensure that the sample will be analyzed expeditiously.
NOTE: Samples collected under intensified sampling (see Regulatory Section) should indicate this on the collection report.
Ship samples to servicing laboratories according to the following table:
Commodity | Servicing Laboratories |
---|---|
Cantaloupe | (#) |
Tomatoes | |
Loose-leaf lettuce | |
Spinach | |
Cilantro | |
Parsley | |
Snow Peas | |
Basil - split sample: | |
Cyclospora cayetanensis | |
All other analyses | |
Green Onions - split sample: | |
Hepatitis A | |
All other analyses |
Collect all samples as domestic import status. Process the sample collection in FACTS. Inform importers that preliminary analytical results (negative for the pathogens) should be available within 3 to 7 days of sample receipt by the FDA servicing laboratory (should include estimated shipping time as well). Any distribution of sampled product is done at the importer's risk.
The following should be included with the Notice of Sampling.
NOTE: Notice to the Importer
Surveillance Sample(s) collected from this shipment will be tested for the presence of pathogenic microorganisms. Preliminary analytical results may be available within 4 to 9 days following the date of sample collection. FDA will attempt to provide the importer with preliminary analytical results as soon as they are available. Should a sample be determined to contain a pathogenic microorganism and is violative, the importer will be responsible to initiate a recall of the product.
If you have any questions regarding the above procedures contact the Division of Import Operations and Policy (DIOP), Linda Wisniowski at 301-594-3855.
Aseptic Sampling
Collect all samples ASEPTICALLY; see IOM, Chapter 4, Section 426.
NOTE: | It is important that each sub-sample be collected into a separate bag, and controls (i.e., open and unopened collection bags, and unopened sterile disposable gloves) be submitted with the sample. All controls must be identified and placed in the container with the sample. |
Collect sub samples at random to ensure that the sample is representative of the lot.
Sampling containers for cantaloupe samples:
If whirl pack bags of sufficient
size are unavailable, investigators may use unopened, new, small commercial
garbage or trash bags. Previous experience indicates that the interiors of
these bags do not support the growth of bacteria. If these containers are used,
then an unopened intact bag must also be submitted to the laboratory as a
control sample.
Sample Shipment
Because fresh produce is highly perishable, ship refrigerated samples by the fastest means possible and coordination should be made by the District to the servicing labs for this assignment. Consideration should also be made to not collect samples late in the day if they cannot be prepared and shipped the same day.
Ensure that the coolant used does not come in direct contact with the commodity.
Data Reporting
Laboratories are required to report positives and monthly sample status to headquarters.
Report all analytical finding into FACTS using PAF = MIC (problem code MICROID, PFGE, SERO as appropriate); secondary PAF = SAL, ABR.
Data Reporting Requirements:
Cantaloupe: | 22A [ ] B01 | Raw |
22A [ ] C01 | Raw, Fresh, Refrigerated | |
Tomatoes: | 24F [ ] B50 | Raw |
24F [ ] C50 | Raw, Fresh, Refrigerated | |
Loose-leaf Lettuce: | 24T [ ] B32 | Raw |
24T [ ] C32 | Raw, Fresh, Refrigerated | |
Green Onions: | 25J [ ] B04 | Raw |
25J [ ] C04 | Raw, Fresh, Refrigerated | |
Spinach: | 24T [ ] B25 | Raw |
24T [ ] C25 | Raw, Fresh, Refrigerated | |
Cilantro: | 24T [ ] B46 | Raw |
24T [ ] C46 | Raw, Fresh, Refrigerated | |
Basil: | 28A [ ] B04 | Raw |
28A [ ] C04 | Raw, Fresh, Refrigerated | |
Parsley: | 24T [ ] B21 | Raw |
24T [ ] C21 | Raw, Fresh, Refrigerated | |
Snow Peas | 24A [ ] B51 | Raw |
24A [ ] C51 | Raw, Fresh, Refrigerated | |
PAC: Report all import operations accomplished under PAC 03F098. |
Negative or presumptive positive test results for Salmonella and Shigella will be available within 3 days from receipt in the lab, Cyclospora and Hepatitis A negative or presumptive positive test results will be available within 5 days from receipt in the lab, E. coli negative results will be available in 3 days and confirmed positive and MPN within 7 days from receipt in the lab, E. coli O157:H7 negative results will be available in 3 days and presumptive positive will be available in 5 days from receipt in the lab. The collecting district in coordination with the servicing laboratories needs to notify the broker of either negative or presumptive positive results within the timeframe.
ANALYTICAL RESULTS | ||
---|---|---|
Microorganism | Presumptive Positive | Positive |
E. coli | Not Applicable | IMVIC, API20E, VITEK GNI+, modified 3.21.05 |
E. coli 0157:H7 | Absence of Sorbitol fermentation on TC-SMAC agar and Spot Indole Test, modified 3.21.05 | Serology and PCR |
Salmonella | VIDAS | (api20E or VITEK GNI+) and Salmonella antiserum H and O Groups |
Shigella | First round PCR (of amplified product and/or microbiology with PCR analysis of colonies) using ipaHF/ipaHR primers | Nested PCR (of amplified product and/or microbiology with PCR analysis of colonies) using ipaH3/ipaH4 primers |
Cyclospora cayetanensis | Not Applicable | CC719 CRP999 |
Hepatitis A | BG7/BG8 | Sequencing |
At the first of each month, each laboratory is requested to e-mail a list of samples received and/or completed during the previous month to the DFS contact (Atin Datta at atin.datta@fda.hhs.gov). The information will include the sample number, product, sampling district and analysis results (if completed). This information will be compiled and sent to CFSAN assignment contact (Carrie Lawlor at carrie.lawlor@fda.hhs.gov). The labs will immediately notify the DFS contacts and the CFSAN assignment contact of positive samples by e-mail. Laboratories should also immediately notify the collecting district.
Due to the perishable nature of fresh produce, it is important that analyses start immediately upon arrival of samples to the laboratories. Samples should not be frozen at any time prior to analysis.
Use the following table to determine which commodities to sample for each pathogen.
E. coli | E. coli 0157:H7 | Salmonella | Shigella |
Cyclospora cayetanensis |
Hepatitis A | |
---|---|---|---|---|---|---|
Cantaloupe | X | X | X | |||
Tomatoes | X | X | X | |||
Loose-leaf lettuce | X | X | X | |||
Green onions | X | X | X | X | ||
Spinach | X | X | ||||
Cilantro | X | X | ||||
Basil | X | X | X | |||
Parsley | X | X | X | |||
Snow peas | X |
Salmonella cannot be enumerated when detected by the soak method.
Tomato, Cantaloupe, and Parsley
Each sub sample will be split into
two approximately equal portions. One portion of each sub sample will be
analyzed for E. coli, and Shigella using the sub sample rinse
method. The other portion of each sub sample will be used for Salmonella
testing as per the specialized soak methods for the particular commodity.
Loose-leaf lettuce
Each sub sample will be split into
two approximately equal portions. One portion of each sub sample will be
analyzed for E. coli and E. coli O157:H7 using the sub sample
rinse method. The other portion of each sub sample will be used for Salmonella
testing as per the specialized soak method for the particular commodity.
Green Onions
Each sub sample will be split into
three portions. One portion of each sub sample will consist of 50 grams and
will be analyzed for Hepatitis A using the protocol for the detection of
viruses in produce (Attachment E).
The remaining quantity will be split into
two approximately equal portions; one portion will be analyzed for E. coli
and Shigella using the sub sample rinse method, and the other portion of
each sub sample will be used for Salmonella testing as per the
specialized soak methods for the particular commodity.
Spinach and Cilantro
Each sub sample will be split into
two approximately equal portions. One portion of each sub sample will be
analyzed for E. coli using the sub sample rinse method. The other
portion of each sub sample will be used for Salmonella testing as per
the specialized soak method for the particular commodity.
Basil
Remove a 10 gram portion of each
sub sample for analysis for Cyclospora cayetanensis. The remaining
portion of each sub sample will be split into two approximately equal portions.
One portion of each sub sample will be analyzed for E. coli using the
sub sample rinse method. The other portion of each sub sample will be used for
Salmonella testing as per the specialized soak method for the particular
commodity.
Pre-sample preparation for all products that are to be analyzed by the Rinse Method.
To conduct meaningful bacterial analyses, the samples must be prepared for analysis in a manner that closely simulates the actions typically taken by consumers who provide minimal preparation (e.g., washing and/or trimming) prior to consumption.
All product analyses except Salmonella: Perform a light rinse to remove visible dirt. "Light rinse" means to place produce commodity under cold running tap water for several seconds until visible dirt is removed. For Salmonella analyses only, a preliminary rinsing of the produce under running tap water is not recommended.
For each individual sub sample, place contents into a sterile plastic bag. Add a volume of Butterfield's phosphate buffer solution that is equal to the weight of the product. For instance, if one sub sample weighs 500 g, add 500 ml Butterfield's phosphate buffer solution (1:1 dilution). Gently shake the bag with contents for 5 minutes using a shaker (e.g., orbital) at 100 rpm. This is considered to be the "sub sample rinse". Do not discard the "sub sample rinse" until the entire analysis is completed. Refrigerate the remaining rinse.
From each sub sample rinse (10 analyses/sample):
Prepare decimal dilutions by removing 50 ml (of sub sample rinse) into 450 ml of Butterfield's phosphate buffer solution (1:10). Then follow methodology as outlined in the BAM for E. coli.
NOTE: | E. coli analysis: inoculation of the LST tubes will be conducted from 10-1 to 10-5 dilutions, only. It will not be necessary to prepare/use tubes for dilutions greater than 10-5for an end-point. Therefore, the maximum result that can be encountered would be > 110,000 MPN/g. |
The Laboratory should notify the CFSAN Assignment Contact (Carrie Lawlor at carrie.lawlor@fda.hhs.gov) when levels equal to or greater than 100 MPN of E. coli are found.
Note: Only loose-leaf lettuce is to be tested for E. coli O157:H7.
From each subsample rinse (10 analyses/sample):
Remove 125 ml (of sub sample rinse) and place in a sterile beaker/flask with 125 ml 2X EEB to perform the E. coli O157:H7 analysis. Then follow methodology as outlined in BAM, Chapter 4a, Sections K-Q.
NOTE: | Since the normal flora levels are not anticipated to be high in these products, the level of antibiotic cefixime to be used in the EEB enrichment is recommended to be reduced to one-fourth of that stated in the BAM (Edition 8, Revision A/1998), to avoid the inhibition of any E. coli O157: H7 that may be present. |
See BAM, Ch. 4a, Section M.
DO NOT USE THE OPTIONAL METHOD DESCRIBED THAT USES DYNA BEADS.
Positive E. coli O157: H7
Submit one (1) isolate from each E. coli O157:H7 positive sub sample to the specified laboratories per the instructions for PFGE and ribotyping. All laboratories are to send isolates for PFGE and/or ribotyping analyses within 24 hrs after completion of the analytical portion of the sample analysis.
All cultures should be shipped by FedEx overnight and should conform to the rules and regulations regarding the shipment of infectious agents. Consult your supervisor if you have any questions.
Ensure that the appropriate servicing laboratory is selected and identified in FACTS - MIC screen.
Submit E. coli O157:H7 isolates for Pulse Field Gel Electrophoresis (PFGE) assay to respective servicing laboratories.
Submit E. coli O157:H7 isolates for ribotyping only to:
(#)
Regional Laboratory HFR-PA260)
19701 Fairchild
Irvine, CA 92612
Submit E. coli O157:H7 isolates for antibiotic sensitivity assay to:
(#)
6th Avenue & Kipling Street
DFC BLDG. 20
Denver, Colorado 80225-0087
(#)
See Attachment A: Detection and Isolation of Shigella species from Produce.
Shigella analysis must be done on a composite basis (i.e., 2 composites per sample). Each composite for Shigella analysis will consist of 250 ml.
If the district laboratories do not have PCR primers and the positive control strain, please notify Keith Lampel, Ph.D., the CFSAN scientific contact for Shigella.
Salmonella analysis will be done on a composite basis (i.e., 2 composites per sample). Each composite for Salmonella analysis will consist of 375 ml.
Prepare each composite by removing 75 grams from each of five (5) sub samples into a sterile beaker/flask. Add 3375 ml of appropriate pre-enrichment broth (see Attachment B).
Incubate 24±2 h at 35° C. Then follow the methodology as outlined in BAM On-line, at Chapter 5 for Salmonella.
Screen all samples for Salmonella using rapid methods listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology" dated April 24, 1998. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
If there is a presumptive positive based on the test kit, then perform:
[1] Confirmation analyses as outlined in the BAM.
See Attachment C: Soak Method for Salmonella analysis in Cantaloupe.
See Attachment D: Tomato Soak Method for Salmonellaanalysis
One (1) isolate from each Salmonella positive composite or sub sample is to be sent to each of the specified laboratories per the instructions for serotyping (speciation) and PFGE.
Following speciation, one slant from each serotyped isolate will be sent for antibiotic resistance testing.
All laboratories are to send Salmonella isolates for serotyping and PFGE analyses within 24 hrs after completion of the analytical portion of the sample analysis.
All cultures should be shipped by FedEx overnight and should conform to the rules and regulations regarding the shipment of infectious agents. Consult your supervisor if you have any questions.
For Salmonella serotyping, all bacterial cultures should be prepared and submitted according to the directions specified in the Bacteriological Analytical Manual (BAM), at Chapter 5, E.11 "Submission of cultures for serotyping."
Ensure that the appropriate servicing laboratory is selected and identified in FACTS - MIC screen.
The serotyping (speciation) laboratory should batch isolates of Salmonella for antibiotic resistance testing (20 isolates per batch) and ship to the identified laboratory for antibiotic resistance testing.
An electronic mail should be sent to the recipient before the shipment.
Submit Salmonella isolates for serotyping to the laboratories listed below.
Isolates from (#) will be serotyped in ARL:
Arkansas Regional Laboratory
3900 NCTR Road Building 26
Jefferson AR 72079
(#)
Isolates from (#) will be serotyped in DEN:
Denver District Laboratory
6th Avenue & Kipling Street
DFC Building 20
Denver Colorado 80225-0087
(#)
Serotyping laboratories submit Salmonella isolates for antibiotic sensitivity assay to:
(#)
6th Avenue & Kipling Street
DFC BLDG. 20
Denver, Colorado 80225-0087
(#)
Submit Salmonella isolates for Pulse Field Gel Electrophoresis (PFGE) assay to respective servicing laboratories.
See Attachment E: Protocol for the Detection of Viruses in Produce.
See Attachment F: Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR).
Cyclospora analysis for snow peas will be done on a composite basis (i.e., 2 composites per sample). Each composite for Cyclospora analysis will consist of 100 grams. Prepare each composite by removing 20 grams from each of five (5) sub samples and proceed with the protocol in Attachment F: Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR).
Further action should be considered if any of the following microorganisms are detected and confirmed:
Please include the original entry number with each sample submitted for regulatory review. Please refer to the guidance outlined below:
Generic E. coli:
If found at levels equal to or
greater than 100 MPN, after the CFSAN contact is notified, the competent
authority in the producing country will be notified by CFSAN since these levels
indicate gross insanitation.
E. coli O157:H7, Salmonella:
Contamination of produce with
these pathogens is considered a significant risk to health. These pathogens may
be present as the result of animal-to-food contamination that is out of control
at the grower, or insanitation at the processor, or manufacturer. However, the
pathogens may be introduced to the growing fields from natural sources.
Therefore, a single instance of contamination may be the result of an
unavoidable solitary occurrence and regulatory discretion will be applied.
However, if more than a solitary occurrence of contamination occurs, either in
the same lot or in subsequent lots, it is indicative of inadequate controls and
additional lots are likely to be contaminated.
Regulatory Strategy:
NOTE: All DWPE recommendations need the concurrence of CFSAN and ORA headquarters prior to implementation and must be submitted to DIOP.
Shigella, Hepatitis A, and Cyclospora cayetanensis:
Contamination of a product with human source pathogens, Shigella, Hepatitis A, and Cyclospora cayetanensis, is considered a significant risk to health. Shigella contamination is also indicative of a direct human-to-food contamination. Hepatitis A is excreted in feces of infected people and can produce clinical disease when susceptible individuals consume contaminated water or foods. Hepatitis A is primarily transmitted by person-to-person contact through fecal contamination, but common-source epidemics from contaminated food and water also occur. Poor sanitation and crowding facilitate transmission. Contamination of foods by infected workers in food production facilities/processing plants and restaurants is common. No known non-human sources of the virus exist. It is likely that the cause of the contamination with Shigella and Hepatitis A is a result of insanitation at the grower or subsequent establishments. It is likely that subsequent lots may also be contaminated unless insanitary conditions or practices are corrected. Cyclospora cayetanensis is transmitted by the fecal-oral route; however, direct person-to-person transmission is unlikely because excreted oocysts require days to weeks under favorable environmental conditions to become infectious (i.e., sporulate). Most reported cases have occurred during spring and summer.
Regulatory Strategy:
NOTE: All DWPE recommendations need the concurrence of CFSAN and ORA headquarters prior to implementation and must be submitted to DIOP.
REMOVAL FROM DETENTION WITHOUT PHYSICAL EXAMINATION
FDA decisions to remove a
product, shipper, grower, or importer from DWPE should be based on evidence
establishing that the conditions that gave rise to the appearance of a
violation have been identified and resolved and the Agency has confidence that
further entries will be in compliance with the Act.
The following criteria are required in the evaluation for the removal from DWPE:
If a farm investigation or verification of implemented corrective measures is not conducted by FDA, FDA may decide to audit the verification of the corrective actions before a grower is removed from DWPE. Since CFSAN concurrence is necessary before removing the product/firm from DWPE, all recommendations for removal from DWPE are to be submitted to DIOP for review and coordination with CFSAN when the district or other interested parties present documentation, which establishes that the corrective actions implemented adequately presents evidence that meets the criteria for removal from DWPE.
The Office of Plant and Dairy Foods will prepare a summary and evaluation of the findings within 120 days of the completion of the assignment.
CFSAN Assignment Contact: | Carrie Lawlor, (301) 436-2068 Office of Compliance, Division of Field Programs Compliance Programs Branch, HFS-636 |
CFSAN Import Regulatory Contact: |
Doriliz Mestey, (301) 436-2772 Office of Compliance, Division of Enforcement Import Branch, HFS-606 |
CFSAN Import Regulatory Contact (Backup): | Salvatore Evola, (301) 436-2164 Office of Compliance, Division of Enforcement Import Branch, HFS-606 |
CFSAN Program Office Contact: | Amy Green, (301) 436-2025 Office of Plant and Dairy Foods Division of Plant Product Safety Regulatory and Policy Branch, HFS-306 |
CFSAN Scientific Contacts: | |
E. coli and E. coli O157:H7: | Peter Feng, PhD, (301) 436-1650 Office of Plant and Dairy Foods Division of Microbiological Studies Microbiological Methods Development Branch, HFS-516 |
Shigella: |
Keith A. Lampel, PhD, (301) 827-8617 Office of Applied Research and Safety Assessment Division of Virulence Assessment Virulence Mechanisms Branch, HFS-025 |
Salmonella: |
H. Andrews, PhD, (301) 436-2008 Office of Plant and Dairy Foods Division of Microbiological Studies Microbiological Methods Development Branch, HFS-516 |
Hepatitis A: |
Biswendu B. Goswami, PhD, (301) 827-8627 Office of Applied Research and Safety Assessment Division of Molecular Biology Virulence Mechanisms Branch, HFS-025 |
Cyclospora cayetanensis: |
Palmer A. Orlandi, PhD, (301) 827-8643 Office of Applied Research and Safety Assessment, Division of Virulence Assessment Virulence Mechanisms Branch, HFS-025 |
ORA Import Alert and Procedures Inquires:
Linda Wisniowski, Division of Import Operations and Policy, HFC-170 at (301) 443-6553.
ORA Analytical Inquiries:
Atin Datta, PhD, Division of Field Sciences, HFC-141 at (301) 827-1030.
Marsha Hayden, Division of Field Sciences, HFC-141 at (301) 827-1039.
ORA Investigational Contact: Barbara Marcelletti, Division of Field Investigations, HFC-130 at (301) 827-5635.
(#)
Import Produce Assignment FY 2005 DFP # 05-16
Detection and Isolation of Shigella species From Produce
Notes:
Microbiological analysis and PCR are to be performed
concurrently. PCR analysis should be performed on both the amplified product
and suspect colonies.
Addition of a positive control spike of the rinse will
run in parallel to the sample analysis (conventional and molecular) throughout
the method.
For preparation of media and reagents, refer to the Bacteriological Analytical Manual (BAM). The number in parentheses following each medium refers to its listing in the media section of the BAM.
Media
Reagents
Enrichment in broth medium
Procedure
The following is a typical set up for PCR methodology.
dH20 | 4-6.5 µl |
Mix | 12.5 µl 10 X stock (DNA polymerase buffer*) |
Primers | 2.5 µl each primer (10 pmoles/ ml stock) (will be provided) ipaHF and ipaHR |
Template | 1-2.5 µl (e.g., positive control or PCR template prep) |
Total volume is 25 µl |
*HotStart Taq™ Master Mix Kit (Qiagen)
Primer sequences: | ipaHF 5'GTT CCT TGA CCG CCT TTC CGA TAC CGT C 3' |
ipaHR 5'GCC GGT CAG CCA CCC TCT GAG AGT AC 3' |
NOTE: | A S. flexneri strain (2457M) is provided on a slant and should be streaked out onto nutrient agar plate (e.g., isolated colonies). This strain is a positive control, which can be used, with the PCR primers. However, this strain can be differentiated from any other Shigella isolate with another set of primers (607, 608), if needed, and its resistance to the antibiotic kanamycin [50 µg/ml]. All presumptive positive samples should be confirmed by nested PCR and also by primers 607 and 608 to make sure the positive samples are not due to cross contamination with the control strain. Amplification (PCR) with primers 607 and 608 will yield a 1.8 kb amplicon from the control strain (2457M) only; all other Shigella spp. will have a 1.0 kb amplicon. Control reactions can be run simultaneously (not multiplex) to ensure proper quality control of sample processing. A negative result, i.e. no PCR product from reactions using primers 607 and 608 only should not be interpreted as being negative for Shigella; the virulence plasmid could be completely or partially deleted. The ipaHF and ipaHR primers target the ipaH genes-there are 9 copies in the chromosome and virulence plasmid. Template is prepared by boiling a colony from an agar plate in 150 µl dH20 and using 1 µl in a PCR control tube. Another set of primers specific for this strain is available. It is recommended that the positive control be used to ensure that the reagents are working properly. |
First file is set at 95° C for 15 minutes
Total number of cycles is 30.
After amplification, transfer 10 µl of the PCR products to another microcentrifuge tube containing 2 µl of tracking dye and load on 1% agarose gel.
NOTE: Do not add dye directly to the PCR product.
A 100 base pair ladder is used as a molecular weight standard. A 620 base pair product is expected from the positive samples. When reactions are completed, keep PCR product at 4° C or stored at -20° C.
If a 620 bp amplicon is seen on the agarose gel (presumptive positive), proceed to the nested PCR step below for confirmation.
NOTE: PCR primers
PCR primers (ipaH-F and ipaH-R) are targeted to the ipaH genes; there are multiple copies of this gene residing in the chromosome and in the virulence plasmid of Shigella.
Primers ipaH3 and ipaH4 are directed to internal sequences within the 620 bp amplicon generated from PCRs using primers ipaHF and ipaHR. Using primers ipaH3 and ipaH4, a 290 bp product should be amplified if the 620 bp fragment was generated from Shigella DNA. The objective of using the nested PCR assay is to confirm that the 620 bp fragment was amplified from Shigella.
1. Distilled water | 6.5 µl | |
2. 10 X buffer | 12.5 µl (see note I below) | |
3. Primers | 2.5 µl ipaH3 | (stock is 10 pmol/µl) |
2.5 µl ipaH4 | (stock is 10 pmol/µl) | |
4. Template | 1.0 µl (see explanation II below) |
After reactions are complete, run 8-10 µl through a 1 % agarose gel in 0.5 X Tris-acetate EDTA buffer, pH 8.3. Each gel should have a 100 bp ladder as molecular weight marker. A positive reaction generates a 290 bp fragment. This is a confirmatory test.
Notes:
Primer sequence
ipaH3: 5'-CCA
CTG AGA GCT GTG AGG
ipaH4: 5'-TGT
CAC TCC CGA CAC GCC
It is recommended that the positive control be used to ensure that the reagents are working properly.
If a presumptive sample is analyzed by nested PCR and a 290 bp product is detected, save the PCR products from both sets of reactions (first round and nested). If necessary, send the products to:
Dr. Keith A. Lampel
FDA/CFSAN, HFS-515
5100 Paint Branch Parkway
College Park, MD 20740
301-436-2007
Interpretation:
Bacteriological:
Lactose negative on MacConkey/lactose agar plates
Negative for motility, hydrogen sulfide production, lysine
decarboxylase activity, no gas production from glucose.
PCR (of amplified product and of colonies):
Presumptive positive if first round PCR yields a 620 bp product
Confirmation is by nested PCR-amplification of 290 bp product
Reference:
Bacteriological Analytical Manual Online.
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for the Detection of Salmonella in Basil, Cilantro, Green Onions, Loose-Leaf Lettuce, Parsley, and Spinach
Note: This sample preparation is only to be used for the detection of Salmonella in basil, cilantro, green onions, loose-leaf lettuce, parsley, and spinach. See Attachment C for cantaloupe and Attachment D for tomatoes.
Do not rinse the produce, even if there is visible dirt. Examine the produce "as is".
For basil and cilantro:
Combine 75 g from each of 5 individual sub-samples into a sterile flask (375 g composite), or other appropriate container. Add 3375 ml tryptic soy broth and swirl, so that all of the produce is fully wetted. Loosely cap the flask. Let stand for 60 ± 5 min. Adjust pH to 6.8 ± 0.2, if necessary. Allow the samples to remain in the pre-enrichment broth during incubation.
For green onions, loose-leaf lettuce, parsley, snow peas, and spinach:
Combine 75 g from each of 5 individual sub-samples into a sterile flask (375 g composite), or other appropriate container. Add 3375 ml lactose broth and swirl, so that all of the produce is fully wetted. Loosely cap the flask. Let stand for 60 ± 5 min. Adjust pH to 6.8 ± 0.2, if necessary. Allow the samples to remain in the pre-enrichment broth during incubation.
After pre-enrichment, produce are to be selectively enriched as described below. The selective enrichment strategy is dependent on whether the culture method or a rapid method is to be used. Only rapid methods, for Salmonella, listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology" dated April 24, 1998, may be used. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
For the Salmonella culture method (BAM, method 995.20) and rapid method 996.08, use Rappaport-Vassiliadis (RV) medium and tetrathionate (TET) broth. For the rapid methods 989.14, 990.13, 992.11, or 993.08 use selenite cystine (SC) and TET broths.
For the Salmonella culture method, transfer 0.1 ml mixture to 10 ml RV medium and 1 ml mixture to 10 ml TET. Vortex. Treat all of the above produce as high microbial load foods. Incubate RV medium for 24 ± 2 h at 42 ± 0.2° C and incubate TET broth 24 ± 2 h at 43 ± 0.2° C. Incubate both RV and TET in air incubator. After incubation, follow the BAM Online, Salmonella, Chapter 5, section D, Isolation of Salmonella.
For rapid method kits, selectively enrich as instructed by the kit manufacturer.
None of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of all of the different kinds of produce found in this assignment. Thus, should the analyst decide to use a rapid method which has not been validated for a particular kind of produce, it will be necessary to do a comparative seeding study.
If a sample is a presumptive-positive based on the test kit, then perform confirmation analysis as described in the BAM Online, above.
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for Salmonella analysis in Cantaloupe
Note: | This sample preparation is only to be used for the detection of Salmonella in Cantaloupe; when other organisms are being analyzed for, follow the soak method as stated in Attachment B. |
Do not rinse the cantaloupes, even if there is visible dirt. Examine the cantaloupe "as is".
For each individual sub sample (e.g., one cantaloupe), place contents into a sterile plastic bag (Biopro Sample Bag, 12 x 18 inches, catalog number BP-41218, available from International Bioproducts, phone 800-729-7611). Add a volume of lactose broth that is needed to allow the cantaloupe to float. Normally this volume of lactose broth is 1.5 times the weight of the cantaloupe. For instance, a cantaloupe weighing 1200 g will need a volume of 1800 ml lactose broth. Place the plastic bag, with cantaloupe and lactose broth, into a non-sterile 5 liter beaker for support during incubation. Allow the open-end flap of the plastic bag to "fold over" so as to form a secure, but not airtight, closure during incubation.
Incubate each, individual cantaloupe sub sample at 35 C for 24 plus or minus 2 hours.
After incubation, manually mix the contents of the bags containing the cantaloupes and the pre-enrichments. The sub sample pre-enrichments are then to be "wet composited". From each of 5 incubated sub samples, remove 0.1 ml lactose broth pre-enrichment and place into a tube or flask containing 50 ml Rappaport-Vassiliadis (RV) medium. For the other 5 incubated sub samples, remove 0.1 ml lactose broth and place into a tube or flask containing 50 ml RV medium. Incubate the 2 RV medium composites at 42 plus or minus 0.2 C in a circulating, thermostatically controlled water bath for 24 h.
In addition to subculturing the sub sample pre-enrichments to RV medium, these sub sample pre-enrichments are to be sub-cultured to tetrathionate (TET) broth. From each of 5 incubated sub samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube containing 50 ml TET broth. For the other 5 incubated sub samples, remove 1.0 ml lactose broth and place into a tube containing 50 ml TET broth. Incubate the 2 TET broth composites at 35 C for 24 hours.
After incubation of the RV and TET composites, continue as directed in BAM Online, Chapter 5.
Note: Only the VIDAS Salmonella (SLM) Assay (Method 996.08 has been validated for use with cantaloupes.
None of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of cantaloupe. Thus, should the analyst decide to use rapid methods other than the VIDAS Salmonella SLM Assay, it will be necessary to do a comparative seeding study as described in the guidance memo of April 24, 1998 and in ORA-LAB1.
If a sample is a presumptive positive based on the test kit, then perform confirmation analysis as described in the BAM Online, above. It should be noted that the use of this soak method does not allow a most probable number determination of Salmonella for those samples that are qualitatively positive for this pathogen.
Please note that this procedure involves wet compositing of incubated sample pre-enrichments as opposed to dry compositing as described in the BAM. Validation data to support the use of wet compositing may be found in the following references:
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for Salmonella analysis in Tomatoes
Note: | This sample preparation is only to be used for the detection of Salmonella in tomatoes; when other organisms are being analyzed for, follow the soak method as stated in Attachment B. |
After pre-enrichment, tomato sub-samples are to be selectively enriched as described below. The selective enrichment strategy is dependent on whether the culture method or a rapid method is to be used. Only rapid methods, for Salmonella, listed in the memo entitled, }"Guidance for the Use of Rapid Methods for Food Microbiology dated" April 24, 1998, may be used. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
For the Salmonella culture method (method 2000.06), use Rappaport-Vassiliadis (RV) medium and tetrathionate (TET) broth. For the rapid methods 989.14, 990.13, 992.11, 993.08, or 996.08 use selenite cystine (SC) and TET broths. Please note that method 996.08 (Vidas SLM method) may be changed in the near future: SC broth may be replaced with RV medium. In the event that RV medium is approved for use, with method 996.08, use TET and RV medium for this method.
After incubation, manually mix the contents of the bags containing the tomatoes and the pre-enrichments. The sub-sample pre-enrichments are then to be "wet composited". From each of 5 incubated sub-samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube or flask containing 50 ml TET broth. For the other 5 incubated sub-samples, remove 1.0 ml lactose broth from each sub-sample and place into a tube or flask containing 50 ml TET broth. Incubate the 2 TET broth composites at 35°C for 24 h.
In addition to sub-culturing the sub-sample pre-enrichments to TET broth, for the rapid methods listed above, these sub-sample pre-enrichments are to be sub-cultured to SC broth. From each of 5 incubated sub-samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube containing 50 ml SC broth. For the other 5 incubated sub-samples, remove 1.0 ml lactose broth from each sub-sample and place into a tube containing 50 ml SC broth. Incubate the 2 SC broth composites at 35°C for 24 h.
In addition to sub-culturing the sub-sample pre-enrichments to TET broths, for the culture method and possibly for method 996.08, these sub-sample pre-enrichments are to be sub-cultured to RV medium. From each of 5 incubated sub-samples, remove 0.1 ml lactose broth pre-enrichment and place into a tube containing 50 ml RV medium. For the other 5 incubated sub-samples, remove 0.1 ml lactose broth from each sub-sample and place into a tube containing 50 ml RV medium. Incubate the 2 RV medium composites at 42 ± 0.2°C in a circulating, thermostatically-controlled water bath for 24 h.
After incubation of the RV and TET composites, continue as directed in the BAM Online.
Please note that none of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of tomatoes. Thus, should the analyst use one of these rapid methods, then it will be necessary to do a comparative seeding study as described in the guidance memo of April 24, 1998 and in ORA-LAB1.
If a sample is a presumptive positive based on the test kit, then perform confirmation analysis as described in the BAM Online. It should be noted that the use of this soak method does not allow a most probable number determination of Salmonella for those samples that are qualitatively positive for this pathogen.
This procedure involves wet compositing of incubated sample pre-enrichments as opposed to dry compositing as described in the BAM.
For positive samples refer to Salmonella Isolates on page 8 of the Assignment.
Import Produce Assignment FY 2005 DFP # 05-16
Protocol for the Detection of Viruses in Produce
The following protocol was developed for the detection of foodborne viruses in produce such as scallion, and is probably applicable to other produce material such as cilantro or loose-leaf lettuce.
Materials required:
10X Tris-Glycine buffer | Sigma | T-4904 |
Polyethylene Glycol (PEG, Average Mol. Wt. 8000) | Sigma | 81268 |
Ribonucleic acid (Transfer) (10mg/ml) | Sigma | R8508 |
Tri Reagent | MRC | TR118 |
RNase/DNase free water | Any | |
AMV reverse transcriptase | Promega | M9004 |
10X reverse transcriptase buffer | Promega | A3561 |
Magnesium Chloride 25mM | Promega | A3511 |
PCR nucleotide mix (10mM) | Promega | C1141 |
Taq DNA polymerase in storage buffer B Oligonucleotide primers (see note 1). |
Promega | M1661 |
Procedure:
Add 9.4µl of the following reaction mixture: | |
!0X reverse transcription buffer (Promega) | 2µl |
100mM DTT | 2µl |
10mM deoxynucleotide mix | 1µl |
25mM MgCl2 | 2.4 µl |
RNasin RNase inhibitor 20 -40 units perµl | 1µl |
AMV reverse transcriptase 20u/µl | 1µl |
All the above reagents are from Promega | |
Heat the reactions in a thermal cycler at 22° for 10min followed by 42° for 90 min, and 95° for 5min. Chill immediately on ice and centrifuge at 14,000 rpm for 5 min. Proceed immediately to PCR or freeze at -20°. |
Buffer | 50 mM Tris-HCl, pH ; 75 mM KCl |
dNTPs | 200 µM each |
MgCl2 | 3 mM |
Primers | 50 pmol of forward and reverse primers |
Template | 5-10 µl of reverse transcription reaction |
Taq polymerase | 0.5 Units (Promega) |
Total volume 50 µl |
Note 1: | |
Primers | |
BG 7 (5'-CCGAAACTGGTTTCAGCTGAGG-3') BG 8 (5'-CCTCTGGGTCTCCTTGTACAGC-3') |
The expected size of an amplicon generated with BG7/BG8 is 276 bp. This is considered a presumptive positive result.
PCR products should be sent under refrigeration temperature to the attention of Yuan Hu, NRL, to perform DNA sequencing. An e-mail should also be sent to Yuan to alert him of the sample:
Yuan Hu, Microbiologist
FDA - Northeast
Regional Laboratory
158 - 15 Liberty Avenue
Jamaica, New York
11433-1034
Developed by Biswendu B. Goswami, PhD, Division of Molecular Biology, OARSA
Import Produce Assignment FY 2005 DFP # 05-16
Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR)
This protocol is derived from Chapter 19A, Revised Version of the BAM chapter entitled "Detection of Cyclospora and Cryptosporidium from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR) and Microscopic analysis."
Palmer A. Orlandi, Christian Frazar, Laurenda Carter, and Dan-My T. Chu
The molecular detection of Cyclospora spp is independently accomplished using nested PCR protocols. The differential identification of Cyclospora cayetanensis from other closely related non-human pathogenic parasites (i.e. Eimeria spp) employs a nested multiplex PCR assay. This assay can be accomplished using a conventional thermal cycler with heated lid.
Primer Designation | Primer Specificity |
Primer Sequence (5'-3') |
Amplicon Size (bp) | Designated Application |
---|---|---|---|---|
F1E (forward) | Cyclospora and Eimeria spp. | TACCCAATGAAAACAGTTT | 636 | Primary Amplification |
R2B (reverse) | CAGGAGAAGCCAAGGTAGG | |||
CC719 (forward) | C. cayetanensis | GTAGCCTTCCGCGCTTCG | 298 | Nested Amplification |
PLDC661 (forward) |
C.
cercopitheci, C. colobi, C. papionis |
CTGTCGTGGTCATCGTCCGC | 361 | Nested Amplification |
ESSP841 (forward) |
Eimeria spp | GTTCTATTTTGTTGGTTTCTAGGACCA | 174 | Nested Amplification |
CRP999 (reverse) | Cyclospora and Eimeria spp | CGTCTTCAAACCCCCTACTGTCG | Nested Amplification |
†All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.
Component | Volume (µl)* | Final Concentration | |
---|---|---|---|
FTA Filter Disk (DNA Template) | |||
HotStartTaq™ Master Mix | 50.0 | † | |
Reagent Master Mix | MgCl2, 25 mM | 2.0 | 2.0‡ |
Forward Primer, 10 µM | 2.0 | 0.2 µ M | |
Reverse Primer, 10 µM | 2.0 | 0.2 µ M | |
Sterile deionized water | 44.00 |
*100 µl total volume
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200
µ
M of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡ Final MgCl2 concentration is that contributed by
both the HotStartTaq ™ Master Mix
and 25 mM MgCl2stock
Control Type | Condition/Organism |
---|---|
Negative Control-1 | Reagent blank-no filter |
Negative Control-2 | Reagent blank + unspotted, washed filter |
†Positive Controls: Cyclospora Analysis: |
C. cayetanensis |
‡¶Cyclospora spp (NHP) | |
*Eimeria spp |
†Whenever possible, positive control FTA filters should be spotted with at least 103 organisms
‡Non-human primate-derived Cyclospora spp.
¶Not routinely available.
*Most available Eimeria spp are suitable.
Step | Number of Cycles | Temperature and Time | |
---|---|---|---|
Primary PCR | Initial Activation | 1 | 95° C; 15 min |
Amplification | 35 | Denaturation: 94° C; 30 sec | |
Annealing: 53° C; 30 sec | |||
Extension: 72° C; 90 sec | |||
Final Extension | 1 | 72° C; 10 min | |
Nested Multiplex PCR | Initial Activation | 1 | 95° C; 15 min |
Amplification | 25 | Denaturation: 94° C; 15 sec | |
Annealing: 66° C; 15 sec |
Component | Volume (µl)* | Final Concentration |
---|---|---|
HotStartTaq™ Master Mix | 25.0 | † |
MgCl2, 25 mM | 1.0 | 2.0 mM‡ |
CC719 (forward primer), 10 µ M | 1.0 | 0.2 µ M |
PDCL661 (forward primer), 10 µ M | 1.0 | 0.2 µ M |
ESSP841 (forward primer), 10 µ M | 1.0 | 0.2 µ M |
CRP999 (reverse primer), 10 µ M | 1.0 | 0.2 µ M |
Sterile deionized water | 19.00 | |
DNA Template (primary amplicon) | 1.0 |
*50 µl total volume
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µ M of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock.