NOTE: Johne's Disease may be viewed as one complete publication file below, or as individual chapter files at johnes.htm |
![]() United States Department of Agriculture ![]() Agricultural Research Service ![]() National Agricultural Library ![]() Animal Welfare Information Center |
Johne's Disease--Mycobacterium avium subsp. paratuberculosis: A Debilitating Enteric Disease of Ruminants
June 2002 (Revised October 2006)
Compiled by: |
There are many loses in the livestock industry as a result of the bacterial disease called Johne's disease. "The disease occurs across the US and many foreign countries and is one of the most economically important disease of cattle." 3. The effects of this contagious disease lead to reduced milk, fetal loss and early death. This disease is caused by a bacterium Mycobacterium avium subsp. paratuberculosis. This family of bacteria causes a variety of disease scourges such as tuberculosis, leporsy, cervical lymphadenitis, Aswimming pool granuloma, chronic pulmonary diseases and Johne's disease. Johne's disease is known to affect cattle, sheep, llamas, camels, goats, farmed deer, bison, and other domestic and wild ruminants. It may be the cause of some wasting diseases in horses and swine. Also, chickens can be successfully infected with it. The disease can also be transmitted to laboratory animals in a laboratory setting. It may also be an agent of the Crohn=s disease in humans. There is conflicting information about the zoonotic risks of the disease, but interaction with diseased animals should be done with caution. Johne's is found world-wide.
The disease. Although the infection is usually acquired early in life, the clinical signs can take 2-6 years to develop. Clinical signs in cattle include severe wasting due to prolonged diarrhea, dehydration, and emaciation with lethal consequences. (In other susceptible animals the clinical signs are somewhat different.) In cattle the intestinal wall becomes thickened and has transverse folds called rugae. The surface looks corrugated. Lymph nodes are also affected and at times there are lesions in the liver, spleen, lungs, kidneys. Infections in the uterus and placenta can lead to congenital infection and abortion. Most cattle are infected when young through contaminated feed, colostrum, milk, contaminated bedding and water. The organism is often shed in large number in the feces and for long periods of time. It can live for long periods in fecal material and depending on the environmental and soil conditions, has been known to survive up to 1 year.
Diagnosis. Diagnosis of the disease in live individual animals is difficult for a number of reasons. To date, "there is no single, good test for paratuberculosis and a combination of tests is often used." 1. It seems that it is easier to diagnosis the presence in a herd as apposed to individual animals. Most of the time, the definitive diagnosis is done after an animal has died. Note that in the bibliography, there is research going on to attempt to develop better diagnostic methods for this difficult disease.
Control measures. There is no satisfactory treatment for the disease. The trend toward intensive has made control more difficult. Disease control is via implementing a variety of production practices. Some of the production practices include culling of affected animals, and removal of calves from dams immediately following birth. The calves are then fed pasturized colostrum that is free of fecal contamination and raising them in a facility that is separate from adult cows. Fecal culturing of all cows in a herd can catch those affected early on. Manure removal and facility cleaning can help control the disease. Since a basic soil discourages bacterial survival in soil, liming of pastures is helpful.
Vaccines used in calfhood can be effective in reducing the incidence, but they do not totally eliminate disease. A more effective vaccine is also being researched at this time, but vaccination does not eliminate the need for good production practices.
Resources used above:
1. Aiello, Susan E. and Asa Mays (eds.) The Merck Veterinary Manual, 8th edition. Whitehouse Station, N. J. The Merck & Co, Inc. 1998, p.537-539.
2. Jones, Thomas Carlyle and Ronald Duncan Hunt. Veterinary Pathology, 5th edition. Philadelphia, Lea & Febiger. 1983. p 648-664.
3. U.S. Department of Agriculture. 1984 Yearbook of Agriculture. Animal Health. Washington, D.C.. The Department. 1984 p. 158-160.
Additional information: Genome Sequencing Completed for Major Dairy Cattle Microbe Manual of Standards Diagnostic Tests and Vaccines. Part 2, Section 2.2, Chapter 2.2.6. Paratuberculosis (Johne's Disease)This document was compiled from various databases. The information is organized alphabetically by author and by publication year. Where there were abstracts in the database, they have been included in this document. The National Agricultural Library call numbers are included.
If the reader is interested in
obtaining copies of the articles, you may request them on inter-library loan
through your local library. Complete document delivery information is available
at http://www.nal.usda.gov/services/request.shtml.
If
you have comments or would like to submit additional information for inclusion
in this document, please contact the compiler at jlarson@nal.usda.gov.
2006 / 2005 / 2004 / 2003 / 2002 / 2001 / 2000 / 1999 / 1998 / 1997 / 1996 / USDA and USDA Sponsored Research
Bielanski, A.; Algire, J.; Randall, G.; Surujballi, O. Risks of
transmitting Mycobacterium avium sp. paratuberculosis by
transfer of in vivo-derived and in vitro-fertilized bovine embryos.
Reproduction, Fertility and Development. 2006; 18(1-2): 212.
ISSN: 1031-3613. Note: 32nd Annual Conference of the International Embryo
Transfer Society, Orlando, Florida, January 7-11, 2006.
NAL Call No.: QP251.R47
Descriptors: Mycobacterium avium subsp.
paratuberculosis, disease transmission risks, fertile bovine embryo
transfer, comparison between in vitro and in vivo.
Rosseels, Valerie; Marche, Sylvie; Roupie, Virginie; Govaerts, Marc;
Godfroid, Jacques; Walravens, Karl; Huygen, Kris. Members of the 30- to
32-kilodalton mycolyl transferase family (Ag85) from culture filtrate of
Mycobactelium avium subsp. paratuberculosis are immunodominant
Th1-type antigens recognized early upon infection in mice and cattle.
Infection and Immunity. 2006; 74(1): 202-212. ISSN: 0019-9567.
URL:
http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Descriptors: calves,
Mycobacterium avium subsp. paratuberculosis strain ATCC 19698,
cattle, B6 bg/bg beige mouse strain, Mycobacterium bovis, vaccine
development, protective antigens, culture filtrate, 10 weeks post experimental
oral infection, lymphoproliferative responses of peripheral blood mononuclear
cells, T cells.
Alvarez, J.; Juan, L. de; Briones, V.; Romero, B.; Aranaz, A.;
Fernandez-Garayzabal, J.F.; Mateos, A. Mycobacterium avium subspecies paratuberculosis in fallow deer and wild
boar in
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8 V641
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Johne’s
disease, disease incidence, fallow deer, wild boar,
Aly, S.S.; Thurmond, M.C. Evaluation of Mycobacterium avium subsp. paratuberculosis infection of dairy cows
attributable to infection status of the dam. Journal of the American Veterinary Medical
Association. 2005;
227(3): 450-454. ISSN: 0003-1488.
URL: http://www.avma.org/
NAL
Call No.: 41.8 AM3
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, dairy cow
infection, transmission levels from mother to calves.
Anonymous. 3rd Annual Symposium of Veterinary
Microbiology and Immunology, Bet
Descriptors: domestic animals, cats,
dogs, cattle, pigs, West Nile virus, Streptococcus, Mycobacterium avium
subsp. paratuberculosis,
laboratory animals, fish, various topics, infectious diseases,
immunology.
Aradaib, I.E.; Abbas, Z.A.; Abbas, B.; El Sanousi, S.M. Evaluation of conventional methods and
nested PCR (nPCR) for detection of paratuberculosis in goats. Veterinary Research
Communications. 2005;
29(5): 381-385. ISSN: 0165-7380.
URL: http://www.springerlink.com/(adb1ua55ubfoab45vpcz30vb)/app/home/journal.asp?referrer=parent&backto=linkingpublicationresults,1:103009,1
NAL
Call No.: SF601.V38
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, clinical aspects,
diagnostic methods, PCR, animal pathology, case reports, paratuberculosis,
postmortem examinations,
Archuleta, Rebecca Joy; Hoppes, Patricia Yvonne; Primm, Todd
P.
Mycobacterium avium, enters a state of metabolic dormancy in response
to starvation. Tuberculosis
URL: http://www.sciencedirect.com/science/journal/14729792
Descriptors: Mycobacterium
avium
complex, biphasic response to starvation, lipid catabolism, mycolate
modification, loss of catalase and urease activities, sensitivity reduction to
antibiotics, atanine tRNA synthetase decline, increase in ribonuclease E levels,
metabolic dormancy, primary reservoir is natural and
municipal water.
Basler, T.; Goethe, R. IRG1 is differentially regulated at the
transcriptional and posttranscriptional level in LPS stimulated and Mycobacterium avium ssp paratuberculosis infected murine
macrophages. Immunobiology. 2005; 210(6-8): 395. ISSN: 0171-2985. Note: Joint Annual Meeting of the German
and Scandinavian Societies of Immunology,
NAL Call
No.: QR180.Z4
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, IRG1 gene,
gene expression, in vitro, murine macrophages.
Begg, D.J.; O'Brien, R.; Mackintosh, C.G.;
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Abstract: Johne's disease in ruminants results in
chronic enteritis caused by the pathogenic bacterium Mycobacterium avium subsp. paratuberculosis. This study examined two M. avium subsp. paratuberculosis strains (JD3 and W),
using different doses and routes of infection, to establish the optimal time
postchallenge when predictable levels of infection, gut lesions, and clinical
disease occur in a large proportion of sheep. While a small proportion (25%) of sheep
challenged with a low-passage-number laboratory culture of M. avium subsp. paratuberculosis (strain W) became
infected, no infection was found in animals exposed to a high-passage-number
culture isolate of strain W. In
contrast, a primary tissue homogenate of
M. avium subsp. paratuberculosis
(JD3) resulted in high (90%) infection rates and gut histopathology following
oral or intratonsillar challenge. The optimal conditions necessary to
produce Johne's disease involve oral inoculation of 3-month-old lambs with four
doses of 5 x 108 CFU of M. avium
subsp. paratuberculosis isolated
directly from the gut lymphatic tissues of clinically affected sheep. This resulted in consistent gut
histopathology at 9 months and the onset of clinical disease by 11 months
postchallenge.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, strain
comparison, strain W, strain JD3, animal disease model, oral inoculations of
lambs, dosing regimen, optimum conditions, dosing age.
Begg, D.J.;
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
Neoparasec (TM) vaccine, comparison study, aqueous formulation of Map 316F
(AquaVax), tested in sheep,
vaccination and challenge with virulent strain, immunological study,
blood, lymphoid tissue in gut, CD4(+), CD8(+), CD25(+), B
cells.
Berghaus, Roy D.; Lombard, Jason E.; Gardner, Ian A.; Farver, Thomas
B. Factor analysis of a Johne's disease risk
assessment questionnaire with evaluation of factor scores and a subset of
original questions as predictors of observed clinical
paratuberculosis. Preventive Veterinary
Medicine. 2005; 72(3-4):
291-309. ISSN: 0167-5877.
URL: http://www.sciencedirect.com/science/journal/01675877
NAL Call
No.: SF601.P7
Descriptors: Johne’s disease risk
assessment, 815 US dairy operations, questionnaire of 38 variables, model based
logistic regression analysis, predictive ability of variables, suggested
revision of questionnaire,
Biet, Franck; Boschiroli, Maria Laura; Thorel, Marie Francoise; Guilloteau,
Laurence A. Zoonotic aspects of Mycobacterium bovis and Mycobacterium avium intracellulare
complex (MAC). Veterinary Research. 2005; 36(3):
411-436. ISSN: 0928-4249.
NAL Call
No.: SF602.A5
Descriptors: livestock, cattle,
humans, wildlife, Mycobacterium bovis,
Mycobacterium, Mycobacterium avium
subsp. paratuberculosis, disease
transmission, acquired immune deficiency syndrome, disease control programs,
environmental reservoirs of pathogens, epidemiology, tuberculosis, zoonoses,
Johne’s disease, Crohn’s disease.
Bires, J.; Juras, M.; Beracova, L. Plan kontroly a
eradikacie paratuberkulozy na Slovensku.
[Plan for paratuberculosis control and eradication in
Descriptors: cattle, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, disease control
programs, disease prevalence, disease prevention, epidemiology, paratuberculosis.
Bogli-Stuber, K.; Kohler, C.; Seitert, G.; Glanemann, B.; Antognoli, M.C.;
Salman, M.D.; Wittenbrink, M.M.; Wittwer, M.; Wassenaar, T.; Jemmi, T.;
Bissig-Choisat, B. Detection of Mycobacterium avium subspecies paratuberculosis in Swiss dairy cattle
by real-time PCR and culture: a comparison of the two assays. Journal of Applied Microbiology.
2005; 99(3): 587-597. ISSN: 1364-5072.
URL: http://www.blackwellpublishing.com/journal.asp?ref=1364-5072
NAL
Call No.: QR1.J687
Descriptors: Swiss dairy cattle,
diagnostic assays, Mycobacterium avium
subsp. paratuberculosis, fecal
sampling, 13 dairy herds, in vitro culture, real time PCR, alternative method,
Switzerland.
Bradley, T.L.; Cannon, R.M. Determining the sensitivity of abattoir
surveillance for ovine Johne's disease. Australian Veterinary Journal.
2005; 83(10): 633-636. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8
AU72
Descriptors: sheep, Johne's disease,
intestinal tract lesions, post slaughter sampling, diagnostic test validation,
histopathological examination, experienced meat inspectors, sheep
identification, inspector surveillance was 70%.
Brugere-Picoux, J.; Maillard, R.; Douart, A. Paratubercolosi: quali test diagnostici
utilizzare? [Paratuberculosis:
which diagnostic tests to use?]
Summa. 2005; 22(6): 50-54, 2. Note: In Italian with an English summary.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, diagnostic
assays, fecal culture, PCR, mesenteric lymph note biopsy, immunological methods,
complement fixation, indirect immunofluorescence, gel precipitation test, ELISA,
review of advantages and disadvantages.
Bujnakova, D.; Melicharek,
Descriptors: cattle, fecal sampling,
PCR, IS900, Mycobacterium avium
subsp. paratuberculosis,
detection method, quantitative analysis,
Bulte, Michael; Schoenenbruecher, Holger; Abdulmawjood,
Amir. From farm to fork - Mycobacterium avium ssp. paratuberculosis (MAP) als Zoonoseerreger?
[From farm to fork - Mycobacterium
avium ssp paratuberculosis (MAP)
as zoonotic agent?] Berliner und Munchener Tierarztliche
Wochenschrift. 2005; 118(9-10):
377-385. ISSN: 0005-9366. Note: In German with an English summary.
NAL Call No.: 41.8 B45
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Crohn’s
disease, potential zoonotic disease, transmission from infected animals to
humans, intensive research for diagnosis, valid epidemiological
investigations.
Cheng, J.; Bull, T.J.; Dalton, P.; Cen, S.; Finlayson, C.; Hermon Taylor, J.
Mycobacterium avium subspecies paratuberculosis in the inflamed gut
tissues of patients with Crohn's disease in
URL:http://www.springerlink.com/(dtfvovf5jv3uot2uol4kxtvj)/app/home/journal.asp?referrer=parent&backto=linkingpublicationresults,1:100229,1
NAL
Call No.: QR1.M562
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Johne’s
disease, Crohn’s disease, milk production and consumption increases in China, Mycobacterium avium subsp. paratuberculosis in intestines of
human’s with Crohn’s, possible association with Mycobacterium avium subsp. paratuberculosis, recommend testing
dairy herds and retail milk.
Conraths, F.J.; Kohler, H.; Werner, O.; Beer, M.; Depner, K.R.; Geue, L.;
Kaden,V.; Staubach, C.; Potzsch, C.; Schares, G.; Mettenleiter, T.C. The "Friedrich-Loeffler-Institut": past,
present and future of research in infectious diseases of animals. Berliner und Munchener Tierarztliche
Wochenschrift. 2005;
118(9/10): 354-364. ISSN: 0005-9366. Note: In English with a German summary.
NAL Call No.: 41.8
B45
Descriptors: Friedrich-Loeffler-Institut,
research accomplishments, history, poultry, pigs, livestock, animal diseases,
aquatic animals, infectious diseases, biosafety, diagnosis, diagnostic
techniques, foot and mouth disease, neosporosis, parasitoses, paratuberculosis,
prion diseases, swine fever, zoonoses, Aphthovirus, avian influenza, Mycobacterium avium subsp. paratuberculosis, Neospora caninum, swine fever virus,
Germany.
Corn, Joseph L.; Manning, Elizabeth J.B.; Sreevatsan, Srinand; Fischer, John
R.
Isolation of Mycobacterium avium subsp. paratuberculosis from free-ranging birds
and mammals on livestock premises. Applied and Environmental
Microbiology. 2005;
71(11): 6963-6967. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3
AP5
Descriptors: dairy farms, 25
mammalian species sampled, 22 avian species sampled, Mycobacterium avium subsp. paratuberculosis, ileum, liver,
intestinal lymph nodes, feces, radiometric culture, acid fast isolates,
16S/IS900/IS1311 PCR and mycobactin dependency testing, 9 mammals and 3 avian
species were positive, effect probably negative compared to manure, Wisconsin,
Georgia, United States.
Coussens, P.M.; Pudrith, C.B.; Skovgaard, K.; Ren, X.; Suchyta, S.P.; Stabel,
J.R.; Heegaard, P.M.H. Johne's disease in cattle is associated
with enhanced expression of genes encoding IL-5, GATA-3, tissue inhibitors of
matrix metalloproteinases 1 and 2, and factors promoting apoptosis in peripheral
blood mononuclear cells. Veterinary Immunology and
Immunopathology. 2005;
105(3-4): 221-234. ISSN:
0165-2427. Note: In the special issue: Functional Genomics of Host-Pathogen
Interactions in Species of Veterinary Importance, edited by E.J. Glass and
P.M. Coussens.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.: SF757.2.V38
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, cattle
disease, peripheral mononuclear blood cells, enhanced gene expression, IL-5,
GATA-3, tissue inhibitors, metalloproteinases 1 and 2,
apoptosis.
Crossley, Beate M.; Zagmutt Vergara, Francisco J.; Fyock, Terry L.; Whitlock,
Robert H.; Gardner, Ian A. Fecal shedding of Mycobacterium avium subsp. paratuberculosis by dairy
cows. Veterinary
Microbiology. 2005;
107(3-4): 257-263. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: 786 dairy cows; shedding
Mycobacterium avium subsp. paratuberculosis, 93 dairy herds,
disease prevalence, fecal sampling, cultured in Herrold's egg yolk medium,
livestock numbers, seasonal variation, herd size, multivariable negative
binomial model, Pennsylvania.
D'Haese, E.; Dumon,
URL: http://journals.cambridge.org/action/displayJournal?jid=DAR&bVolume=y
NAL
Call No.: 44.8
J823
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, detection in
milk samples, sample pretreatment, solid phase cytometry, detection of viable
cells in 1 day.
Deutz, Armin; Spergser, Joachim; Wagner, Peter; Rosengarten, Renate; Koefer,
Josef. Nachweise von Mycobacterium avium subsp. paratuberculosis bei wildtieren und
rindern in der Steiermark/Osterreich.
[Mycobacterium
avium subsp. paratuberculosis in
wild animal species and cattle in Styria/Austria.] Berliner und Munchener Tierarztliche
Wochenshrift. 2005; 118(7-8):
314-320. ISSN: 0005-9366. Note: In German.
NAL Call No.: 41.8
B45
Descriptors: clinical aspects,
diarrhea, epidemiology, disease prevalence, disease surveys, disease
transmission, fetus, histopathology, liver, lungs, lymph nodes, Johne’s disease,
paratuberculosis, wild animals, cattle, Capra ibex, Capreolus capreolus, red deer, Cervus elaphus, chamois, fallow deer,
foxes, hares, mouflon, Mycobacterium
avium subsp. paratuberculosis,
Austria.
Djonne, B.; Pavlik,
NAL Call
No.: 41.8
AC87
Descriptors: cattle, goats, Mycobacterium avium subsp. paratuberculosis, genotype variation,
51 isolates from goats, 4 isolates from cattle, IS900 RFLP analysis, no
differences in host origin, epidemiological surveys, 5 new RFLP found,
epidemiology, genetic variation, genotypes, paratuberculosis, Norway.
Donat, K.; Eulenberger, Karin; Kaempfer,
NAL Call No.: 41.8 T445
Descriptors: Saxon cattle herds,
blood sampling (55,394) for antibody testing, Mycobacterium avium subsp. paratuberculosis, commercial test
IDEXX Worrstadt, prevalence testing, data on herd positives, Saxony,
Germany.
Douart, A.; Maillard, R. Il controllo della paratubercolosi
bovina. [Monitoring of bovine paratuberculosis.] Summa. 2005;
22(6): 45-48, 2. Note: In Italian with an English summary.
Descriptors: cattle, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, PCR, monitoring programs, disease surveys,
control programs, disease prevention and control, vaccination, paratuberculosis,
Italy.
Dunn, J.R.; Kaneene, J.B.; Grooms, D.L.; Bolin, S.R.; Bolin, C.A.;
Bruning-Fann, C.S. Effects of positive results
for Mycobacterium avium subsp. paratuberculosis as determined by
microbial culture of feces or antibody ELISA on results of caudal fold
tuberculin test and interferon-gamma assay for tuberculosis in
cattle. Journal of the American Veterinary Medical
Association. 2005;
226(3): 429-435. ISSN: 0003-1488.
NAL Call
No.: 41.8 AM3
Descriptors: cattle,
paratuberculosis, Mycobacterium avium
subsp. paratuberculosis, fecal
culture, antibody ELISA, caudal fold TB test, interferon-gamma
assay.
Dupont, Chris; Thompson, Keith; Heuer, Cord; Gicquel, Brigitte; Murray,
Alan. Identification and
characterization of an immunogenic 22 kDa exported protein of Mycobacterium avium subspecies paratuberculosis. Journal of Medical
Microbiology. 2005; 54(11): 1083-1092. ISSN: 0022-2615.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, exported 22
kDa putative lipoprotein, alkaline phosphatase gene fusion library, LppX/LprAFG
family of mycobacterial lipoproteins, antibody to p22, detected in vaccinated
sheep, clinical and subclinical infected cows.
Durham, S. ARS collaborates in regional dairy quality
management alliance. Agricultural
Research. 2005; 53(4):
20. ISSN:
0002-161X.
URL: http://www.ars.usda.gov/is/AR/
NAL Call No.: 1.98 AG84
Descriptors: USDA, Agricultural
Research Service, dairy industry, quality control, best management practices,
dairy products, dairy cows, food safety, animal health, Mycobacterium avium subsp. paratuberculosis, food pathogens, Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, Campylobacter,
genetic techniques and protocols, milk analysis, New York, Pennsylvania,
Vermont.
Elad, D. The 3rd Annual Symposium of Veterinary
Microbiology and Immunology.
Descriptors: dairy cattle, monkeys,
cats, dogs, mice, pigs, fish, various animal diseases, diagnosis, diagnostic
techniques, disease control, ELISA, epidemiology, pathogenesis, genomes,
immunology, macrophages, immune responses, paratuberculosis, gastroenteritis,
relapsing fever, West Nile fever, Mycobacterium avium subsp. paratuberculosis, Borrelia, Streptococcus iniae,
Israel.
Ellingson, J.L.E.; Stabel, J.R.; Radcliff, R.P.; Whitlock, R.H.; Miller,
J.M. Detection of Mycobacterium avium subspecies paratuberculosis in free-ranging bison
(Bison bison) by
PCR. Molecular and Cellular Probes.
2005; 19(3): 219-225. ISSN: 0890-8508.
URL:
NAL
Call No.: RB43.7.M63
Descriptors: North American Bison,
free ranging animals, Mycobacterium avium
subsp. paratuberculosis,
detection with PCR, 25 animals with clinical signs of Johne’s disease, frozen
and paraffin-embedded ileum, jejuniun, ileocecal lymph nodes, post slaughter, Mycobacterium avium subsp. paratuberculosis was
found.
Eppleston, J.; Reddacliff, L.; Windsor, P.; Links,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8
AU72
Descriptors: Johne’s disease, sheep,
vaccination, shedding, Mycobacterium
avium subsp. paratuberculosis,
Gudair, immunologic drug, immunostimulant drug, immunology, disease prevention
and control,
Ezanno, P.; Van Schaik, G.; Weber, M.F.; Heesterbeek,
J.A.P. A
modeling study on the sustainability of a certification-and-monitoring program
for paratuberculosis in cattle. Veterinary Research. 2005; 36(5/6): 811-826. ISSN: 0928-4249.
NAL Call
No.: SF602.A5
Descriptors: cattle, cattle herd
health, disease monitoring, Mycobacterium
avium subsp. paratuberculosis,
Dutch disease control programs, certification disease control, Johne’s disease,
paratuberculosis, computer model.
Gao, Anli; Odumeru, Joseph;
Raymond, Melinda; Mutharia, Lucy.
Development of improved method
for isolation of Mycobacterium avium
subsp. paratuberculosis from bulk
tank milk: Effect of age of milk,
centrifugation, and decontamination. Canadian Journal of Veterinary
Research. 2005; 69(2):
81-87. ISSN: 0830-9000.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=133
NAL
Call No.: SF601.C24
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Johne’s
disease, Crohn’s disease, microbial contamination, isolating Mycobacterium avium subsp. paratuberculosis from bulk raw milk,
spiking with 50-200 colonies/mL, centrifugation, decontamination,
hexadecylpyridinium chloride.
Georgiadis, M.P.; Johnson, W.O.;
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: cattle, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, screening, testing
accuracy, calculation, estimation, sample size, statistical analysis,
techniques, Excel spreadsheet template http://www.epi.ucdavis.edu/diagnostictests/
Godfroid, J.; Delcorps, C.; Irenge, L.M.; Walravens, K.;
Descriptors: wild
Gonzalez, J.; Geijo, M.V.; Garcia-Pariente, C.; Verna, A.; Corpa, J.M.;
Reyes, L.E.; Ferreras, M.C.; Juste, R.A.; Marin, J.F. Garcia; Perez, V. Histopathological classification of lesions
associated with natural paratuberculosis infection in cattle.
Journal of Comparative Pathology. 2005; 133(2-3): 184-196. ISSN: 0021-9975.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6861&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=6091bef4d15aae1adbceffba708c6eb8
Descriptors: Mycobacterium avium
subsp. paratuberculosis, cattle lesions, adult
cows, with and without clinical signs, gut lymphoid tissue, 5 categories of
lesions, ileum, jejunum, intestinal villi, thickening of intestinal
wall.
Grant, Irene R.; Williams, Alan G.; Rowe, Michael T.; Muir, D.
Donald. Efficacy of various pasteurization
time-temperature conditions in combination with homogenization on inactivation
of Mycobacterium avium subsp. paratuberculosis in milk. Applied and Environmental
Microbiology. 2005;
71(6): 2853-2861. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3
AP5
Descriptors: Mycobacterium avium
subsp. paratuberculosis, milk contamination,
homogenization, pathogen inactivation, time/temperature conditions, HTST
pasteurization.
Grant, I.R.; Williams, A.G.; Rowe, M.T.; Muir, D.D. Investigation of the impact of simulated
commercial centrifugation and microfiltration conditions on levels of Mycobacterium avium ssp. paratuberculosis in milk. International Journal of
Dairy Technology. 2005;
58(3): 138-142. ISSN: 1364-727X.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=idt
NAL
Call No.: SF221.I58
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, microbial
contaminate of raw milk, milk processing, decontamination process,
centrifugation, microfiltration.
Griffin, J. Frank T.; Spittle, Evelyn; Rodgers, Christie R.; Liggett, Simon;
Cooper, Marc; Bakker, Douwe; Bannantine, John P. Immunoglobulin G1 enzyme-linked
immunosorbent assay for diagnosis of Johne's disease in
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=84
Descriptors: farmed red deer,
serodiagnosis, Johne’s disease, denatured purified protein derivative (PPDj),
undenatured protoplasmic antigen (PpAg), ELISA, antigen reactivity of IgG1,
compared non pathological and those with pathological
diseases.
Groenendaal, H. Control programs for Johne's disease.
Advances in Dairy Technology Proceedings of
the Western Canadian Dairy Seminar. 2005; 17: 81-94.
ISSN: 1184-0684. Note: Seminar held March 8-11, 2005,
URL: http://www.wcds.afns.ualberta.ca/
NAL
Call No.: SF223.W478
Descriptors: dairy herds,
paratuberculosis, Mycobacterium avium
subsp. paratuberculosis, disease
prevalence, disease surveillance, disease control, simulation models, culling
animals, dairy herd management,
Groenendaal, Huybert. Epidemiologic and Economic Risk Analysis of
Johne's Disease Control. [Wageningen: s.n., 2005?]; 160 p., ill. ISBN: 9085042135. Note: Doctoral dissertation, Wageningen
Universiteit. In
English with a Dutch summary.
NAL
Call No.: DISS F2005041
Descriptors: Mycobacterium
avium
subsp. paratuberculosis,
epidemiology, risk analysis, economic factors, disease control methods, The
Netherlands.
Harwood, D. My goat's got diarrhoea: common causes and
disease management. Veterinary Times.
2005; 35(41): 20-21. ISSN: 1352-9374.
Descriptors: goats, kids, diarrhea,
cause, disease management and control, fluids, acidosis, mineral deficiencies
and therapy, poisonings, common pathogens, etiology, diagnosis, fascioliasis,
parasitoses, salmonellosis, sulfonamides, Clostridium perfringens, Cryptosporidium parvum, Eimeria christenseni, Eimeria ninakohlyakimovae, Escherichia coli, Fasciola, Mycobacterium avium subsp. paratuberculosis, Salmonella, Trichostrongylus, Secernentea,
Strongylida, treatments, anthelmintics, antibiotics, sulfonamides, United
Kingdom.
Hendrick, Steven H.; Kelton, David F.; Leslie, Ken E.; Lissemore, Kerry D.;
Archambault, Marie; Duffield, Todd F. Effect of paratuberculosis on culling, milk
production, and milk quality in dairy herds. Journal of the American Veterinary Medical
Association. 2005;
227(8): 1302-1308. ISSN: 0003-1488.
URL: http://www.avma.org/
NAL
Call No.: 41.8
AM3
Descriptors: Mycobacterium avium
subsp. paratuberculosis, dairy cattle, 9
infected dairy herds, disease effects, culling, milk production, milk quality,
fecal sampling, mycobacterial culture, serum sampling, ELISA testing, mixed
effect and proportional hazards models, disease effects on: 305-day milk levels,
fat, protein production, somatic cell count linear score, potential cow
longevity.
Holstad, G.; Sigurdardottir, O.G.; Storset, A.K.; Tharaldsen, J.; Nyberg, O.;
Schonheit, J.; Djonne, B. Description of the infection
status in a Norwegian cattle herd naturally infected by Mycobacterium avium subsp. paratuberculosis. Acta Veterinaria Scandinavica. 2005; 46(1/2): 45-56. ISSN: 0044-605X. Note: In English with a Danish summary.
NAL Call
No.: 41.8
AC87
Descriptors: dairy cattle, goats, Mycobacterium avium subsp. paratuberculosis, age differences,
serological survey, diagnosis, diagnostic techniques, antibodies, antibody
testing, histopathology, immunoassay, immunodiagnosis, interferon,
paratuberculosis, RFLP, restriction fragment length polymorphism, disease
prevalence, disease surveys, epidemiological surveys, epidemiology
seroprevalence, surveillance and control program, Norway.
Hostetter,J.; Huffman, E.; Byl, K.; Steadham, E.
Inducible nitric oxide synthase
immunoreactivity in the granulomatous intestinal lesions of naturally occurring
bovine Johne's disease. Veterinary Pathology. 2005; 42(3): 241-249. ISSN: 0300-9858.
URL: http://www.vetpathology.org/contents-by-date.0.shtml
NAL
Call No.: 41.8 P27
Abstract: Inducible nitric oxide synthase (iNOS)
is important in the control of a number of intracellular pathogens, including
mycobacteria, and is a marker of classic macrophage activation. In human granulomatous diseases such as
leprosy, a spectrum of granulomatous lesions is described, ranging from the
tuberculoid to lepromatous types. Tuberculoid granulomas are associated
with enhanced iNOS production and improved clinical outcomes over the
lepromatous types. The aim of this
study is to determine whether an association exists between morphology of bovine
Johne's disease granulomas and lesion macrophage effector functions. To accomplish this, we retrospectively
evaluated 24 cases of bovine Johne's disease. In each case, we recorded the predominant
granuloma morphology and evaluated iNOS immunoreactivity and bacterial burden by
acid-fast stains and mycobacterial immunolabeling. The results of this study demonstrate
that all cases had granulomas with features most similar to the lepromatous
type. This morphology correlated with heavy bacterial burdens demonstrated by
acid-fast staining and mycobacterial immunoreactivity. None of the cases had high expression of
iNOS in mycobacterial-positive granulomas. When iNOS immunoreactivity was
identified, it was usually located near the crypts and was distinct from the
granulomatous foci.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, iNOS,
morphology of bovine Johne's disease granulomas, lesion macrophage effector
functions, granuloma morphology, acid-fast stains, mycobacterial immunolabeling,
crypts.
Hostetter, Jesse Michael; Steadham, Edward. Immune scrum opsonization effects on
non-tuberculous mycobacterial interaction with macrophages. FASEB
Journal. 2005; 19(5, Suppl. S, Pt. 2): A1515.
ISSN: 0892-6638. Note: Experimental Biology 2005 Meeting, 35th
International Congress of Physiological Sciences,
URL: http://www.fasebj.org/contents-by-date.0.shtml
NAL
Call No.: QH301.F3
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, antibody is
opsonizing, may promote killing, independent of nitric oxide and phagosome
acidification.
Hostetter, J.; Kagan, R.; Steadham, E. Opsonization effects on Mycobacterium avium subsp. paratuberculosis-macrophage
interactions. Clinical and Diagnostic
Laboratory Immunology. 2005; 12(6): 793-796. ISSN: 1071-412X.
URL: http://www.fasebj.org/contents-by-date.0.shtml
NAL
Call No.:
RB46.5
Descriptors: macrophages, ability to
limit proliferation of bacteria, opsonized Mycobacterium avium subsp.
paratuberculosis.
Hughes, M.S.; Ball, N.W.; McCarroll, J.; Erskine, M.; Taylor, M.J.; Pollock,
J.M.; Skuce, R.A.; Neill, S.D. Molecular analyses of mycobacteria other
than the M-tuberculosis complex
isolated from
URL: http://www.sciencedirect.com/science/journal/03781135
NAL Call No.: SF601.V44
Descriptors: cattle, antigens, genes,
bovine tuberculosis, Johne’s disease, diagnostic techniques, Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium
kansasii, Mycobacterium bovis, Mycobacterium malmoense, Mycobacterium bohemicum, Mycobacterium holsaticum, Mycobacterium nonchromogenicum, Mycobacterium palustre, Mycobacterium sp. IWGMT-90210, Mycobacterium sp. LIV-2129, Northern
Ireland, United Kingdom.
Huntley, J.F.J.; Whitlock, R.H.; Bannantine, J.P.; Stabel, J.R. Comparison of
diagnostic detection methods for Mycobacterium avium subsp. paratuberculosis in North American
Bison. Veterinary Pathology. 2005; 42(1): 42-51. ISSN: 0300-9858.
URL: http://www.vetpathology.org/contents-by-date.0.shtml
NAL
Call No.: 41.8 P27
Abstract: Tissues and fecal material were
collected from 14 North American Bison (Bison bison) that were suspected of
having Johne's disease and analyzed for the presence of Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis). Sections of ileum, ileal-cecal lymph
node, and three sequential sections of jejunum with their associated mesenteric
lymph nodes were taken from each animal. Fecal culture indicated that 5 of 14
(35.7%) animals were infected, whereas cultures from tissues detected 12 of 14
(85.7%) animals as infected and 59 of 111 (53.2%) of the tissues as positive for
M. paratuberculosis. Polymerase chain reaction analysis
identified infection in 14 of 14 (100%) animals and in 91 of 112 (81.2%)
tissues. In addition, tissues were
processed for Ziehl-Neelsen acid-fast staining, auramine O/acridine orange
fluorescent staining, and immunohistochemical staining. Ziehl-Neelsen and
auramine O staining identified 7 of 14 (50%) and 5 of 14 (35.7%) animals as
infected and 24 of 112 (21.4%) and 28 of 112 (25%) tissues as positive,
respectively. Immunohistochemical
analyses of bison tissues, using antisera collected from rabbits immunized with
four different preparations of M.
paratuberculosis, identified a greater percentage of infected animals
(ranging from 57 to 93%) and positive tissues (ranging from 28 to 46%). Collectively, these data indicate that
DNA-based detection of M.
paratuberculosis was more sensitive than bacterial culture or staining,
identified infection in all the bison, and detected the greatest number of
positive tissues within each animal.
Descriptors: North American Bison,
possible Johne’s disease, tissue and fecal sampling, Mycobacterium avium subsp. paratuberculosis, ileum, ileal-cecal
lymph node, and three sequential sections of jejunum & associated mesenteric
lymph nodes, fecal culture, PCR analysis, Ziehl-Neelsen acid-fast staining,
auramine O/acridine orange fluorescent staining, and immunohistochemical
staining, sensitivity of various detection methods.
Huntley, J.F.; Stabel, J.R.; Paustian, M.L.; Reinhardt, T.A.; Bannantine,
J.P. Expression library immunization confers
protection against Mycobacterium
avium subsp. paratuberculosis
infection. Infection and Immunity. 2005; 73(10): 6877-6884. ISSN:
0019-9567.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Descriptors: expression library
immunization, Mycobacterium avium
subsp. paratuberculosis, DNA
vaccines, mice immunization, gene gun delivery, live virulent strain challenge,
26 antigens seem to generate protection.
Huntley, Jason F.J.; Stabel, Judith R.; Bannantine, John
P.
Immunoreactivity of the Mycobacterium avium subsp. paratuberculosis 19-kDa
lipoprotein. BMC Microbiology. 2005; 5(January 21). ISSN:
1471-2180.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=44
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, gene encoding 19-kDa
lipoprotein, immunomodulator, Johne’s disease, MAP0261, IFN gamma production
measured in infected cows, sera testing, not sensitive enough for an
assay.
Ikiz, Serkan; Bagcigil, A. Funda; Ak, Seyyal; Ozgur, N. Yakut; Lgaz,
Atilla. Paratuberculosis in cattle in
NAL Call No.: 41.8
M463
Descriptors: cattle, adult animals,
fecal sampling, Mycobacterium avium
subsp. paratuberculosis, PCR, IS900
gene, results negative, recommended further studies, Trakya,
Turkey.
Jansen, J.; Godkin, A. Raising Johne's-free calves.
Advances in Dairy Technology.
Proceedings of the Western Canadian Dairy
Seminar. 2005; 17: 217-225. ISSN: 1184-0684. Note: Seminar held March 8-11, 2005,
URL: http://www.wcds.afns.ualberta.ca/
NAL Call No.: SF223.W478
Descriptors: paratuberculosis,
Johne’s disease prevention, Mycobacterium avium subsp. paratuberculosis, disease transmission,
dairy herd management, cattle manure management.
Juan, L. de ; Mateos, A.; Dominguez, L.; Sharp,
J.M.; Stevenson, K. Genetic diversity of Mycobacterium avium subspecies paratuberculosis isolates from goats
detected by pulsed-field gel electrophoresis. Veterinary Microbiology. 2005; 106(3-4): 249-257. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL Call No.: SF601.V44
Descriptors: goats, sheep, diagnosis,
Mycobacterium avium subsp. paratuberculosis, 44 clinical isolates
characterized, epidemiology, diagnostic techniques, genetic diversity,
genotypes, PCR, pulsed field electrophoresis, RFLP.
Jubb, T.F. The effect of interpreting an ELISA at a
lower cut-off on detection of clinical cases of bovine Johne's
disease. Australian Veterinary
Journal. 2005; 83(5):
305-307. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, diagnosis, ELISA
testing, positive results interpretation.
Judge, Johanna; Kyriazakis, Ilias; Greig, Alastair; Allcroft, David J.;
Hutchings, Michael R. Clustering of Mycobacterium avium subsp. paratuberculosis in rabbits and the
environment: How hot is a hot spot. Applied and Environmental
Microbiology. 2005;
71(10): 6033-6038. ISSN:
0099-2240.
URL: http://aem.asm.org/contents-by-date.0.shtml
NAL Call No.: 448.3 AP5
Abstract: Clustering of pathogens
in the environment leads to hot spots of diseases at local, regional, national,
and international levels.
Descriptors: Mycobacterium avium subsp. paratuberculosis, cattle, epidemiology,
rabbits are a reservoirs, spatial and temporal dynamics, environmental patterns
of infection, seasonal effects, spatial distribution of pathogen, Johne’s
disease, disease transmission, disease prevalence, seasonal variation, risk to
livestock, Scotland.
Judge, J.; Greig, A.; Kyriazakis,
URL: http://www.sciencedirect.com/science/journal/01678809
NAL
Call No.: S601.A34
Descriptors: cattle, sheep, rabbits,
contaminated rabbit droppings, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
contaminated pastures, disease transmission via ingestion of feces while
grazing, risks to herbivores, grazing study, no avoidance of droppings,
plant-height affects levels of ingestion of rabbit droppings, United
Kingdom.
Juste, R.A.; Garrido, J.M.; Geijo, M.; Elguezabal, N.; Aduriz, G.;
Atxaerandio, R.; Sevilla, I. Comparison of blood
polymerase chain reaction and enzyme-linked immunosorbent assay for detection of
Mycobacterium avium subsp. paratuberculosis infection in cattle
and sheep. Journal of Veterinary
Diagnostic Investigation. 2005; 17(4): 354-359. ISSN: 1040-6387.
NAL Call No.: SF774.J68
Descriptors: cattle, cows, heifers,
sheep, ewes, lambs, Mycobacterium
avium subsp. paratuberculosis
infection, Johne’s disease, diagnosis, diagnostic techniques, ELISA assay, PCR,
blood test comparison, test accuracy.
Kiehnbaum,
NAL Call No.: SF774.J68
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, bacterial clones,
genetic diversity, amplified fragment length, polymorphism, methods,
Koo, HyeCheong; Park,YongHo; Ahn, JongSam; Waters, W.R.; Palmer, M.V.;
Hamilton, M.J.; Barrington, G; Mosaad, A.A.; Park, KunTaek; Jung,WooKyung;
Hwang, InYeong; Cho, SangNae; Shin, S.J.; Davis, W.C. Use of rMPB70 protein and ESAT-6 peptide as
antigens for comparison of the enzyme-linked immunosorbent,
immunochromatographic, and latex bead agglutination assays for serodiagnosis of
bovine tuberculosis. Journal of Clinical Microbiology.
2005; 43(9): 4498-4506.
ISSN: 0095-1137.
Descriptors: cattle, deer, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium, Mycobacterium bovis
early secretory antigenic target 6 (ESAT6-p) and a recombinant major
secreted immunogenic protein (rMPB70), recombinant major secreted immunogenic
protein (rMPB70) of Mycobacterium
bovis, assays, diagnostic techniques, ELISA, immunodiagnosis, mycobacterial
diseases, tuberculosis.
Kudahl, A.B. Economic consequences of paratuberculosis
control in dairy cattle herds. DIAS Report, Animal Husbandry. 2005; (63): 127 p. ISSN: 1397-9892. Note: A thesis from the Danish
URL: http://www.digisource.dk/
Descriptors: dairy cattle, dairy
herds, paratuberculosis, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, economics impact of
disease, different control strategies, simulation model, herd specific decision
support for dairy farmers.
Lagunas Solar, M.C.; Cullor, J.S.; Zeng, N.X.; Truong, T.D.; Essert, T K;
Smith, W.L.; Pina, C.. Disinfection of dairy and
animal farm wastewater with radiofrequency power. Journal of Dairy Science. 2005; 88(11): 4120-4131. ISSN: 0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: dairy operations,
livestock facilities, waste water decontamination, radiofrequency power
technology, thermal disinfection, experimental inoculated, pathogens monitored,
Salmonella sp., Escherichia coli O157: H7, and Mycobacterium avium subsp. paratuberculosis, alternative
methodology,
Langelaar, Merel F.M.; Weber, Corinna N.; Overdijk, Marije B.; Mueller,
Kerstin E.; Koets, Ad P.; Rutten, Victor P.M.G. Cytokine gene expression profiles of bovine
dendritic cells after interaction with Mycobacterium avium ssp paratuberculosis (M.a.p.), Escherichia coli (E coli) or recombinant M.a.p. heat shock
protein 70. Veterinary Immunology and
Immunopathology. 2005;
107(1-2): 153-161. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.: SF757.2.V38
Descriptors: Mycobacterium avium
subsp.
paratuberculosis, Escherichia coli, recombinant heat shock
protein 70 (M.a.p.) cytokine gene
expression, bovine dendritic cells, bovine IL-12 gene, bovine interleukin-12
gene, expression, bovine IL-1 beta gene, interleukin-1 beta gene, expression,
bovine IL-6 gene expression.
Langelaar, M.F.M.; Hope, J.C.; Rutten, V.P.M.G.; Noordhuizen, J.P.T.M.; Van
Eden, W.; Koets, A.P. Mycobacterium avium ssp paratuberculosis recombinant heat shock
protein 70 interaction with different bovine antigen-presenting
cells. Scandinavian Journal of
Immunology. 2005; 61(3):
242-250. ISSN: 0300-9475.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=sji
NAL
Call No.: QR180.53
Descriptors: recombinant Hsp 70, Mycobacterium avium subsp. paratuberculosis, bovine peripheral
blood mononuclear cells, CD14 (+), characterized monocyte-derived macrophages,
monocyte derived dendritic cells (DC), BoMac, an immortalized bovine macrophage
cell line.
Lei, Liying; Hostetter, Jesse M. Effects of Mycobacteria avium subspecies paratuberculosis infection on bovine
dendritic cell surface marker expression. FASEB Journal. 2005; 19(4, Suppl. S, Pt. 1): A965. ISSN: 0892-6638. Note: Experimental Biology 2005 Meeting, 35th
International Congress of Physiological Sciences,
URL: http://www.fasebj.org/contents-by-date.0.shtml
NAL
Call No.: QH301.F3
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, infected
bovine CD14(+) monocytes, cultured for dendritic cell differentiation in vivo,
host immune response, down-regulation of MHCII expression on
DCs.
Leine, N. Smittesaneringsprosjektet "Friskere geiter". [Disease eradication
project "Healthier goats.”]
Norsk
Veterinaertidsskrift. 2005;
117(5): 360-362. ISSN: 0332-5741. Note: In
Norweigian.
Descriptors: goats, goat diseases,
preventive medicine, Mycobacterium
avium subsp. paratuberculosis, Corynebacterium pseudotuberculosis,
caprine arthritis encephalitis,
Li, Lingling; Bannantine, John P.; Zhang, Qing; Amonsin, Alongkorn; May,
Barbara J.; Alt, David; Banerji, Nilanjana; Kanjilal, Sagarika; Kapur, Vivek.
The complete genome sequence of Mycobacterium avium subspecies paratuberculosis.
Proceedings of the
URL: http://www.pnas.org/contents-by-date.0.shtml
NAL
Call No.: 500
N21P
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, strain K-10,
pathogenic strain of Johne’s, cattle, ruminants, sequence data, description of
the genome, comparison with Mtb.
Lindstedt, Bjorn Arne. Multiple-locus variable number tandem
repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis. 2005; 26(13): 2567-2582.
ISSN: 0173-0835.
Descriptors: DNA fingerprinting,
identifying, tracing, preventing dissemination, pathogenic bacteria, review
article, VNTRs, MLVA, advantages and disadvantages, many species listed
including Mycobacterium tuberculosis,
Mycobacterium bovis, Mycobacterium avium subsp. paratuberculosis.
Lombard, Jason E.; Garry, Franklyn B.; McCluskey, Brian J.; Wagner, Bruce
A.
Risk of removal and effects on milk
production associated with paratuberculosis status in dairy cows. Journal of the American Veterinary Medical
Association. 2005;
227(12): 1975-1981. ISSN: 0003-1488.
URL: http://www.avma.org/
NAL
Call No.: 41.8 AM3
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, National Animal Health
Monitoring System Dairy 2002, serum evaluation, ELISA for antibodies, Dairy Herd
Improvement Association records, current and historical lactation data,
premature removal, culling data, reduced milk production, strong positives for
Johne’s, milk composition seemed unchanged, economic
impacts.
Losinger, W.C. Economic impact of reduced milk production
associated with Johne's disease on dairy operations in the
URL: http://journals.cambridge.org/action/displayJournal?jid=DAR&bVolume=y
NAL
Call No.: 44.8 J823
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Johne’s
disease, dairy cattle, reduced milk production, economic impact,
Machackova-Kopecna, M.; Bartos, M.; Straka, M.; Ludvik, V.; Svastova, P.;
Alvarez, J.; Lamka, J.; Trcka, I.; Treml, F.; Parmova, I.; Pavlik, I. Paratuberculosis and avian tuberculosis
infections in one
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: red deer farm herd, Cervus elaphus, Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, animal slaughter,
levels of infection of different Mycobacterium species, liver, lymph
nodes, spleen, tuberculosis, Johne’s disease, mixed infections,
paratuberculosis, RFLP, restriction
fragment length polymorphism.
Mackintosh, C.G.; Labes, R.E.;
NAL Call
No.: 41.8
N483
Descriptors: farmed
Marsh, I.B.; Whittington, R.J. Deletion of an mmpL gene and multiple
associated genes from the genome of the S strain of Mycobacterium avium subsp. paratuberculosis identified by
representational difference analysis and in silico analysis. Molecular and Cellular Probes.
2005; 19(6): 371-384. ISSN:
0890-8508.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6959&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=a1d954773ca83f03ff7b5c0d870580ef
NAL
Call No.: RB43.7.M63
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, cattle (C)
and sheep (S) strains, strain differences, unique genetic differences, DNA
deletions, loss of mmpL5 and mrnpS5 genes, homologues of M. tuberculosis genes, Rv2002 (fabG3),
Rv2017c (lipW), Rv3132c (devS), Rv2032 (acg), conserved hypothetical genes
Rv2005c and Rv2026c.
McDonald, Wendy L.; O'Riley, Kimberly J.; Schroen, Christopher J; Condron,
Robin J. Heat inactivation of Mycobacterium avium subsp. paratuberculosis in milk.
Applied and
Environmental Microbiology. 2005; 71(4): 1785-1789. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3
AP5
Descriptors: Mycobacterium avium subsp. paratuberculosis, raw milk, heat
treatment, effective pasteurization, 3 temperature levels, 3 time levels,
industrial pasteurizer, equipment size and flow rates, spiked raw milk, all
experimental time and temperature levels were effective.
McKenna, S.L.B.; Keefe, G.P.; Barkema, H.W.;
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, ELISA,
antibody detection sensitivity, post mortem tissue and fecal sampling, dairy
cattle, non-absorbed indirect assay, absorbed indirect assays, comparison
study.
McKenna, S.L.B.; Sockett, D.C.; Keefe, G.P.; McClure, J.; Van Leeuwen, J.A.;
Barkema, H.W. Comparison of two enzyme-linked
immunosorbent assays for diagnosis of Mycobacterium avium subsp. paratuberculosis. Journal of Veterinary Diagnostic
Investigation. 2005;
17(5): 463-466. ISSN:
1040-6387
URL: http://jvdi.org/cgi/reprint/17/5/463?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&author1=McKenna,+S&searchid=1&FIRSTINDEX=0&sortspec=relevance&resourcetype=HWCIT
NAL
Call No.: SF774.J68
Descriptors: 383 dairy cows, 8 herds,
Johne’s disease, sera and fecal testing, Mycobacterium avium subsp. paratuberculosis, bacterial antigens,
protoplasmic antigen, lipoarabinomannan-based antigen, diagnosis, diagnostic
techniques, absorbed ELISA was best, non-absorbed ELISA, specificity,
sensitivity, immunodiagnosis, paratuberculosis, Wisconsin, United
States.
Motiwala, Alifiya S.; Strother, Megan; Theus, Natalie E.; Stich, Roger W.;
Byrum, Beverly; Shulaw, William P.; Kapur, Vivek; Sreevatsan, Srinand. Rapid detection and
typing of strains of Mycobacterium
avium subsp. paratuberculosis
from broth cultures. Journal of Clinical Microbiology.
2005; 43(5): 2111-2117. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=81
NAL
Call No.: QR46.J6
Abstract: A liquid culture
followed by molecular confirmation was evaluated for potential to improve
sensitivity and reduce time to diagnosis of Mycobacterium avium subsp. paratuberculosis infection. Fecal samples from 240 animals from Ohio
farms were assessed for presence of M.
avium subsp. paratuberculosis
using four different protocols: (i) sedimentation processing followed by
inoculation on Herrold's Egg Yolk media (HEYM) slants (monitored biweekly up to
16 weeks), (ii) double centrifugation processing followed by inoculation on HEYM
slants (monitored biweekly up to 16 weeks), (iii) liquid-solid double culture
method using modified 7H9 broth (8 weeks) followed by subculture on HEYM slants
(monitored up to 8 weeks), and (iv) liquid culture using modified 7H9 broth (8
weeks) followed by molecular assays for the presence of two M. avium subsp. paratuberculosis-specific targets. The number of positive samples detected
by each protocol was 37, 53, 65, and 76, respectively. Twenty-seven samples were positive by all
four methods. Based on samples positive by at least one method (n = 81), the
sensitivities for sedimentation processing, double centrifugation processing,
liquid-solid double culture, and liquid culture followed by molecular
confirmation were 46%, 65%, 80%, and 94%, respectively. Fingerprinting of the positive samples
using two polymorphic (G and GGT) short sequence repeat regions identified
varying levels of within-farm and between-farm diversity. Our data indicate that liquid culture
followed by molecular confirmation can significantly improve sensitivity and
reduce time-to-diagnosis (from 16 to 8 weeks) of M. avium subsp. paratuberculosis infection and can also
be efficiently employed for the systematic differentiation of M. avium subsp. paratuberculosis strains to understand
the epidemiology of Johne's disease.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, diagnostic
methods, strain typing, fingerprinting, polymorphic G and GGT short sequence
repeat regions, fecal samples, liquid cultures, molecular confirmation,
sensitivity of diagnostic testing, 4 testing protocols, potential in
epidemiological studies, Ohio, United States.
Munjal, S.K.; Tripathi, B.N.; Paliwal, O.P. Progressive immunopathological changes
during early stages of experimental infection of goats with Mycobacterium avium subspecies paratuberculosis. Veterinary Pathology. 2005; 42(4):427-436. ISSN:
0300-9858.
URL: http://www.vetpathology.org/contents-by-date.0.shtml
NAL
Call No.: 41.8 P27
Abstract: A dose of 1010 Mycobacterium avium subspecies paratuberculosis was administered orally
on seven occasions to produce experimental paratuberculosis infection in 10
5-8-week-old goat kids. Bacteriological, immunological, and
histopathological changes, their relationships, and the efficacy of the commonly
used diagnostic methods were studied during the progressive disease up to 270
days postinfection (DPI). Significant lymphocyte proliferative
responses in the peripheral blood of five goats were detected as early as 60
DPI. A lymphoproliferative test was
also performed on lymphocytes purified from different compartments of the guts
of five infected and five control goats. Significant proliferative responses were
observed in lymphocytes of jejunal compartments of all five goats, of which four
had also significant lymphocyte proliferation in the blood. The ileal lymphocytes from two goats, one
each at 120 and 270 DPI, had significant proliferation. The histological lesions were mainly
observed in the gut-associated lymphoid tissues of the ileocecal valve, the
ileum, and the terminal jejunum. Acid-fast bacilli were demonstrated in
the lesions of two goats at 60 and 210 DPI. Bacterial culture showed poor
sensitivity, detecting positive results for only one goat in the fecal and
tissue samples at 210 DPI, whereas polymerase chain reaction (PCR) detected one
goat in fecal sample at 210 DPI and two goats in tissue samples at 60 and 210
DPIs, respectively. Enzyme-linked
immunosorbent assay and agar gel immunodiffusion test were found to be 100%
sensitive from 180 and 210 DPI onwards, respectively.
Descriptors: young goat kids, Mycobacterium avium subsp. paratuberculosis, oral administration,
experimental infection, bacteriological, immunological, and histopathological
changes, lymphocyte proliferative testing, gut, blood, fecal and tissue
sampling, ELISA assay, agar gel immunodiffusion test.
Nagata, Reiko; Muneta, Yoshihiro; Yoshihara, Kazuhiro; Yokomizo, Yuichi;
Mori, Yasuyuki. Expression cloning of gamma
interferon-inducing antigens of Mycobacterium avium subsp. paratuberculosis. Infection and Immunity. 2005; 73(6): 3778-3782. ISSN: 0019-9567.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Descriptors: Mycobacterium avium
subsp. paratuberculosis, peripheral blood
mononuclear cells of infected cattle, recombinant proteins, Map10, Map39, and
Map41, gamma interferon production, peripheral blood mononuclear cells of
infected cattle.
National Animal Health Monitoring System (
NAL Call No.: SF967.P33 D35 2005
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, dairy cattle, disease
incidence, survey, cattle diseases,
Olsen, Ingrid; Boysen, Preben; Kulberg, Siri; Hope, Jayne C.; Jungersen,
Gregers; Storset, Anne K. Bovine NK cells can produce gamma
interferon in response to the secreted mycobacterial proteins ESAT-6 and MPP14
but not in response to MPB70. Infection and Immunity. 2005; 73(9): 5628-5635. ISSN: 0019-9567.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Descriptors: IFN-gamma of NK cells,
antigen presenting cell, secreted mycobacterial proteins, Mycobacterium avium subsp. paratuberculosis, ESAT-6, MPP14, Mycobacterium tuberculosis, PPD,
interleukin 12, young cattle response.
Palmer, Mitchell V.; Stoffregen, William C.; Carpenter, Jeremy G.; Stabel,
Judith R. Isolation of Mycobacterium avium subsp. paratuberculosis (Map) from feral cats
on a dairy farm with MAP-infected cattle. Journal of Wildlife Diseases.
2005; 41(3): 629-635. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, possible non-cattle
disease reservoirs, feral cats, mice, opossums, mesenteric lymph node, ileum
sampling, interspecies transmission, ingestion of infected feces, infected prey,
Mid Western dairy farm, United States.
Paustian, Michael L.; Kapur, Vivek; Bannantine, John P. Comparative genomic hybridizations reveal
genetic regions within the Mycobacterium
avium complex that are divergent from Mycobacterium avium subsp. paratuberculosis isolates. Journal of Bacteriology. 2005; 187(7): 2406-2415. ISSN: 0021-9193.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=88
NAL
Call No.: 448.3
J82
Descriptors: comparative genomic
study, coding sequence, genomic DNA, open reading frame, Mycobacterium avium subsp. paratuberculosis, whole genome
microarray, Mycobacterium avium
subsp. silvaticum, Mycobacterium avium subsp. avium, Mycobacterium intracellulare, Mycobacterium smegmatis, differentiation
with multiple clusters of divergent ORFs.
Pavlas, M. New findings of pathogenesis, diagnostics
and control of paratuberculosis in cattle.
Acta
Veterinaria Brno. 2005;
74(1): 73-79. ISSN: 0001-7213. NAL
Call No.: SF604.B7
Descriptors: 3620 cattle, 18 farms,
Mycobacterium avium subsp. paratuberculosis, bacteriology,
diagnosis, diagnostic techniques, paratuberculosis, pathogenesis, separation
bacterioscopic method, fecal sampling, young animals, PCR
IS900.
Peddie, S.; Stott, A.; Oglethorpe, D.; Gunn, G. Communicating food-safety risks to key
stakeholders. Eurochoices. 2005; 4(2): 42-49. ISSN: 1478-0917. Note: In English with summaries in German and
French.
Descriptors: cattle, cattle disease,
Johne’s disease as a case studies, communication about food safety, information
regarding risk and uncertainty, Mycobacterium avium subsp. paratuberculosis, risk management, Codex
Alimentarius.
Pickup, R.W.; Rhodes, G.; Arnott, S; Sidi Boumedine, K.; Bull, T.J.;
Weightman, A.; Hurley, M.; Hermon-Taylor, J. Mycobacterium avium subsp. paratuberculosis in the catchment area
and water of the river Taff in South Wales, United Kingdom, an its potential
relationship to clustering of Crohn's disease cases in the city of Cardiff.
Applied and Environmental
Microbiology. 2005; 71(4): 2130-2139. ISSN:
0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.:
448.3
AP5
Descriptors: pastures, livestock
grazing, pasture runoff, bacterial pathogen, Mycobacterium avium subsp. paratuberculosis, bovine strains, water
pollution, Taff River, river water sampling, 32% of samples IS900 PCR positive,
river aerosols, reservoirs, zoonotic potential, Crohn's disease levels in local
humans, epidemiology, human diseases, Cardiff, Wales.
Raizman, E.A.; Wells, S.J.; Jordan, P.A.; DelGiudice, G.D.; Bey,
R.R.
Mycobacterium avium subsp. paratuberculosis from free-ranging deer
and rabbits surrounding
URL: http://canadianveterinarians.net/publications-journal-issue.aspx
NAL
Call No.: SF601.C24
Descriptors: dairy cows, 108 dairy
herds surveyed, fecal sampling and culture, dairy farm management practices,
wild animals, disease reservoir for Mycobacterium avium subsp. paratuberculosis, estimates of disease
prevalence in deer and rabbits, production practices effecting disease
transmission, pasture, dry lot use, manure spreading on crop fields, disease
vectors, Minnesota, United States.
Rajeev, Sreekumari; Zhang, Yan; Sreevatsan, Srinand; Motiwala, Alifiya S;
Byrum, Beverly. Evaluation of multiple genomic targets for
identification and confirmation of Mycobacterium avium subsp. paratuberculosis isolates using
real-time PCR. Veterinary
Microbiology. 2005;
105(3-4): 215-221. ISSN:
0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: multiple genomic
targets, Mycobacterium avium subsp. paratuberculosis, isolates, diagnostic techniques, DNA, genomes,
identification, nucleotide sequences, real time PCR.
Rast, L.; Whittington, R.J. Longitudinal study of the spread of ovine
Johne's disease in a sheep flock in southeastern
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, epidemiology, disease
spread, longitudinal study,
Ravva, Subbarao V.; Stanker, Larry H. Real-time quantitative PCR detection of Mycobacterium avium subsp. paratuberculosis and differentiation
from other mycobacteria using SYBR Green and TaqMan assays. Journal of Microbiological
Methods. 2005; 63(3):
305-317. ISSN:
0167-7012.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=4932&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=541315e5c987176039c95a3602129114
NAL
Call No.: QR65.J68
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, 2 detection
methods, diagnostic methods, SYBR Green bound to PCR products, cleavage of a
fluorogenic (TaqMan) probe, level of sensitivity, Mycobacterium avium subsp. paratuberculosis strain ATCC 19698,
direct cell detection, other mycobacterium species not
detected.
Reddacliff,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, susceptibility to
Johne’s disease, genetic aspects.
Ridge, S.E.; Baker, I.M.; Hannah, M. Effect of compliance with recommended
calf-rearing practices on control of bovine Johne's disease. Australian Veterinary Journal.
Jan/Feb 2005; 83(1-2): 85-90. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, disease control
practices for calves, on the farm prevention, effects of compliance,
Rodriguez-Lazaro, David; D'Agostino, Martin; Herrewegh, Arnold; Pla, Maria;
Cook, Nigel; Ikonomopoulos, John. Real-time PCR-based methods for detection
of Mycobacterium avium subsp. paratuberculosis in water and
milk. International Journal of Food
Microbiology. 2005;
101(1): 93-104. ISSN:
0168-1605.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5061&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=b5ac5281dbf42fb6f6dba9a0316091c5
NAL
Call No.: QR115.I57
Descriptors: PCR assay, Mycobacterium avium subsp. paratuberculosis, 18 isolates, 17
other Mycobacteria strains, pathogen
detection, milk contamination, drinking water contamination, drinking water,
food contamination, methodology, detection levels of less than 3 genomic DNA
copies, 12 cell detection.
Romano, M.I.; Amadio, A.; Bigi, F.; Klepp, L.; Etchechoury, I.; Noto-Llana,
M.; Morsella, C.; Paolicchi, F.; Pavlik, I.; Bartos, M. Further analysis of VNTR and MIRU in the
genome of Mycobacterium avium
complex, and application to molecular epidemiology of isolates from
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: Mycobacterium
avium
complex, animal pathogenic bacteria, loci, genes, genome, epidemiology,
minisatellite repeats, tandem repeat sequences, genetic markers, codons,
nucleotide sequences, genetic variation, Mycobacterium avium subsp. paratuberculosis, bioinformatics,
molecular epidemiology, Mycobacterial Interspersed Repetitive Units, Mycobacterium avium subsp. hominisuis, South America.
Roussel, A.J.; Libal, M.C.; Whitlock, R.L.; Hairgrove, T.B.; Barling, K.S.;
Thompson, J.A. Prevalence of and risk factors for
paratuberculosis in purebred beef cattle. Journal of the American Veterinary Medical
Association. 2005;
226(5): 773-778. ISSN: 0003-1488.
URL: http://www.avma.org/
NAL
Call No.: 41.8
AM3
Descriptors: 4,579 purebred beef
cattle, 115 beef ranches, testing for Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
serum antibody testing, commercial ELISA, culturing of feces from seropositive
animals, disease prevalence, antibodies, risk factors, water source, dairy type
nurse cows, previous clinical signs of Johne’s, species of cattle (Bos taurus vs Bos indicus), location, possible
unexpected serologic results in herds, Texas, United
States.
Salem, M.; Zeid, A.A.;
Hassan, D.; El Sayed, A.; Zschoeck, M. Studies on Johne's disease in Egyptian
cattle. Journal of Veterinary
Medicine Series B. 2005;
52(3): 134-137. ISSN: 0931-1793.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=jvb
NAL
Call No.: 41.8
Z52
Descriptors: 160 Egyptian cows
tested, 40 German cows tested, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
diagnosis, various diagnostic methods, microscopic examination, fecal culture,
PCR, disease distribution, disease prevalence, disease surveys, epidemiological
surveys, epidemiology, Egypt, Germany.
Salgado, M.; Manning, E.J.B.; Collins, M.T. Performance of a Johne's disease
enzyme-linked immunosorbent assay adapted for milk samples from goats. Journal of Veterinary Diagnostic
Investigation. 2005;
17(4): 350-354. ISSN:
1040-6387.
NAL Call No.: SF774.J68
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, ELISA, goat’s milk
samples.
Schleig, P.M.; Buergelt, C.D.;
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: bovine intestinal epithelial cells, organ
cultures, bacterial attachment, bacterial strain differences, methods,
attachment process method, radiolabelled Mycobacterium avium subsp. paratuberculosis strains, mucosal
epithelium, goblet cells, effects of coating with
fibronectin.
Semret, M.; Alexander, D.C.; Turenne, C.Y.; de Haas, P.; Overduin, P.; Van Soolingen, D.; Cousins, D.; Behr,
M.A. Genomic polymorphisms for Mycobacterium avium subsp. paratuberculosis
diagnostics. Journal of Clinical Microbiology.
2005; 43(8): 3704-3712. ISSN:
0095-1137.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=81
NAL
Call No.: QR46.J6
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, Mycobacterium
avium subsp. avium, animal
pathogen, potential zoonotic disease, differential diagnostic assays,
comparative genomic approach, genomic differences, DNA microarray based assay,
Mycobacterium avium subsp. avium strain 104, MAP K10, absence of
LSPA8 was specific for Mycobacterium
avium subsp.
paratuberculosis.
Shin, Sung Jae; Chang, Chao Fu; Chang, Ching Dong; McDonough, Sean P.;
Thompson, Belinda; Yoo, Han Sang; Chang, Yung Fu.
In vitro cellular immune responses to recombinant
antigens of Mycobacterium avium
subsp. paratuberculosis. Infection and Immunity. 2005; 73(8): 5074-5085. ISSN:
0019-9567.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=87
NAL
Call No.: QR1.I57
Descriptors: Mycobacterium avium
subsp. paratuberculosis, in vitro, recombinant
antigens, Ags, 85A, 85B, 85C, superoxide dismutase [SOD], 35-kDa protein,
ability to stimulate peripheral mononuclear ear cells, fecal culture, bacterial
shedding cows, gamma interferon, IL-2, IL-12, TNF alpha, possibly important for
vaccine production.
Sigurdardottir, Olof G.; Bakke-McKellep, Anne Marie; Djonne, Berit; Evensen,
Oystein. Mycobacterium avium subsp. paratuberculosis enters the small
intestinal mucosa of goat kids in areas with and without Peyer's patches as
demonstrated with the everted sleeve method. Comparative Immunology Microbiology and
Infectious Diseases. 2005; 28(3): 223-230. ISSN: 0147-9571.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5003&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=d84c7d4df471489f36fcab6d30fb7920
NAL
Call No.: QR180.C62
Descriptors: goats, young animals,
kids, entry point, Mycobacterium avium
subsp. paratuberculosis, small
intestine, in vitro absorption, everted sleeve method, with and without Peyer’s
patchers, M cells, enterocytes, jejunium.
Simutis, F.J.; Cheville, N.F.; Jones, D.E. Investigation of antigen-specific T-cell
responses and subcutaneous granuloma development during experimental
sensitization of calves with Mycobacterium avium subsp. paratuberculosis. American Journal of Veterinary
Research. 2005; 66(3):
474-482. ISSN: 0002-9645.
URL: http://avmajournals.avma.org/loi/ajvr?cookieSet=1
NAL
Call No.: 41.8 AM3A
Descriptors: calves, experimental
infection and sensitization, Mycobacterium avium subsp. paratuberculosis, antigen specific T
cell responses, granulomas.
Sivakumar, P.; Tripathi, B.N.; Singh, Nem. Detection of Mycobacterium avium subsp. paratuberculosis in intestinal and lymph
node tissues of water buffaloes (Bubalus
bubalis) by PCR and bacterial culture. Veterinary Microbiology. 2005; 108(3-4): 263-270. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: water buffalo, animal
pathogen, intestines, differential diagnosis, genes, histopathology, lymph
nodes, nucleotide sequences, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
PCR, polymerase chain reaction.
Stokka, G.L.; Lardy, G.P. Health management programs: integrating
biological and management principles in analysis, design, and implementation of
programs for two-year-old beef cows. Professional Animal Scientist.
2005; 21(3): 159-163. ISSN: 1080-7446.
NAL Call No.: SF51.P76
Descriptors: beef cows, beef
production, cattle diseases, productions costs, vaccination, disease control
programs, immunity, leptospirosis, bovine diarrhea virus, Mycobacterium avium subsp. paratuberculosis, Neospora, Trichomonas, infectious bovine
rhinotracheitis.
Storset, A.K.; Berg,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.: SF757.2.V38
Descriptors: goats, goat herd
testing, vaccinated and unvaccinated herds, Mycobacterium avium subsp. paratuberculosis, diagnosis, diagnostic
techniques, gamma interferon test, age differences, clinical aspects, immune
response, paratuberculosis, vaccination.
Stott, A.W.; Jones, G.M.; Humphry, R.W.; Gunn, G.J. Financial incentive to control
paratuberculosis (Johne's disease) on dairy farms in the
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8 V641
Descriptors: dairy cows,
paratuberculosis, dairy farm management, disease control, costs and returns,
dynamic programming, estimates of financial incentive for disease control, Mycobacterium avium subsp. paratuberculosis, milk prices,
Stratmann, J.; Homuth, M.; Gerlach, G.F. Uberlegungen zur Kontrolle und Bekampfung
der Paratuberkulose in Milchviehbestanden.
[Considerations with respect to control and eradication
of Johne's disease in dairy herds.] DTW (Deutsche Tieraerztliche Wochenschrift).
2005; 112(8): 304-306. ISSN: 0341-6593. Note: In German.
NAL Call No.: 41.8
D482
Descrptors:
dairy herds, Mycobacterium
avium subsp. paratuberculosis,
5-15% infected, environmental reservoirs, non-ruminant animals, isolation of
heavy shedding herds, potential disease control strategy,
Germany.
Strickland, S.J.; Scott, H.M.; Libal, M.C.; Roussel, A.J.; Jordan,
E.R.
Effects of seasonal climatic conditions on
the diagnosis of Mycobacterium avium
subspecies paratuberculosis in dairy
cattle. Journal of Dairy
Science. 2005; 88(7):
2432-2440. ISSN: 0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8 J822
Abstract: Validity of Johne's
disease programs and control protocols that rely on established cut points
[e.g., specified sample-to-positive (S/P) ratios] for ELISA serological tests
depends on interpreted results that are not susceptible to variable test
accuracy. It was hypothesized that
seasonal variability exists in serological response to Mycobacterium avium subsp. paratuberculosis (MAP) infection. Further, a reciprocal response may occur,
resulting in greater risk of fecal shedding in subclinically infected animals.
A testing regimen was invoked that
included multiple testing of individual adult cows during the 4 seasons. Serum was collected on a cyclic, monthly
basis from 3 randomly selected cohorts of dairy cows, and fecal samples were
collected from the 20% of cows with the greatest ELISA test S/P ratios. Staggered, quarterly sampling was
continued for 1 yr, and at the conclusion, serum was analyzed en masse. The ELISA outcome values (i.e., S/P
ratio) were treated both as categorical and continuous variables. The potential lagged effects of
temperature-related seasonality on S/P ratio, as well as the potential for a
change in test result caused by temperature were assessed. Results for fecal culture were analyzed
on a categorical scale and compared with the ELISA results to explore the
possibility of reciprocal fecal shedding. No significant seasonal effects on
either S/P ratios or the proportion of cows seropositive to MAP were observed.
Furthermore, no evidence was found
linking temperature-related seasonality to a reciprocal increase in the risk of
fecal culture positivity for MAP.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, control
protocols, diagnostic variations, no seasonal variations, multiple testing
during all 4 seasons, serum testing, fecal testing, ELISA test S/P ratios,
temperature effects.
Suanes, A.; Nunez, A.; Piaggio, J.; de Freitas, J.; Zaffaroni, R.; Gil,
A.
Evaluation of diagnostic tests for the
early detection of Johne's disease in a dairy herd in
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, interferon, antibodies, antigens, diagnosis,
diagnostic techniques, ELISA, paratuberculosis, skin tests,
tuberculin.
Szteyn, J.; Wiszniewska, A.; Fus-Szewczyk, M.M. Przeciwciaa swoiste dla Mycobacterium avium subsp. paratuberculosis u byda mlecznego
ponocno-wschodniej Polski.
[Antibodies specific to Mycobacterium avium subsp. paratuberculosis in dairy cows in
northeast
NAL Call
No.: 41.8 M463
Descriptors: dairy cattle, 495
samples, 20 preselected herds, seroprevalence, antibody testing for Mycobacterium avium subsp. paratuberculosis, IDEXX and ELISA kit,
recommend a control program, Poland.
Tasara, T.; Hoelzle, L.E.; Stephan, R. Development and evaluation of a Mycobacterium avium subspecies paratuberculosis (MAP) specific
multiplex PCR assay. International Journal of Food
Microbiology. 2005;
104(3): 279-287. ISSN: 0168-1605.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5061&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=b5ac5281dbf42fb6f6dba9a0316091c5
NAL
Call No.: QR115.I57
Descriptors: Mycobacterium
avium
subsp. paratuberculosis,16S-rRNA
gene; detection assays, PCR, co-amplifies 16S rRNA gene, MAP IS900 and f57
sequences, specificity, false positive IS900 PCR signals in Mycobacterium chelonae, Mycobacterium terrae, Mvcobacterium
xenopi.
Tasara, T.; Stephan, R. Development of an F57 sequence-based
real-time PCR assay for detection of Mycobacterium avium subsp. paratuberculosis in milk.
Applied and Environmental
Microbiology. 2005;
71(10):5957-5968. ISSN:
0099-2240.
URL: http://aem.asm.org/contents-by-date.0.shtml
NAL Call No.: 448.3 AP5
Abstract: A light cycler-based
real-time PCR (LC-PCR) assay that amplifies the F57 sequence of Mycobacterium avium subsp. paratuberculosis was developed. This assay also includes an internal
amplification control template to monitor the amplification conditions in each
reaction. The targeted F57 sequence
element is unique for M. avium
subsp. paratuberculosis and is not
known to exist in any other bacterial species. The assay specificity was demonstrated by
evaluation of 10 known M. avium
subsp. paratuberculosis isolates and
33 other bacterial strains. The
LC-PCR assay has a broad linear range (2 x 101 to 2 x106 copies) for
quantitative estimation of the number of M. avium subsp. paratuberculosis F57 target copies in
positive samples. To maximize the
assay's detection sensitivity, an efficient strategy for isolation of M. avium subsp. paratuberculosis DNA from spiked milk
samples was also developed. The
integrated procedure combining optimal M.
avium subsp. paratuberculosis DNA
isolation and real-time PCR detection had a reproducible detection limit of
about 10 M. avium subsp. paratuberculosis cells per ml when a
starting sample volume of 10 ml of M.
avium subsp.
paratuberculosis-spiked milk was analyzed. The entire process can be completed
within a single working day and is suitable for routine monitoring of milk
samples for M. avium subsp. paratuberculosis contamination. The applicability of this protocol for
naturally contaminated milk was also demonstrated using milk samples from
symptomatic M. avium subsp. paratuberculosis-infected cows, as well
as pooled samples from a dairy herd with a confirmed history of
paratuberculosis.
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, individual
dairy cows, dairy herds pooled milk samples, microbial detection assay for milk,
polymerase chain reaction, PCR, F57 sequence element amplification, evaluation,
assay specificity, animal pathogenic bacteria, disease diagnosis, Johne’s
disease, cattle diseases.
Tiwari, A.; VanLeeuwen, J.A.; Dohoo, I.R.; Stryhn, H.; Keefe, G.P.; Haddad,
J.P. Effects of seropositivity for bovine
leukemia virus, bovine viral diarrhoea virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum on culling in dairy
cattle in four Canadian provinces. Veterinary Microbiology. 2005. 109(3-4): 147-158. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, Neospora caninum, bovine leukemia virus,
bovine diarrhea virus, blood sampling, seropositivity, culling of infected
cattle,
Toft, N.; Nielsen, S.S.; Jorgensen, E. Continuous-data diagnostic tests for
paratuberculosis as a multistage disease. Journal of Dairy Science. 2005; 88(11): 3923-3931. ISSN: 0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, fecal
culture testing scheme, linked to indirect ELISA, adjustments for covariates,
optical density, Bayesian
network.
Tuboly, S.; Kovacs, A.; Lami, E.; Nagy, G. Az ember Crohn-es a szarvasmarha
Johne-betegsege (paratuberculosisa) kozotti osszefuggesek. [Connections between
Crohn’s disease in humans and Johne’s disease (paratuberculosis) in
cattle.] Magyar Allatorvosok
Lapja. 2005; 127(2):
106-112. ISSN: 0025-004X. Note: In Hungarian with an English summary.
Descriptors: cattle, sheep, goats,
wild and captive ruminants, deer, mouflon, antelope, Mycobacterium avium subsp. paratuberculosis, serological screening,
fecal culture, etiology, animal pathology, clinical aspects, diagnosis,
histopathology, pathogenesis, Crohn’s disease, immunodiagnosis, zoonotic
potential, Hungary.
United States. Department of Agriculture.
Johne's Disease on
Descriptors: USDA annual report for
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis, United
States dairy herd operations, herd level management factors, risk assessment,
preweaned and post weaned heifer calves, bred heifers, adult cows, disease
prevalence, disease testing, data and analysis.
Valeeva, N.I.; Meuwissen, M.P.M.; Lansink, A.G.J.M.O.; Huirne,
R.B.M. Improving food safety within the dairy
chain: an application of conjoint analysis. Journal of Dairy Science. 2005; 88(4): 1601-1612. ISSN: 0022-0302.
URL: http://jds.fass.org/cgi/content/abstract/88/4/1601
NAL Call No.: 44.8
J822
Descriptors: milk, production of
pasteurized milk, food safety, residues, quality control, diary farms,
antibiotics, dioxins, consumer preferences, dairy farms, dioxins, feeds,
bacterial contaminants, Escherichia
coli, Mycobacterium avium subsp.
paratuberculosis, Salmonella, Staphylococcus
aureus.
Van Leeuwen, J.A.; Forsythe,
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8 R3224
Descriptors: dairy cattle, immune
response, seroprevalence of antibodies, animal pathogens, bovine leukemia virus,
bovine diarrhea virus, Mycobacterium
avium subsp. paratuberculosis, Neospora canium, Saskatchewan,
Canada.
Van Schaik, Gerdien; Stehman, Susan M; Jacobson, Richard H; Schukken, Ynte
H.; Shin, Sang J; Lein, Donald H. Cow-level evaluation of a kinetics ELISA
with multiple cutoff values to detect fecal shedding of Mycobacterium avium subspecies paratuberculosis in
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.: SF601.P7
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis , Johne’s disease,
herd sampling, unabsorbed kinetics ELISA (KELA) testing, evaluation of
sensitivity and specificity of KELA, fecal shedding, a multiple logistic
regression model, serum sampling, within heard prevalence, New York
State.
Vansnick, E.; Vercammen, F.; Bauwens, L.; D'Haese, E.; Nelis, H.; Geysen,
D.
A survey for Mycobacterium avium subspecies paratuberculosis in the Royal Zoological
Society of
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=7163&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f68d9c40dd58509407a11a133122c879
NAL
Call No.: SF601.V484
Descriptors: Mycobacterium avium
subsp. paratuberculosis, survey, European zoo
survey, ruminant survey, fecal and post mortem sampling, IS900 PCR, serum tested
with ELISA kit, some level of Mycobacterium avium subsp. paratuberculosis was detected, Royal
Zoological Society of Antwerp.
Vaughan, J.A.; Lenghaus, C.; Stewart, D.J.; Tizard, M.L.; Michalski,
W.P.
Development of a Johne's disease infection
model in laboratory rabbits following oral administration of Mycobacterium avium subspecies paratuberculosis. Veterinary Microbiology. 2005; 105(3-4): 207-213. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, laboratory animal
model, oral dosing model.
Walker, Belinda; Yunamu, Yuni and NSW Agriculture. Division of Animal
Industries. NSW Department of Primary
Industries. Bovine Johne's disease: Australian Johne's
disease market assurance program for cattle (CattleMAP). 1st ed. Agnote NSW Agriculture;
330. [2005]. Note: Other title: Australian Johne's Disease Market Assurance
Program for Cattle (CattleMAP). This Agnote is based on an earlier Agnote
(DAI-96) written by Tim Jessep, former Technical Specialist BJD, Goulburn.
URL: http://www.agric.nsw.gov.au/reader/bjd-trading/bjd-aust-cattlemap.htm. Title from web site (viewed June 3,
2005).
NAL Call No.: SF55.A8 A36 no. 330
Descriptors: paratuberculosis, cattle
diseases, prevention, marketing impacts, beef herds, dairy herds, Mycobacterium avium subsp. paratuberculosis, disease control,
disease prevention, quality assurance program, CattleMAP, an Australian Market
Assurance Programme, participants have herds free of Johne’s disease,
Australia.
Weiss, D.J.; Evanson, O.A.; Souza, C. de; Abrahamsen, M.S. A critical role of interleukin-10 in the
response of bovine macrophages to infection by Mycobacterium avium subsp. paratuberculosis. American Journal of
Veterinary Research. 2005; 66(4): 721-726. ISSN:
0002-9645.
NAL Call No.: 41.8 AM3A
Descriptors: immune response, in
vitro cell cultures, bovine macrophages, infection with Mycobacterium avium subsp. paratuberculosis.
Weiss, D.J.; Evanson, O.A.; Souza, C.D. Expression of interleukin-10 and suppressor
of cytokine signaling-3 associated with susceptibility of cattle to infection
with Mycobacterium avium subsp. paratuberculosis. American Journal of Veterinary
Research. July 2005;
66(7): 1114-1120. ISSN:
0002-9645.
NAL Call No.: 41.8 AM3A
Descriptors: cows, Mycobacterium avium subsp. paratuberculosis, cattle, disease
susceptibility, interleukin 10 expression, suppression of cytokine signaling-3,
Johne’s disease, disease resistance, immune response, cytokines, interleukin-10,
interleukin-12, monocytes from cows with subclinical infection, phagocytes,
phagocytosis, phagosomes, tumor necrosis factor, zoonotic diseases.
Wernery, U. The most important infectious diseases in
camelids. In: Faye, B; Esenov, P. [Editors].
Desertification Combat and Food Safety: The Added Value of Camel
Producers,
Descriptors: dromedary camels,
Bactrian camels, list of many diseases, bacterial, viral, and various ecto and
endo parasites, Mycobacterium avium
subsp. paratuberculosis,
Mycobacterium tuberculosis.
Western Australia. Dept. of
Agriculture. Ovine Johne's disease: management
options. Bulletin
NAL Call
No.: S478.A82 W47 no. 4631
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, disease management
possibilities, disease control strategies,
Western Australia. Dept. of Agriculture. Ovine Johne's disease: minimise the
risk. Bulletin
NAL Call No.: S478.A82 W47 no. 4634
Descriptors: sheep, paratuberculosis,
Mycobacterium avium subsp. paratuberculosis, management strategies
to reduce risk of infection,
Western Australia. Dept. of Agriculture. Ovine Johne's disease: SheepMAP. Bulletin
NAL Call No.: S478.A82 W47 no. 4633
Descriptors: sheep, paratuberculosis,
Mycobacterium avium subsp. paratuberculosis, pathogen strains in
sheep,
Western Australia. Dept. of Agriculture. Ovine Johne's disease: the disease.
Bulletin
NAL Call No.: S478.A82 W47 no. 4630
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, sheep, description of
the disease, pathology,
Western Australia. Dept. of
Agriculture. Ovine Johne's disease: vaccination.
Bulletin
NAL Call No.: S478.A82 W47 no. 4632
Descriptors: sheep, paratuberculosis,
Mycobacterium avium subsp. paratuberculosis, control, vaccination,
Whan, L.; Ball, H.J.; Grant, I.R.; Rowe, M.T. Development of an IMS-PCR assay for the
detection of Mycobacterium avium ssp
paratuberculosis in
water. Letters in Applied Microbiology.
2005; 40(4): 269-273. ISSN: 0266-8254.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=lam
NAL
Call No.: QR1.L47
Descriptors:
human diseases, animal diseases, polluted water, Mycobacterium avium subsp. paratuberculosis, detection,
centrifugation, methodology, immunomagnetic separation polymerase chain reaction
(IMS-PCR), IS900 PCR, Tween 80 concentration, sensitive
method.
Whan, Lynne; Ball, Hywel J.; Grant, Irene R.; Rowe, Michael
T.
Occurrence of Mycobacterium avium subsp. paratuberculosis in untreated water in
URL: http://aem.asm.org/contents-by-date.0.shtml
NAL Call No.: 448.3 AP5
Abstract: Mycobacterium
avium
subsp. paratuberculosis is the known
cause of Johne's disease of both domestic and wild ruminants and has been
implicated as a possible cause of Crohn's disease in humans. The organism is shed in the feces of
infected animals and can survive for protracted periods in the environment and
hence could be present in catchment areas receiving agricultural runoff. A limited survey was undertaken in
Descriptors: Mycobacterium avium
subsp. paratuberculosis, bacterial agent of
Johne’s disease of ruminants, possible cause of Crohn’s disease in humans,
survey testing of untreated water, 3 detection methods, immunomagnetic
separation-PCR, culture on Herrold's egg yolk medium (HEYM), BACTEC 12B medium,
15% positive, efficacy of water treatment, possible contamination of
recreational water sources, seasonal differences, Northern Ireland.
Whittington, Richard J.; Marsh, Ian B.; Reddacliff, Leslie
A.
Survival of Mycobacterium avium subsp. paratuberculosis in dam water and
sediment. Applied and Environmental
Microbiology. 2005;
71(9): 5304-5308. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=1214599
NAL Call No.: 448.3
AP5
Descriptors: Mycobacterium
avium
subsp. paratuberculosis, survival in
water, survival in sediment, dam water, large water troughs, sediment in shade,
semi exposed location, fecal material in shade, water as a reservoir for
pathogen, potential for transmission to humans, Crohn’s
disease.
Ali Vehmas, T.; Moisander, A.M.; Soini, H. Yleiskatsaus mykobakterioosien
esiintymisesta ja Suomen tilanteesta.
[Mycobacteriosis - a review and survey in
NAL Call No.: 41.8
F49
Descriptors: pigs, humans, bacterial diseases,
disease surveys, Mycobacterium, Mycobacterium avium complex, Mycobacterium avium subsp. paratuberculosis, Mycobacterium tuberculosis,
epidemiology, diagnosis, drug therapy, isoniazid, rifampicin, zoonoses,
Finland.
Amemori, T.; Matlova, L.; Fischer, O.A.; Ayele, W.Y.; Machackova, M.;
Gopfert, E.; Pavlik, I. Distribution of Mycobacterium avium subsp. paratuberculosis in the gastrointestinal
tract of shedding cows and its application to laparoscopic biopsy. Veterinarni Medicina. 2004; 49(7): 225-236. ISSN: 0375-8427.
URL: http://vetmed.vri.cz/
NAL
Call No.: 41.9
C333
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, sampling of 10 areas
of gastrointestinal tract, distribution of bacteria, jejunum mucosa, to the
ileocecal valve, in the lymph nodes from jejunum to the cecum, laproscopy for
sampling unsuccessful.
Amonsin, A.; Li, L.L.; Zhang, Q.; Bannantine, J.P.; Motiwala, A.S.;
Sreevatsan, S.; Kapur, V. Multilocus short sequence repeat sequencing
approach for differentiating among Mycobacterium avium subsp. paratuberculosis strains. Journal of Clinical Microbiology. 2004; 42(4): 1694-1702. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/abstract/42/4/1694
NAL
Call No.:
QR46.J6
Descriptors: cattle and sheep isolates, 33 Mycobacterium avium subsp. paratuberculosis isolates, bacterial
cattle disease, Johne’s disease, genotyping, 20 multilocus short sequence repeat
(MLSSR) types, 11 polymorphic short sequence repeats (SSRs), genome analysis,
genomes, genotypes, loci, molecular biology, molecular genetics, MLSSR results
in easy, reproducible and high resolution subtyping.
Anderton, Matthew C.; Bhakta, Sanjib; Patrick, Anna L.; Sim, Edith. Characterisation of the putative operon
containing arylamine N-acetyltransferase (NAT) in mycobacteria. Drug Metabolism Reviews. 2004; 36(Suppl. 1): 161. ISSN: 0360-2532. Note: 7th International Meeting of the
International Society for the Study of Xenobiotics,
NAL Call No.:
RM301.D73
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium tuberculosis, Mycobacterium
smegmatis, arylamine N-acetyltransferase, operons, drug
therapy.
Andrews, A.H. Colostrum - not just for 24 hours. Cattle Practice. 2004; 12(2): 121-124. ISSN: 0969-1251.
NAL Call No.:
SF961.C37
Descriptors: calves, nutrition colostrum feeding,
intestinal lining exposed to local immunoglobulins that attach to endothelial
receptors, block ability of pathogens to attach, and reproduce or cause disease,
vaccination of dams for rotovirus, coronovirus, E. coli, Salmonella, Eimeria, Mycobacterium avium subsp.
paratuberculosis.
Ayele, W.Y.; Bartos, M.; Svastova, P.; Pavlik,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: bull calves, breeding bulls, various
breeds, Holstein-Friesian, Piemonte, Hereford, Simmental, natural infection, Mycobacterium avium subsp. paratuberculosis, semen derived
infection, serum, fecal and tissue culture, liver, spleen, testes, sub
clinically infected release Mycobacterium
avium subsp. paratuberculosis in
semen.
Bannantine, J.P.; Hansen, J.K.; Paustian, M.L.; Amonsin, A.; Li, L.L.;
Stabel, J.R.; Kapur, V. Expression and immunogenicity of proteins
encoded by sequences specific to Mycobacterium avium subsp. paratuberculosis. Journal of Clinical Microbiology. 2004; 42(1): 106-114. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/abstract/42/1/106
NAL Call No.:
QR46.J6
Descriptors: cattle, mice, rabbits, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
complex, animal disease models,
laboratory animals, immunoassay as a diagnostic technique, cloning, heterologous
expression, antigenic analysis of Mycobacterium avium subsp. paratuberculosis specific sequences in
Escherichia coli, binding proteins,
gene expression, nucleotide sequences.
Basagoudanavar, S.H.; Goswami, P.P.; Tiwari, V.; Pandey, A.K.; Singh, N.
Heterologous expression of a gene encoding
a 35 kDa protein of Mycobacterium avium
paratuberculosis in Escherichia
coli. Veterinary Research Communications. 2004; 28(3): 209-224. ISSN:
0165-7380.
URL: http://www.kluweronline.com/issn/0165-7380/contents
NAL Call No.: SF601.V38
Descriptors: gene expression, Escherichia coli, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
bacterial proteins, nucleic acid hybridization, genetically engineered
microorganisms, genetic recombination, transposons, polyclonal antibodies,
guinea pigs, laboratory animals, delayed hypersensitivity, cell mediated
immunity, purification, cloning DNA, solubility, cross reaction, open reading
frames, 35kDa protein genes, recombinant surface proteins, immune response,
plasmids, insertion into Escherichia
coli expression plasmid pQE32=pPMP35, was transformed into E. coli M15, expression confirmed with
immunoblotting, reacted with rabbit antiserum to Mycobacterium avium subsp. paratuberculosis, reacted with serum of
infected goat, recognized as a membrane fraction, evoked skin reaction in
sensitized guinea pigs, 35kDa is a membrane protein.
Basler, T.; Geffers, R.; Weiss, S.; Valentin-Weigand, P.; Goethe, R. Macrophages infected with Mycobacterium avium ssp paratuberculosis display a specific gene
expression program and activating capacity towards enterocytes. Immunobiology. 2004; 209(4-6): 392. ISSN: 0171-2985. Note: Joint Annual Meeting of the German and
Dutch Societies for Immunology,
NAL Call No.: QR180.Z4
Descriptors: Mycobacterium avium subsp. paratuberculosis, infected
macrophages, infection response, gene expression, activating capacity, response
to enterocytes.
Beyerbach, M.; Ortmann, G.; Gerlach, G.F.; Homuth, M; Strutzberg, K.;
Kreienbrock, L. Uberlegungen zu diagnostischen Sicherheiten
und Cut-Off-Werten fur einen Sammelmilch-ELISA auf Paratuberkulose. [Considerations concerning diagnostic
probabilities and cut-off values for a Mycobacterium avium ssp.
paratuberculosis bulk milk ELISA.]
DTW (Deutsche Tieraerztliche Wochenschrift).
2004; 111(5): 220-225. ISSN: 0341-6593. Note: In German with an English summary.
NAL Call No.: 41.8
D482
Descriptors: dairy cows, Johne’s
disease, paratuberculosis, Mycobacterium
avium subsp. paratuberculosis,
disease diagnosis, diagnostic techniques, disease prevalence, disease surveys,
ELISA, bulk milk, reference works, regression analysis, mathematical models,
Brandenburg, Germany.
Boettcher, J.; Gangl, A. Mycobacterium avium ssp paratuberculosis - Combined serological
testing and classification of individual animals and herds. Journal of Veterinary Medicine Series B.
2004; 51(10): 443-448. ISSN: 0931-1793.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=jvb
NAL
Call No.: 41.8
Z52
Descriptors: 2748 bovine sera, 119 Bavarian herds, 3
commercial tests, testing scheme proposed, individual animals, herds.
Bowen, J.S. Small ruminant tips for small animal
practitioners. Large Animal Proceedings of the North
American Veterinary Conference,
Descriptors: goats, sheep, small ruminant health,
small animal veterinary practice; veterinarians, animal husbandry, clinical
examination drug residues, metabolic disorders, coccidiosis, enterotoxemia,
pneumonia, scrapie, zoonoses, caprine arthritis encephalitis virus, Clostridium perfringens, Corynebacterium pseudotuberculosis, Mycobacterium avium subsp. paratuberculosis, Mycoplasma, Johne’s
disease.
Bowen, J.S. Tough diseases of goats. Large Animal Proceedings of the North
American Veterinary Conference,
Descriptors: goats, small ruminants, various
diseases, disease transmission, lymph nodes, lymphadenitis, lymphatic diseases,
Johne’s disease, caprine arthritis encephalitis virus, Corynebacterium pseudotuberculosis, Mycobacterium avium subsp. paratuberculosis, Mycoplasma.
Branscum, A.J.;
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: cattle, animal level based on polled
sampling, herd level disease prevalence, epidemiology, Bayesian theory approach,
mathematical models, WinBUGS computer software, animal diseases, Brucella abortus, Salmonella interitidis,
Mycobacterterium avium subsp. paratuberculosis, brucellosis, Johne’s
disease, computer software, diagnostic techniques, disease surveys, California,
United States.
Brumbaugh, G.W.; Simpson, R.B.; Edwards, J.F.; Anders, D.R.; Thomson, T.D.
Susceptibility of Mycobacterium avium subsp. paratuberculosis to monensin sodium or
tilmicosin phosphate in vitro and resulting infectivity in a murine model.
Canadian Journal of Veterinary. 2004; 68(3): 175-181. ISSN: 0830-9000. Note: In English with a French summary.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=133
NAL
Call No.:
SF601.C24
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
antibacterial properties, macrolide antibiotics, cattle diseases, laboratory
mice, infectious disease model.
Buergelt, C.D.; Donovan, G.A.; Williams, J.E. Identification of Mycobacterium avium subspecies paratuberculosis by polymerase chain
reaction in blood and semen of a bull with clinical paratuberculosis. Journal of Applied Research in Veterinary
Medicine. 2004; 2(2):
130-134. ISSN: 1542-2666.
URL: http://www.jarvm.com/
Descriptors: cattle,
Buergelt, C.D.; Williams, J.E. Nested PCR on blood and milk for the
detection of Mycobacterium avium
subsp paratuberculosis DNA in
clinical and subclinical bovine paratuberculosis. Australian Veterinary Journal. 2004; 82(8): 497-503. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: cattle bacterial disease, clinical and
subclinical infections, disease detection and diagnosis, blood sampling, milk
sampling, nested PCR.
Buergelt, C.D.; Bastianello, S.S.; Michel, A.L. Paratuberculosis. In: Coetzer, J.A.W;
NAL Call No.: SF781.I525
2004
Descriptors: livestock, culling infected animals,
etiology, diagnostic techniques, differential diagnostic methods, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis, etiology,
pathogenesis, histopathology, epidemiology, disease prevalence, disease control
and prevention, vaccines, disease transmission, antibacterial agents, clinical
aspects, Crohn's disease, drug therapy, zoonoses, public health
concerns.
Buergelt, C.D.; Williams, J.E.; Monif, G.R.G. Spontaneous clinical regression of Johne's
disease in a
URL: http://www.jarvm.com/
Descriptors: Holstein cow diagnosed with Johnes’s
disease, Mycobacterium avium subsp. paratuberculosis, spontaneous
regression, serologic titers decreased, fecal shedding abated, changes in
environment may have triggered immune and host responses to cure the
disease.
Bull, R.; Brooks, R.; Molesworth, R.; Watt, R. Ovine Johne's Disease Interim Steering
Committee Final Report 2004.
2004; 9 p.
ISBN: 0734716079.
Descriptors: “Building Block for Ovine Johne’s
Disease,” risk based training system, introduction of mandatory health
declaration of all traded sheep, penalties for false information, Guidair
vaccine for disease control, marker to show vaccination, Property Disease
Management Programmes,
Burr, P. Health schemes: are they only for the
minority? Cattle Practice. 2004; 12(4): 255-257. ISSN: 0969-1251.
NAL Call
No.:
SF961.C37
Descriptors: cattle health schemes, farmers, costs of
disease control and prevention, bovine diarrhea virus, bovine herpesvirus 1, Mycobacterium avium subsp. paratuberculosis, resistance of farmers
to benefits of higher health status,
Buza, Jorarn J.; Hikono, Hirokazu; Mori, Yasuyuki; Nagata, Reiko; Hirayama,
Sachiyo; Bari, Abusaleh M.; Aodon Geril; Shu, Yujing; Tsuji, Noriko M.;
Momotani, Eiichi. Neutralization of interleukin-10
significantly enhances gamma interferon expression in peripheral blood by
stimulation with Johnin purified protein derivative and by infection with Mycobacterium avium subsp. paratuberculosis in experimentally
infected cattle with paratuberculosis.
Infection and Immunity.
2004; 72(4): 2425-2428. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, peripheral blood
mononuclear cells, experimental infections, gene expression, immune response,
interferon, interleukin-10 suppressive effects, IFN gamma secretion, monoclonal
antibodies, paratuberculosis.
Caldow, G. Biosecurity, does it have a place in the
management of beef herds in the
NAL Call No.:
SF961.C37
Descriptors: beef cattle herds, losses due to
infectious disease, cost of biosecurity systems, purchasing policies for
breeding replacements, recommend and industry-wide approach, disease control
programs, vaccination, salmonellosis, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, bovine diarrhea
virus, United Kingdom.
Caldow, G.; Gunn, G.; Crawshaw, M.; Rusbridge, S.; McDiarmid, J. Can test and cull be a part of Johne's
disease control? Cattle Practice. 2004; 12(4): 249-253. ISSN: 0969-1251.
NAL Call No.:
SF961.C37
Descriptors: cattle, disease control program, Johne’s
disease, Mycobacterium avium subsp. paratuberculosis, epidemiology, test
and cull strategy for infected herds, diagnostic tests, disease prevalence,
disease prevention, disease transmission, Great Britain.
Carpenter, T.E.;
NAL Call
No.:
SF774.J68
Descriptors: dairy herd, stochastic simulation model
for risk of Mycobacterium avium
subsp. paratuberculosis
introduced with female replacements, data included: effects of bacteria
prevalence in source herd(s) disease status, number of females purchased, ELISA
alone or ELISA and fecal culture, data varied according to disease levels of
source herds.
Chacon, O.; Bermudez, L.E.;
URL: http://arjournals.annualreviews.org/loi/micro?cookieSet=1
NAL
Call No.: 448.3
AN72
Descriptors: Mycobacterium avium subsp. paratuberculosis, etiology of
diarrheal diseases, Johne’s disease, possible agent of Crohn’s disease,
microbial factors of pathogenicity, issues and controversy of pathogenic role in
humans.
Chauhan, R.S.; Al Ani, F.K. Bacterial diseases. In:
Al Ani, F.K. [Editor]. Camel: Management and Diseases.
Published by the Faculty of Veterinary Medicine,
Descriptors: camels, dromedaries, bacterial diseases,
etiology, epidemiology, clinical picture, diagnostic techniques, disease control
and prevention, drug therapies, bacterial toxins, pathogenesis, actinomycosis,
anaplasmosis, anthrax, botulism, brucellosis, glanders, hemorrhagic septicemia,
heartwater, Johne’s disease, leptospirosis, listeriosis, Lyme disease,
melioidosis, mycoplasmosis, paratuberculosis, tuberculosis, pasteurellosis,
plague, pododermatitis, Q fever, salmonellosis, tetanus, tickborne
fever.
Chavez-Gris, Gilberto; Trigo-Tavera, Francisco J.; Svastova,
URL: http://www.medigraphic.com/veterinariamexico/
NAL
Call No.:
SF604.V485
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, genetic
polymorphism, IS900 probe, BstEII restriction enzyme, C1 type, epidemiological
study, disease, control,
Chui, Linda W.; King, Robin; Lu, Patricia; Manninen, Ken; Sim, Jeong. Evaluation of four DNA extraction methods
for the detection of Mycobacterium
avium subsp. paratuberculosis by
polymerase chain reaction. Diagnostic Microbiology and Infectious
Disease. 2004; 48(1):
39-45. ISSN: 0732-8893.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5016&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=a834b5d6c5e60ba3bd43424467395f82
Descriptors: DNA extraction methods, Mycobacterium avium subsp. paratuberculosis, rapid lysis, organic
extraction, silica based and magnetic particle based technologies (MagaZorb TM),
bacterial cells, spiked bovine feces, efficiency of extraction, PCR end point
titration, insertion sequence IS900.
Chui, Linda W.; King, Robin; Chow, Eva Y.W.; Sim, Jeong. Immunological response to Mycobacterium avium subsp. paratuberculosis in chickens.
Canadian Journal of Veterinary Research. 2004; 68(4): 302-308. ISSN: 0830-9000.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=133
NAL
Call No.:
SF601.C24
Descriptors: chickens, immune capture assay followed
by PCR, heat and formalin inactivated Mycobacterium avium subsp. paratuberculosis, immune response,
IgY, diagnosis, diagnostic techniques, immune response,
immunization.
Cismileanu, A.; Samarineanu, M.; Sarca, M.; Medeanu, R.
Profilul electroforetic si prin Western blot al unui antigen de tip
lipoarabinomanan (LAM) de Mycobacterium
avium subspecia paratuberculosis. [The profile of a lipoarabinomannan-type
antigen (LAM) of Mycobacterium avium
subspecies paratuberculosis
determined by electrophoresis and Western Blot.] Revista Romana de Medicina Veterinara.
2004; 14(1): 81-88. ISSN: 1220-3173. Note: In Rumanian with an English summary.
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, bacterial antigen,
lipoarabinomannan, carbohydrates, electrophoresis, Western blot, proteins,
SDS-PAGE.
Collins, J.D.; Wall, P.G. Food safety and animal production systems:
controlling zoonoses at farm level. Revue Scientifique et Technique Office
International des Epizooties. 2004; 23(2): 685-700. ISSN: 0253-1933. ISBN: 9290446218. Note: In English with Spanish and French
summaries.
Descriptors: food safety, animal production systems,
disease control and prevention, epidemiology, feeds, stressors, risk
assessments, selection pressure, transport of animals, tuberculosis, Johne’s
disease, paratuberculosis, Brucella,
Camplobacter, E. coli, Listeria, Mycobacterium bovis, Mycobacterium avium
subsp. paratuberculosis, Salmonella,
Trichinella, Yersinia, Toxoplasma,
zoonotic diseases.
Collins, M.T. Update on paratuberculosis. 3. Control and
zoonotic potential. Irish Veterinary Journal. 2004; 57(1): 49-52. ISSN: 0368-0762.
Descriptors: cattle, calves, humans, Mycobacterium avium subsp. paratuberculosis, clinical aspects,
diagnosis, disease control and prevention, disease transmission, potential
zoonotic disease, Crohn’s disease.
Corner, L.A.L.; Pfeiffer, D.U.; Abbott, K.A. The respiratory tract as a hypothetical
route of infection of cattle with Mycobacterium avium subspecies paratuberculosis. Australian Veterinary Journal. 2004; 82(3): 170-173. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: Mycobacterium avium subsp. paratuberculosis, cattle, route of
infection, respiratory tract, disease infection hypothesis.
Costa, E.F.; Fazzio, L.E.; Traveria, G.E.; Sanchez, R.O.; Alvarado-Pinedo,
M.F.; Mattioli, G.A.; Otero, M.M.; Chialva, M.; Romero, J.R. Causas de mortalidad y aborto en bovinos
informe de 1163 casos entre 1986 y 2001 en la provincia de Buenos Aires. [Causes of mortality and abortion in
cattle. Report of 1163 cases from
1986 to 2001 in
Descriptors: cattle, necropsies, examination, death,
abortion, ranges of ages, neonates—colibacillosis, 1-8 months—pneumonia, 8-18
months—mucosal disease, anthrax, various parasitic diseases, over 18 months,
nutritional deficiencies, metabolic diseases, important infectious
diseases—anthrax and Mycobacterium avium
subsp.
paratuberculosis.
Coussens, P.M.; Verman, N.; Coussens, M.A.; Elftman, M.D.; McNulty, A.M. Cytokine gene expression in peripheral
blood mononuclear cells and tissues of cattle infected with Mycobacterium avium subsp. paratuberculosis: evidence for an
inherent proinflammatory gene expression pattern. Infection and Immunity. 2004; 72(3): 1409-1422. ISSN: 0019-9567.
URL: http://iai.asm.org/cgi/content/abstract/72/3/1409
NAL Call No.:
QR1.I57
Descriptors: infected cows, Mycobacterium avium subsp. paratuberculosis, suppression of a
proinflammatory gene expression pattern, peripheral blood mononuclear cells,
PBMCs, genes encoding interleukin-1 alpha (IL-1 alpha ), IL-2, IL-4, IL-5, IL-6,
IL-8, IL-10, IL-12p35, IL-16, IL-18, interferon-gamma, transforming growth
factor beta (TGF-beta ), tumor necrosis factor alpha (TNF-alpha), mesenteric
lymph nodes draining infection sites.
Coussens, Paul. Development of gene expression signatures
for chronic infectious diseases, a bovine model. Tissue Antigens. 2004; 64(4): 361. ISSN: 0001-2815. Note: 1st International Conference on Basic
and Clinical Immunogenomics,
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, gene expression,
animal disease model, Crohn's disease, chronic granulomatous enteritis, EST
sequence.
Coussens, Paul M. Model for immune responses to Mycobacterium avium subspecies paratuberculosis in cattle. Infection and Immunity. 2004; 72(6): 3089-3096. ISSN: 0019-9567.
URL: http://iai.asm.org/cgi/content/full/72/6/3089
NAL
Call No.:
QR1.I57
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease, simulation models, immune
response.
Coussens, P.M.; Jeffers, A.; Colvin, C.
Rapid and transient activation of gene expression in peripheral blood
mononuclear cells from Johne's disease positive cows exposed to Mycobacterium paratuberculosis in
vitro. Microbial Pathogenesis. 2004; 36(2): 93-108. ISSN:
0882-4010.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6954&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=0ce0cc81f81ede9640040947d652abf1
Descriptors: Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
dairy cows, gene expression regulation.
Cvetnic, Z.; Ocepek, M.; Spiic, S.; Habrun, B.; Mitak, M.; Krt, B. Usporedba razliitih metoda dijagnostike
paratuberkuloze u uzgoju mlijenih goveda.
[Comparison of different diagnostic methods for paratuberculosis in dairy
cattle breedings.] Veterinarska Stanica. 2004; 35(1): 5-13. ISSN: 0350-7149. Note: In Croation with an English summary.
Descriptors: dairy cow farm, tuberculin testing,
non-specific reactions, clinical symptoms pointed to paratuberculosis,
serological testing, RVC, GDP test, ELISA and gamma IFN test together were best,
different levels of sensitivity found, Croatia.
Dargatz, D.A.; Byrum, B.A.; Collins, M.T.; Goyal, S.M.; Hietala, S.K.;
Jacobson, R.H.; Kopral, C.A.; Martin, B.M.; McCluskey, B.J.; Tewari, D. A multi-laboratory evaluation of a
commercial enzyme-linked immunosorbent assay test for the detection of
antibodies against Mycobacterium avium
subsp. paratuberculosis in cattle. Journal of Veterinary Diagnostic
Investigation. 2004; 16(6):
509-514. ISSN:
1040-6387.
NAL Call No.: SF774.J68
Descriptors: cows, Mycobacterium avium subsp. paratuberculosis, enzyme linked
immunosorbent assay, antibody detection, laboratories, analytical kits, testing,
variance, sources of variability.
Davidson, William R.; Manning, Elizabeth J. B.; Nettles, Victor F. Culture and serologic survey for Mycobacterium avium subsp. paratuberculosis infection among
Southeastern white-tailed deer (Odocoileus virginianus). Journal of Wildlife Diseases. 2004; 40(2): 301-306. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: white tailed deer, Odocoileus virginianus, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, survey of disease
levels, ELISA, lymph nodes, serology, surveillance of wild populations,
currently not a disease reservoir, Alabama, Arkansas, Florida, Georgia,
Kentucky, Louisiana, Maryland, Mississippi, North Carolina, South Carolina,
Tennessee, West Virginia, United States.
Dimareli-Malli, Z.; Samarineanu, M.; Sarca, M.; Zintzaras, E.; Sarris, K.;
Tsitsamis, S. Statistical evaluation of ELISA methods for
testing caprine paratuberculosis. Journal of Applied Research in Veterinary
Medicine. 2004; 2(1):
10-16. ISSN: 1542-2666.
URL: http://www.jarvm.com/
NAL Call No.:
SF601.J63
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis. testing of 4 ELISA
assays for diagnostic value-- LAM-A, LAM-P, GP, IDEXX-ELISA, and AGIT; a
comparison study testing for sensitivity and specificity, 44 infected animals,
73 clinically healthy from infected herds, 62 known negatives, results presented
show AGIT has high specificity, Greece, Mediterranean
regions.
Dufour, Barbara; Pouillot, Regis; Durand, Benoit. A cost/benefit study of paratuberculosis
certification in French cattle herds.
Veterinary Research. 2004; 35(1): 69-81. ISSN: 0928-4249.
NAL Call
No.: SF602.A5
Descriptors: cattle herds, Mycobacterium avium subsp. paratuberculosis, paratuberculosis
certification, cost/benefit analysis, disease control,
Ellingson, J.L.E.; Koziczkowski, J.J.;
NAL Call No.: 44.8 J824
Abstract: Mycobacterium avium subsp. paratuberculosis (MAP) is the etiologic
agent in Johne's disease in cattle and causes diarrhea, decreased milk
production, emaciation, and frequently death. The ability to detect MAP rapidly and
accurately is an integral part of herd management. However, detection of this bacterium is
complicated due to its slow division time and its ability to enter dormancy.
Culture methods are considered the
"gold standard", but they have their limitations. Many enzyme-linked immunosorbent assay
methods and conventional PCR methods have been used as diagnostic tools. The present study compares the results of
a PCR prescreen to two culture methods of detection paired with confirmatory PCR
to determine the most accurate, rapid, and sensitive method using U.S.
Department of Agriculture (USDA) fecal check samples. This study involving two laboratories
(Marshfield Clinic Laboratories, using solid culture medium [Herrold's egg yolk
agar], and TREK Diagnostic Systems Research and Development, using liquid
culture medium [ESP Culture System II]) showed that the PCR prescreening method
used in this study lacked specificity and sensitivity as a stand-alone test in
fecal samples. However, the
combination of liquid enrichment culture using the ESP II system, and PCR
confirmation with the hspX primer set, was not only 100% sensitive and specific
but also correlated with viable MAP and USDA culture
results.
Descriptors: dairy cattle, feces, microbial
detection, methodology, polymerase chain reaction, USDA, culture media, Mycobacterium avium subsp. paratuberculosis, animal pathogenic
bacteria, pathogenesis related proteins, virulence, genes, clinical examination,
rapid methods, food safety.
Emery, D.L.; Whittington, R.J. An evaluation of mycophage therapy,
chemotherapy and vaccination for control of Mycobacterium avium subsp. paratuberculosis infection. Veterinary Microbiology. 2004; 104(3/4): 143-155. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: sheep, ruminants, bacterial pathogen, Mycobacterium avium subsp. paratuberculosis, disease control,
various treatment options reviewed, chemotherapy, vaccination, mycophages,
chemotherapeutic regimes, costs, effectiveness of live and killed mycobacterian vaccines,
neonatal vaccination with defined doses of bacteria, induction of protective Th1
type immunity.
Fischer, O.A.; Matlova, L.; Dvorska, L.; Svastova, P.; Peral, D.L.; Weston,
R.T.; Bartos, M.; Pavlik, I. Beetles as possible vectors of infections
caused by Mycobacterium avium
species. Veterinary Microbiology.
2004; 102(3-4): 247-255. ISSN:
0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: insect vectors, Mycobacterium avium subsp. hominissuis, animal pathogenic
bacteria, disease transmission, paratuberculosis, zoonoses, adult insects,
isolation, Coleoptera, larvae, Tenebrio
molitor, Zophobas atratus, barns, bran, peat, Mycobacterium avium subsp. avium, disease detection, avian
tuberculosis, bovine tuberculosis, Slovakia, Czech
Republic.
Fischer, O.A.; Matlova, L.; Dvorska, L.; Svastova, P.; Bartl, J.; Weston,
R.T.; Pavlik, I. Blowflies Calliphora vicina and Lucilia sericata as passive vectors of
Mycobacterium avium subsp. avium, M. a. paratuberculosis and M. a. hominissuis. Medical and Veterinary Entomology. 2004; 18(2): 116-122. ISSN:
0269-283X.
NAL Call No.: RA639.M44
Abstract: Mycobacterium avium subsp. paratuberculosis (Actinomycetales:
Mycobacteriaceae) isolates of identical restriction fragment length polymorphism
(RFLP) type B-C1 were isolated from: intestinal mucosa of two cows showing
clinical signs of paratuberculosis, a specimen of the blowfly Calliphora vicina Robineau-Desvoidy
(Diptera: Calliphoridae) captured while perched on these cattle intestines in a
waste container at the site of the slaughter, and the blowflies C. vicina and Lucilia caesar Linnaeus captured the
next day at the same site when no infected cattle with paratuberculosis were
slaughtered. Subsequently,
second-stage larvae of the blowflies C.
vicina and Lucilia sericata
(Meigen) were experimentally infected by feeding them liver from hens with avian
tuberculosis caused by M. a. avium
(serotype 1, genotype IS901+ and IS1245+) and small cuts of pork meat
contaminated with M. a. hominissuis
(serotype 8, genotype IS901- and IS1245+). Mycobacterium a. avium of identical
serotype, genotype and RFLP type F-C3 was isolated from C. vicina larvae on days 4 and 11 post
infection (p.i.) and from L. sericata
larvae on day 4 p.i. Identical RFLP
type B-C1 of M. a. paratuberculosis was isolated from adult C. vicina fed with artificially
contaminated saccharose solution on day 2 p.i. Investigation of M. a. paratuberculosis distribution
inside the adult C. vicina showed
that the majority of Colony Forming Units (CFU) were isolated from the abdomen
and head, fewer from the thorax and wings and none from the legs. Larvae and adults may participate in
spreading causal agents of mycobacterial infections and this fact should be
considered during sanitation of infected herds and in slaughterhouses when
materials from animals affected by mycobacterial infections are
processed.
Descriptors: cows, Calliphora vicina, Lucilia sericata, Lucilia caesar, blowflies, Mycobacterium avium subsp. avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium, Mycobacterium avium subsp. hominissuis, insect vectors, bacterial
infection, pathogen identification, restriction fragment length polymorphism,
tissue distribution, cows, hens, paratuberculosis, avian tuberculosis, chicken
meat, pork, food contamination, disease transmission, Czech Republic.
Fredriksen, B.; Djonne, B.; Sigurdardottir, O.; Tharaldsen, J.; Nyberg, O.;
Jarp, J. Factors affecting the herd level of
antibodies against Mycobacterium
avium subspecies paratuberculosis
in dairy cattle. Veterinary Record. 2004; 154(17): 522-526. ISSN:
0042-4900.
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8 V641
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease, dairy
cattle, herd health, antibodies, variable factors.
Gardner, Richard A.; Ghobrial, George; Naser, Saleh A.; Phanstiel, Otto. Synthesis and biological evaluation of new
acinetoferrin homologues for use as iron transport probes in mycobacteria. Journal of Medicinal Chemistry. 2004; 47(20): 4933-4940. ISSN: 0022-2623.
URL: http://pubs.acs.org/journals/jmcmar/index.html
NAL
Call No.:
RS403.A1J6
Descriptors: Mycobacterium avium subsp. paratuberculosis, iron transport,
acinetoferrin, aminohydroxamic acid motif (2 equiv) to a tert-butyl citrate
derivative homologues, generated two linear and two cyclic imide derivatives,
growth stimulating behavior, DCC and N-hydroxysuccinimide, siderophore from Streptomyces pilosus, deferrioxamine
B.
Ghadiali, A.H.; Strother, M.;
URL: http://jcm.asm.org/cgi/content/abstract/42/11/5345
NAL
Call No.:
QR46.J6
Descriptors: cattle, goats, humans, Mycobacterium avium subsp. paratuberculosis, Johne’s disease
strains, Crohn’s disease strains, zoonotic disease strains,
Glanemann, B.; Hoelzle, L.E.; Bogli-Stuber, K.; Jemmi, T.; Wittenbrink,
M.M. Detection of Mycobacterium avium subspecies paratuberculosis in Swiss dairy cattle
by culture and serology. Schweizer Archiv fuer
Tierheilkunde. 2004; 146(9):
409-415. ISSN: 0036-7281.
NAL Call No.: 41.8
SCH9
Descriptors: 186 dairy cows, 10 commercial herds,
cattle antibody testing, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, culture techniques,
diagnosis, diagnostic techniques, diagnostic value, ELISA, fecal sampling,
immunodiagnosis, commercial ELISA with MAP lipoarabinomannan, paratuberculosis,
serology, Switzerland.
Glawischnig, W.; Awad-Masalmeh, M.; Khaschabi, D.; Schonbauer, M. Nachweis von Mycobacterium avium subsp. paratuberculosis im Hoden eines klinisch
erkrankten Zuchtstiers. [Detection
of Mycobacterium avium subsp. paratuberculosis from the testicles of a
clinically infected breed.] Berliner und Munchener Tierarztliche
Wochenschrift. 2004; 117(3/4):
136-139. ISSN: 0005-9366. Note: In German with an English summary.
NAL Call No.: 41.8
B45
Descriptors: Simmental bull, post mortem examination,
severe Johne’s disease, Mycobacterium
avium subsp. paratuberculosis,
testicles sampled, no gross lesions, acid fast organisms found, cultured in
mycostatin culture, PCR showed Mycobacterium avium subsp. paratuberculosis, indication of
bacteremia in final stages, possible transfer with artificial
insemination.
Goethe, R. Mechanismen der Aktivierung und
Deaktivierung von J774 Makrophagen durch Mycobacterium avium Subspezies
paratuberculosis. Mechanisms of
activation and deactivation of J774 macrophages by Mycobacterium avium subsp.
paratuberculosis. 2004;
151. Note: A thesis published by Tierarztliche
Hochschule Hannover,
Descriptors: Mycobacterium avium subsp. paratuberculosis persistence in
mononuclear phagocytes, role in pathogenesis of paratuberculosis in ruminants,
murine macrophages J774, infection mechanism, mycobacterial phagosome
establishment, signal cascades and transactivation of genes, cytokine mRNA
expression was detected, particularly of the IL-6 gene, protein kinase C,
phosphotyrosine kinases.
Granger, K.; Moore, R.J.; Davies, J.K.; Vaughan, J.A.; Stiles, P.L.; Stewart,
D.J.; Tizard, M.L.V. Recovery of Mycobacterium avium subspecies paratuberculosis from the natural host
for the extraction and analysis in vivo-derived RNA. Journal of Microbiological Methods.
2004; 57(2): 241-249. ISSN: 0167-7012.
URL: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T30-4BYC4F5-1&_user=10&_handle=B-WA-A-A-AE-MsSAYVA-UUA-AUEAEVDCVW-AUYECWYBVW-CAUDDCYAC-AE-U&_fmt=summary&_coverDate=05%2F31%2F2004&_rdoc=11&_orig=browse&_srch=%23toc%234932%232004%23999429997%23491206!&_cdi=4932&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=695484d1a3d13c4638c1828f8ce80b07%20
Grant, I.R.; Rowe, M.T. Effect of chemical decontamination and
refrigerated storage on the isolation of Mycobacterium avium subsp. paratuberculosis from heat-treated
milk. Letters in Applied Microbiology. 2004; 38(4): 283-288. ISSN: 0266-8254.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=lam
NAL Call No.:
QR1.L47
Descriptors: milk contaminated with Mycobacterium avium subsp. paratuberculosis, cold storage
treatment, cetylpyridinium chloride treatment not recommended,
pasteurization.
Grooms, D. Johne's disease: A brief overview.
Proceedings / Tri-State Dairy Nutrition
Conference. 2004; 41-46. Note: Conference held April 27-28, 2004,
NAL Call
No.: SF203.T75
Descriptors: dairy cows, beef cattle,
paratuberculosis, Mycobacterium avium
subsp. paratuberculosis, symptoms,
economic impacts, control,
Hacker, U.; Huttner, K.; Konow, M. Untersuchung zur serologischen Pravalenz
und zu Risikofaktoren der Paratuberkulose in Milchviehbetrieben in
Mecklenburg-Vorpommern.
[Investigation of serological prevalence and risk factors of
paratuberculosis in dairy farms in the State of Mecklenburg-Westpommerania,
NAL Call
No.: 41.8
B45
Descriptors: dairy farms; 2997 serum
samples; 59 pre-selected dairy farms, analyzed for antibodies against Mycobacterium avium subsp. paratuberculosis, Svanovir ELISA, herd prevalence 12.2% , need for common
program to control Johne’s disease in Germany, Mecklenburg-Pomerania,
Germany.
Hammer, P.; Kiesner, C.; Walte, H.G.; Knappstein, K.; Teufel, P. Heat resistance of Mycobacterium avium ssp. paratuberculosis in raw milk tested in a
pilot-plant pasteurizer. Bulletin of
the International Dairy Federation.
2004; (392): 53-61.
ISSN: 0250-5118.
NAL Call No.: 44.9
IN82B
Descriptors: Mycobacterium avium subsp. paratuberculosis, bacterial
contaminant in raw milk, inactivation by heat treatments, heat resistance, heat
tolerance, pasteurization, pasteurizers, various heat combinations, experimental
treatment with 5 treatments, factors influencing heat tolerance, cell clumps,
phagocytosis, metabolic activity and heat activation.
Harp, J.A.; Stabel, J.R.; Pesch, B.A.; Goff, J.P. Expression of adhesion molecules on milk
and blood lymphocytes from periparturient dairy cattle with Johne's disease.
Veterinary Immunology and
Immunopathology. 2004; 98(1/2):
69-76. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
Descriptors: dairy cows, infected with Mycobacterium avium subsp. paratuberculosis, parturition, and up
to 21 days post-partum, monitoring for T lymphocytes and expression of adhesion
molecules on cell in blood and milk.
Harwood, D. Diseases of dairy goats. In
Practice. 2004; 26(5):
248-259. ISSN: 0263-841X.
NAL Call
No.:
SF601.I4
Descriptors: dairy goats, common infectious diseases,
differences with reference to common infectious diseases, other clinical
conditions, endoparasites and breeding/fertility problems, species differences
with reference to common infectious diseases, other clinical conditions,
metabolic diseases, endoparasites and breeding/fertility problems, disease
transmission, disease prevention, disease control, includes bacterial diseases,
Mycobacterium avium subsp. paratuberculosis, Mycobacterium
tuberculosis, United Kingdom.
Heeb, M.; Austerman, S.R.; Hall, J.; Evans, R. Comparison of commercial ELISA tests for
Johne's disease in beef cattle herds. In: Smith, R.A. [Editor] Proceedings of the Thirty Seventh Annual
Conference, American Association of Bovine Practitioners, Forth Worth, Texas,
City, USA, September 23-25, 2004. Published by the Association. 2004; 300. ISSN:
0743-0450.
NAL Call No.:
SF961.A5
Descriptors: beef cattle, beef herds,
epidemiology, testing for Mycobacterium
avium subsp. paratuberculosis,
disease prevalence, commercial ELISA kits, comparison study.
Hein, Wayne R; Barber, Ttessa; Cole, Sally Ann; Morrison, Lilian; Pernthaner,
Anton. Long-term collection and characterization
of afferent lymph from the ovine small intestine. Journal of Immunological Methods. 2004; 293(1-2): 153-168. ISSN:
0022-1759.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=4931&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=a9f24e1e7fcf9211e6517a50df2f26f4
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, Trichostrongylus
colubriformis, animal parasitic nematodes, animal disease models,
experimental infections, host/parasite relationships, immune response, small
intestine, lymph flow, methodology, paratuberculosis, Johne’s
disease.
Hellberg, H.; Mork, T. Overvakings- og kontrollprogrammene viser
fortsatt god helse hos fisk, skjell og landdyr i Norge. [Surveillance and control programmes
show continued good health in fish, shellfish and farm animals in
Descriptors: 18 surveillance and
control programs, farm animals, fish, shellfish, new scrapie Nor98, bovine
diarrhea virus—1 case, swine influenza—1 case, avian rhinotracheitis—1 flock, Salmonella—2 cattle, 1 pigs, 1 poultry, 3 goats, paratuberculosis, Norway.
Hendrick, S.H.; Duffield, T.F.; Kelton, T.F.; Leslie, K.E.; Lissemore,
L.K.D.; Archambault, M. Risk factors for Johne's disease in
NAL Call No.:
SF961.A5
Descriptors: dairy cattle, dairy herds, Johne’s
disease, Mycobacterium avium subsp. paratuberculosis disease prevalence,
disease control, risk factors,
Hillerton, J.E. Control of MAP in milk. Bulletin of the International Dairy
Federation. 2004; (386):
17-19. ISSN: 0250-5118.
NAL Call
No.: 44.9
IN82B
Descriptors: cattle disease, Mycobacterium avium subsp. paratuberculosis, precautionary
approach to control milk supply contaminates should be adopted, approaches
necessary at farm level, Johne’s disease, Crohn’s disease.
Hirst, H.L.; Garry, F.B.; Morley, P.S.; Salman, M.D.; Dinsmore, R.P.; Wagner,
B.A.; McSweeney, K.D.; Goodell, G.M. Seroprevalence of Mycobacterium avium subsp paratuberculosis infection among dairy
cows in
URL: http://www.avma.org/
NAL
Call No.:
41.8 AM3
Descriptors: Mycobacterium avium subsp. paratuberculosis, dairy cattle, herd
risk factors, serum testing, disease incidence,
Holmes, I.R.L.; Jubb, T.F.; Callinan, A.P.L. Infection rates in reactors to an absorbed
ELISA used in a test and cull program for bovine Johne's disease. Australian Veterinary Journal. 2004; 82(4): 233-235. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: cattle, culling of diseased animals, Mycobacterium avium subsp. paratuberculosis, infection rates,
testing program, absorbed ELISA diagnostic test.
Holzmann, C.B.; Jorge, M.C.; Traversa, M.J.; Schettino, D.M.;
NAL Call No.:
SF781.R4
Descriptors: cattle disease, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, time series data,
clinical behavior of disease, diagnosis, macroscopic examination, ELISA,
comparative tuberculin test, bacterial disease, epidemiology,
Argentina.
Hruska, K. Research on paratuberculosis: analysis of
publications 1994-2004. Veterinarni
Medicina. 2004; 49(8):
271-282. ISSN: 0375-8427.
URL: http://vetmed.vri.cz/
NAL
Call No.: 41.9
C333
Descriptors: analysis of scientific literature on Mycobacterium avium subsp. paratuberculosis, papers, authors,
institutional affiliations, journals, top 50 authors, top 50 institutions, top
50 most frequently cited articles, trends show significant increases in
research, Web of Knowledge Results Analysis, OIE Reference Laboratory for
Paratuberculosis.
Huda, A.; Jungersen, G.; Lind, P.
Longitudinal study of
interferon-gamma, serum antibody and milk antibody responses in cattle infected
with Mycobacterium avium subsp. paratuberculosis. Veterinary Microbiology. 2004; 104(1-2): 43-53. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, diagnosis diagnostic
techniques, disease markers, antibodies, immune response, immunodiagnosis,
interferon, lymphocytes, milk serum.
Humphry, R.W.; Cameron, A.; Gunn, G.J. A
practical approach to calculate sample size for herd prevalence surveys. Preventive Veterinary Medicine. 2004; 65(3/4): 173-188. ISSN: 0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: cattle herd level prevalence testing,
disease survey, bacterial pathogen, Mycobacterium avium subsp. paratuberculosis, imperfect diagnostic
test, epidemiology, sampling sizes, mathematical models, benefits, costs, low
numbers of herds, large number of animals per herd and exclusion of small herds,
achieving high herd level sensitivity and specificity.
Hutchinson, L.J.; Weinstock, D.;
Byler, L.I. Case report - management of
paratuberculosis in a dairy goat herd.
Bovine Practitioner. 2004; 38(2): 142-146. ISSN: 0524-1685. Note: In English with a French summary.
NAL Call
No.:
SF779.5.A1B6
Descriptors: mixed breed dairy goats, Mycobacterium avium subsp. paratuberculosis, serological screening for Johne’s, ELISA, agar gel
immunodiffusion, AGID, positive animals removed, euthanized or sold for meat,
necropsied, histopathology and tissues cultured, testing identified positive
animals, recommended for management practices, United
States.
Ibrahim, A.; El Sanousi, S.; Aradaib,
NAL
Call No.: 41.8
V6416
Descriptors: detection assay with increased
sensitivity, Mycobacterium avium
subsp. paratuberculosis, nested
PCR, IS1311, 1st is a 549 bp PCR (P1, P2), 2nd set of
primers (P3, P4) frn IS1311 for a 260bp PCR product, useful at early stages of
the infection.
Ikonomopoulos, J.; Gazouli, M.; Pavlik, I.; Bartos, M.; Zacharatos, P.;
Xylouri, E.; Papalambros, E.; Gorgoulis, V. Comparative evaluation of PCR assays for
the robust molecular detection of Mycobacterium avium subsp. paratuberculosis. Journal of Microbiological Methods.
2004; 56(3): 315-321. ISSN: 0167-7012.
URL: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T30-4B5435C-2&_user=10&_handle=B-WA-A-A-AE-MsSAYVW-UUA-AUYZWVUUWZ-AUYBYWUYWZ-BECBEEAUE-AE-U&_fmt=summary&_coverDate=03%2F31%2F2004&_rdoc=2&_orig=browse&_srch=%23toc%234932%232004%23999439996%23480150!&_cdi=4932&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=f3785c183ef03e76c99e976dfc93f1bc%20
Descriptors: detection of Mycobacterium avium subsp. paratuberculosis, molecular assay
method with optimum performance and cost, high reproducibility, DNA extraction,
PCR assays, one-tube nested, 2 two-tube nested, and a single PCR assay, targeted
different genomic regions of IS900 element, tested various samples, pure
bacterial cultures, formalin-fixed paraffin-embedded (FFPE) infected cattle
tissue samples, chickens with M.
avium subsp. avium, best assay
was one-tube nested PCR assay combined with in-house DNA extraction, 3
laboratories collaborated, Czech Republic, Greece.
Irish Veterinary Association. Report of the 40th winter scientific
meeting of the Association of Veterinary Teachers and Research Workers (Irish
region). Irish Veterinary Journal. 2004; 57(2): 87-94. ISSN: 0368-0762.
Descriptors: report, list of animal diseases,
livestock, pets, poultry, disease prevalence, pharmacokinetics, diagnostic
techniques, many viral and bacterial diseases—transmissible spongiform
encephalopathies, bovine herpesvirus 4, feline immunodeficiency virus,
subclinical mastitis, Brucella
abortus, E. coli, Neospora canium, Leptospira interrogans
serovar Bratislava, Irish
Republic.
Jessep, T.; Arnott, R.; Walker, B. Supporting BJD zoning - guidelines for
agents and saleyard operators.
Agnote NSW Agriculture. 2004; (DAI-323 (1st Edition)): 3. ISSN: 1034-6848.
URL: http://www.agric.nsw.gov.au/reader/newSearchResults.html?MIval=newSearchResults.html&action=search&websiteID=1&width=25&submitImg=%2Fi%2Fdpi%2Fsearch-button.gif&searchTerm=dai-323&submit=Search&x=34&y=8
Descriptors: beef and dairy industries, bovine
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis zoning in
New South Wales, protected zone, control zone, role of agents and sale yard
operators, disease prevention and control programs, guidelines,
Australia.
Joardar, S.N.; Nasir, A.; Tewari, V.; Gupta, A.; Goswami, T.K.; Ram, G.C.
Cellular immunoreactivity of fractionated
antigens of Mycobacterium
paratuberculosis 316F. Indian Journal of Animal Health. 2004; 43(2): 127-133. ISSN: 0019-5057.
NAL Call
No.:
SF1.I4
Descriptors: mice, guinea pigs, Mycobacterium avium subsp. paratuberculosis, cellular immune
responses, live bacteria experimental infection, affinity purified antigens of
Mycobacterium avium subsp. paratuberculosis 316F, fractions of
protein antigens, e ConA bound fraction increased invitro T lymphocyte
proliferation and higher NO2 production mouse splenic macrophages, guinea pigs
showed less cross reaction to related mycobacteria, delayed type
hyper-sensitivity.
Jubb, T.F.; Galvin, J.W. Effect of a test and control program for
Johne's disease in Victorian beef herds 1992-2002. Australian Veterinary Journal. 2004; 82(3): 164-166. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: Mycobacterium avium subsp. paratuberculosis, beef cattle, herd
health, testing and control programs, program evaluation, effectiveness,
Jubb, T.F.; Galvin, J.W. Effect of a test and control programme for
bovine Johne's disease in Victorian dairy herds 1992-2002. Australian Veterinary Journal. 2004; 82(4): 228-232. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: infected dairy herds, Mycobacterium avium subsp. paratuberculosis, Victorian Johne’s
Disease Test and Control Programme, 542 dairy herds participated, testing of 2
year and older animals, ELISA, culling of reactors, minimize infection in
younger animals, 680,000 tested, 10,000 reactors, statistics on the results of
the programs presented, Victoria, Australia.
Jubb, T.F.; Sergeant, E.S.G.; Callinan, A.P.L.; Galvin, J.W. Estimate of the sensitivity of an ELISA
used to detect Johne's disease in Victorian dairy cattle herds. Australian Veterinary Journal. 2004; 82(9): 569-573. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: dairy herd, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, detection method
assessment, ELISA,
Kalis, C.H.J.; Collins, M.T.; Barkema, H.W.; Hesselink, J.W. Certification of herds as free of Mycobacterium paratuberculosis
infection: actual pooled faecal results versus certification model predictions.
Preventive Veterinary Medicine. 2004; 65(3-4): 189-204. ISSN:
0167-5877
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: dairy cattle, herd health monitoring,
herd certification, Mycobacterium
avium subsp. paratuberculosis,
animal pathogenic bacteria, Johne’s disease, paratuberculosis, models, pooled
feces, microbial detection, The Netherlands.
Kasravi, R.; Nowrouzian, I. Clinical paratuberculosis as a cause for
higher culling rate in cows with left displaced abomasum and diarrhoea in a
URL: http://www.blackwellpublishing.com/journal.asp?ref=0931-1793&site=1
NAL
Call No.: 41.8
Z52
Descriptors:
Kasravi, R.; Nowrouzian, I. Johne's disease as a probable cause for
higher culling rate in cows with left displaced abomasum and diarrhea in a dairy
herd in
NAL Call No.:
SF961.A5
Descriptors: cattle, dairy cows, rate of culling of
disease animals, abomasum displacement, diarrhea, probably Johne’s disease, Mycobacterium avium subsp. paratuberculosis,
Kataria, A.K.; Kataria, N.; Harsh, S.K.; Dadhich, H.; Lal Singh; Gahlot, A.K.
An outbreak of paratuberculosis complicated
with schistosomosis in sheep. Indian Journal of Animal Health. 2004; 43(2): 145-148. ISSN: 0019-5057.
NAL Call
No.:
SF1.I4
Descriptors: sheep, concurrent infections, outbreaks
of schistosomiasis and Johne’s disease, Schistoma, Mycobacterium avium subsp. paratuberculosis, clinical signs,
diagnosis, blood chemistry, diagnosis, disease prevalence, epidemiology,
histopathology, mortality, high mortality, paratuberculosis, postmortem
examinations, Rajasthan, India.
Katayama, Nobuya; Shibata, Masashi; Suzuki, Takumi; Ootake, Masayoshi;
Kamata, Shinichi; Yokomizo, Yuichi. Effects of ammonia treatment under various
conditions on viability of Mycobacterium
avium subsp. paratuberculosis
inoculated in low moisture roughage.
Nihon Sōchi Gakkai
shi. [Journal of Grassland
Science]. 2004; 50(3): 280-284. ISSN:
0447-5933.
NAL Call No.: 60.9
J27
Descriptors: low moisture roughage, ammonia
treatment, Mycobacterium avium
subsp. paratuberculosis, pathogen
survival, animal feeds, laboratory
scale experiment, NH4OH, filter paper of Mycobacterium avium subsp. paratuberculosis, temperature and
humidity variations, time trial, disinfecting hay.
Katayama, N.; Suzuki, T.; Shibata, M.; Ootake, M.; Kamata, S.; Yokomizo, Y.
Influence of ultraviolet-B (UV-B) on
viability of Mycobacterium avium
subsp. paratuberculosis. Nihon Sōchi Gakkai
shi. [Journal of Grassland
Science]. 2004; 50(4): 336-340. ISSN: 0447-5933. Note: In English with a Japanese summary.
NAL
Call No.: 60.9
J27
Descriptors: Mycobacterium avium
subsp. paratuberculosis strains BBM2201 and
ATCC19851, raw, dried suspensions in distilled water, diluted slurry, irradiated
with UV-B at levels 2,4,8,17,34,136,271,543, 1085 kJ/m2, viability testing,
differences in inactivation due to environment, homogenized feces, slurry, raw
and dried leaves of corn (Zea mays),
sorghum (Sorghum spp.), orchard grass
(Dactylis glomerata), Italian
ryegrass (Lolium multiflorum), red
clover (Trifolium pratense) and tall
fescue (Festuca arundinacea),
bacterial survival in feces and fodder grass leaves can be long periods with
exposure to sunlight.
Keller, L.L.; Rae, D.O.; Harrell, C.D.; Loerzel, S.M. Johne's Disease: seroprevalence of Mycobacterium avium subsp. paratuberculosis in
NAL Call No.:
SF961.A5
Descriptors: beef cattle, dairy cattle,
seroprevalence for antibodies, Mycobacterium avium subsp. paratuberculosis,
Khalifeh, M.S.; Stabel, J.R. Effects of gamma interferon,
interleukin-10, and transforming growth factor beta on the survival of Mycobacterium avium subsp. paratuberculosis in monocyte-derived
macrophages from naturally infected cattle. Infection and Immunity. 2004; 72(4): 1974-1982. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: cows, Mycobacterium avium subsp. paratuberculosis, immunoregulatory
cytokines, interleukin-10,
immunity, in vivo and in vitro infection, effects on IFN gamma, TGF beta
by peripheral blood mononuclear cells PBMC, gamma interferon macrophages,
monocytes, paratuberculosis, survival, PBMCs from subclincally infected
animals.
Khalifeh, M.S.; Stabel, J.R. Upregulation of transforming growth
factor-beta and interleukin-10 in cows with clinical Johne's disease. Veterinary Immunology and
Immunopathology. 2004; 99(1/2):
39-46. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
Descriptors: healthy, subclinically or clinically
infected cows, clinical stage of Johne’s disease, Mycobacterium avium subsp. paratuberculosis, dynamics of host
immune response, tissue sampling of ileum, ileocecal junction, ileocecal lymph
node, mesenteric lymph nodes, expression of TGF-beta, IL-10, and IFN-gamma
genes, quantitative competitive RT-PCR, TGF-beta and IL-10 mRNA are elevated in
the clinical stage.
Khare, S.; Ficht, T.A.; Santos, R.L.; Romano, J.; Ficht, A.R.; Zhang, S.P.;
Grant, I.R.; Libal, M.; Hunter, D.; Adams, L.G. Rapid and sensitive detection of Mycobacterium avium subsp. paratuberculosis in bovine milk and
feces by a combination of immunomagnetic bead separation-conventional PCR and
real-time PCR. Journal of Clinical Microbiology. 2004; 42(3): 1075-1081. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/full/42/3/1075
Descriptors: Bison bison, buffalo, Mycobacterium avium subsp.
paratuberculosis, detection, immunomagnetic bead separation, diagnostic
techniques, DNA replication, fecal sampling, milk, nucleotide sequences,
PCR.
Kim, S.G.; Kim, E.H.; Lafferty, C.J.; Miller, L.J.; Koo, H.J.; Stehman, S.M.;
Shin, S.J. Use of conventional and real-time
polymerase chain reaction for confirmation of Mycobacterium avium subsp. paratuberculosis in a broth-based
culture system ESP II. Journal of Veterinary Diagnostic
Investigation. 2004; 16(5):
448-453. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: ESP II Culture System, Mycobacterium avium subsp. paratuberculosis cultured from feces,
realtime PCR assays, IS900 sequence, diagnostic techniques, detection methods.
Koo, Hye Cheong; Park, Yong Ho; Hamilton, Mary Jo; Barrington, George M.;
Davies, Christopher J.; Kim, Jong Bae; Dahl, John L.; Waters, W. Ray; Davis,
William C. Analysis of the immune response to Mycobacterium avium subsp. paratuberculosis in experimentally
infected calves. Infection and Immunity. 2004; 72(12): 6870-6883. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: cattle, young animals, experimental
infection, Mycobacterium avium
subsp. paratuberculosis, Johne’s
disease, bacterial antigens, T lymphocytes, CD4+ lymphocytes, CD8+ lymphocytes,
flow cytometry, immune response, immunity, cell
proliferation.
Koo, Hye Cheong; Park, Yong Ho; Ahn, Jongsam; Waters, W. Ray; Hamilton, Mary
Jo; Barrington, George; Mosaad, Abdelaziz A.; Palmer, Mitch V.; Shin, Sang;
Davis, William C. New latex bead agglutination assay for
differential diagnosis of cattle infected with Mycobacterium bovis and Myobacterium avium subsp. paratuberculosis. Clinical and Diagnostic Laboratory
Immunology. 2004; 11(6):
1070-1074. ISSN: 1556-6811. URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=84.%20
Descriptors: cattle, infected cows, assays,
diagnosis, Mycobacterium avium
subsp. paratuberculosis,
Mycobacterium bovis, diagnostic techniques, differential diagnosis, ELISA,
immunodominant epitope ESAT6-p, latex agglutination test, peptides, enzyme
immuno assay.
Kudahl, A.; Nielsen, S.S.; Sorensen, J.T. Relationship between antibodies against Mycobacterium avium subsp. paratuberculosis in milk and shape of
lactation curves. Preventive Veterinary Medicine. 2004; 62(2): 119-134. ISSN:
0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: dairy cows, heifers, lactation, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
cattle diseases, ELISA, enzyme linked immunosorbent assay, lactation, milk
yield, lactation curve, milk, optical properties, parity reproduction, lactation
stage, mathematical models, antibody detection, antibodies,
Denmark.
Kurade, N.P.; Tripathi, B.N.; Rajukumar, K.;
URL: http://www.vetpathology.org/contents-by-date.0.shtml
NAL
Call No.: 41.8
P27
Descriptors: 20 crossbred lambs, oral experimental
infection with Mycobacterium avium
subsp. paratuberculosis,
infection stages 10-330 days post infection, diagnostic tests used,
bacterial culture, lymphocyte stimulation test (LST), ELISA, locations and
patterns of granulomatous lesions of intestines, intestinal lymphoid tissue,
cellular infiltration, presence of acid fast bacilli, first establishes in
lymphoid tissue of small intesting producing segmental lesions, the lamina
propria and local lymph nodes, histopathology, Peyer’s
patches.
Lambeth, C.; Reddacliff,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: sheep, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
disease transmission, in utero transmission, mammary glands, nursing milk
transmission.
Lanigan, M.D.; Vaughan, J.A.; Shiell, B.J.; Beddome, G.J.; Michalski, W.P. Mycobacterial proteome extraction:
comparison of disruption methods. Proteomics. 2004; 4(4): 1094-1100. ISSN: 1615-9853.
URL: http://www3.interscience.wiley.com/cgi-bin/abstract/107629550/ABSTRACT
Descriptors: Mycobacterium avium subsp. paratuberculosis, proteome extraction,
comparison study, disruption methods, bead beating sonication, lysates, broad
and narrow range 2 dimensional gel electrophoresis, similar
results.
Lombard, J.E.; Hirst, H.L.;
Antognoli, M.C.; Salman, M.D.; Garry, F.B. Evaluation of diagnostic tests for Johne's
disease using detection of Mycobacterium
avium subsp. paratuberculosis in
tissues to classify infection status of dairy cows. In:
Smith, R.A. [Editor] Proceedings of the Thirty Seventh Annual
Conference, American Association of Bovine Practitioners, Forth Worth, Texas,
City, USA, September23-25, 2004. Published by the Association. 2004; 205, 272-273. ISSN: 0743-0450. Note: In English and French.
NAL Call No.:
SF961.A5
Descriptors: dairy cattle, dairy cows, fecal
sampling, diagnostic techniques for infection status, ELISA, postmortem
examinations, histopathology.
Lugton, I.W. Cross-sectional study of risk factors for
the clinical expression of ovine Johne's disease on
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
clinical level disease, cross sectional risk factors,
Lugton, I.W. Review of possible links between the
clinical expression of paratuberculosis and deficiency of macro and
micro-nutrients. Australian Veterinary Journal. 2004; 82(8): 490-496. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
paratuberculosis, pathogenesis, clinical aspects, macro nutrients, micro
nutrients, trace element deficiencies,
copper, iron, selenium, molybdenum, nutrient balance, pastures, soil types,
soil acidity, pH, liming, disease prevention, environmental factors,
epidemiology, reviews.
Lutze-Wallace, C.; Chen, S.; Turcotte, C. Laboratory diagnosis of bovine tuberculosis
in
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: bison, cattle, wild animals, zoo animals,
Cervus elaphus Canadensis, fallow
deer, white tailed deer, Odocoileus
virginianus, pigs, tuberculosis, Mycobacterium, Mycobacterium avium, Mycobacterium avium avium, Mycobacterium
avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium marinum, Mycobacterium
terrae, Mycobacterium xenopi, Mycobacterium flavescens, Mycobacterium gordonae, Mycobacterium
triviale, disease prevalence, disease surveys, epidemiology, laboratory
diagnosis, Alberta, Quebec, Ontario, Prince, Edward Island, Manitoba,
Saskatchewan.
Machackova, M.; Svastova, P.; Lamka, J.; Parmova,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, animal, pathogenic
bacteria, disease vectors, wild animals, disease reservoirs, disease
transmission, risk factors, Cervus
dama, Capreolus capreolus,
Mouflo, Cervus elaphus, game animals, livestock and meat
industry, disease prevalence, disease diagnosis, restriction fragment length
polymorphism, livestock, epidemiological surveys, farmed deer industry, game
parks, Czech Republic.
Mackintosh, C.G.; de Lisle, G.W.; Collins, D.M.;
NAL Call No.: 41.8
N483
Descriptors: deer, captive, farmed, wild, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
subsp. avium, Mycobacterium bovis, culling for
slaughter as control after skin and blood testing, movement control and vector
control, factors affecting susceptibility—age, environment, population density,
exposure to pathogens, and genetics, difficulty in diagnosing subspecies of Mycobacterium avium with specificity, New
Zealand.
Martini, A.; Marconi, P.; Ponzetta, M.P.; Giorgetti, A.; Viliani, M. Sanitary monitoring models for wild
ungulate stock farms in
URL: http://www.kluweronline.com/issn/0165-7380/contents
NAL Call No.: SF601.V38
Descriptors: farmed game animals, red deer, Cervus elaphus, fallow deer, wild pigs,
Sus scrofa, animal diseases, disease prevalence, disease surveys,
seroprevalence, etiology, animal pathogens, clinical aspects, diagnosis,
antibodies, postmortem examinations, microbial contamination of feeds,
sanitation, Mycobacterium avium
subsp. paratuberculosis,
ascaridiosis, coccidiosis, leptospirosis, parasitoses, Johne’s disease,
paratuberculosis, trichuriasis, Acanthocephala, Aujeszky virus, bovine
herpesvirus 1, encephalomyocarditis virus, Leptospira interrogans serovar Bratislava, Nematoda, Protozoa, Yersinia enterocolitica, Tuscany,
Italy.
Matlova, L.; Dvorska, L.; Bartos, M.; Docekal, J.; Trckova, M.; Pavlik, I.
Tuberculous lesions in pig lymph nodes
caused by kaolin fed as a supplement. Veterinarni Medicina. 2004; 49(10): 379-388. ISSN: 0375-8427.
URL: http://vetmed.vri.cz/
NAL
Call No.:
41.9 C333
Descriptors: slaughtered pigs, 2 farms, tuberculous
lesions, head, mesenteric lymph nodes, sources of infection, piglets feed
contaminated kaolin as a supplement, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
subsp. hominissuis, Mycobacterium fortuitum, kaolin
contaminated by surface water used in levigation, Czech
Republic.
McClure, P.; Stewart, C.; Collins, M.; Condron, R.; Dumon, I.; Eberhard, P.;
Grant, I.; Komorowski, E.; Lodi, R.;
NAL Call No.: 44.9
IN82B
Descriptors: Mycobacterium avium subsp. paratuberculosis, experimental
contamination of milk, experimental design, heating methodologies,
decontamination procedures, pasteurization.
McConnel, C.S.; Churchill, R.C.; Richard, M.M.; Corkhill, C.M.; Reddacliff,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, bacterial detection, surgical
method, intestinal biopsy, ileum, mesenteric lymph node.
McKenna, S.L.B.; Keefe, G.P.; Barkema, H.W.; McClure, J.; Van Leeuwen, J.A.;
Hanna, P.; Sockett, D.C. Cow-level prevalence of paratuberculosis in
culled dairy cows in Atlantic
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.:
44.8 J822
Descriptors: dairy cows, culling animals, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
body condition scoring, disease detection,
Mendes, S.; Boinas, F.; Albuquerque, T.; Fernandes, L.; Afonso, A.; Amado,
A. Epidemiological studies on paratuberculosis
in small ruminants in
Descriptors: 66 sheep and goat flocks, seropositive
testing of Johne’s, Mycobacterium avium
subsp. paratuberculosis, high
incidence in milk versus meat producers, intestinal lesions, disease prevention
and control measures,
Miciora, R. Boala Crohn etiologie controversata. [Crohn's disease - controversial
etiology.] Revista Romana de Medicina Veterinara.
2004; 14(1): 37-44. ISSN: 1220-3173. Note: In Romanian with an English summary.
Descriptors: humans, cattle, Johne’s disease, Crohn’s
disease, etiology, clinical aspects, disease transmission, zoonotic disease, Mycobacterium avium subsp. paratuberculosis.
Mortensen, H.; Nielsen, S.S.; Berg, P. Genetic variation and heritability of the
antibody response to Mycobacterium
avium subspecies paratuberculosis
in Danish
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.:
44.8 J822
Abstract: The purpose of this study was to
estimate the genetic variation and the heritability of the ability to establish
an immune response by producing antibodies to Mycobacterium avium subsp. paratuberculosis. Antibody levels were determined using an
ELISA and measuring optical density (OD) values from milk samples of 11,535 cows
from 99 herds. The pedigree of the
11,535 cows and information about days in milk, parity, milk yield, and others
were obtained from the Danish Cattle database. The statistical analyses were made using
a bivariate mixed animal model. The
bivariate model with daily milk yield and OD as dependent variables showed a
significant heritability of the ability to produce Mycobacterium avium subsp. paratuberculosis antibodies of 0.102
(genetic variance = 0.054) and a nonsignificant genetic correlation of -0.037
between daily milk yield and OD. When a sire model was used, the estimated
heritability was 0.091. To evaluate
whether intrauterine infection could be reflected in the OD, variation among
2715 dam-daughter or maternal sister groups was also estimated. Variation in this data was
nonsignificant, possibly because only very few clinical cases or end-stage cows,
i.e., heavy bacterial shedders may have been represented among the cows sampled.
It does not appear that
intrauterine transmission is of major importance in the transmission of
paratuberculosis.
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
antibody formation, genetic resistance, disease resistance, heritability,
immunoglobulin G, gene expression, milk yield, animal age, calving, genotype,
genetic variation, genetic correlation, Denmark.
Motiwala, A.S.; Amonsin, A.; Strother, M.; Manning, E.J.B.; Kapur, V.;
Sreevatsan, S. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from
wild animal species. Journal of Clinical Microbiology. 2004; 42(4): 1703-1712. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/full/42/4/1703
Descriptors: wild animal species, Mycobacterium avium subsp. paratuberculosis isolates, molecular
epidemiology, alleles, genetic markers, loci, molecular epidemiology, PCR,
Muhlherr, J.; Stephan, R. Mikrobiologische Qualitat von roher Ziegen-
und Schafmilch in der Schweiz. [The
microbiological quality of raw goat and ewe milk in
Descriptors: goat milk, ewe milk, 344 goat herds, 63
sheep flocks, average bacterial count, incidence of enterobacteria, Staphylococcus aureus, Salmonella, Campylobacter, E. coli, Mycobacterium avium subsp. paratuberculosis, Switzerland.
Munjal, S K.; Boehmer, J.; Beyerbach, M.; Strutzberg-Minder, K.; Homuth, M.
Evaluation of a LAM ELISA for diagnosis of
paratuberculosis in sheep and goats. Veterinary Microbiology. 2004; 103(1-2): 107-114. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: goats, sheep, Mycobacterium avium subsp. paratuberculosis, lipoarabinomanan
(LAM) antigen, blood serum, milk samples, diagnosis, diagnostic techniques,
ELISA, immunodiagnosis, immunodiffusion, immunological techniques, lymph nodes,
paratuberculosis, PCR.
NSW Department of Primary Industires, OJD prevalence areas. OJD prevalence areas. 2004;
1.
URL: http://www.agric.nsw.gov.au/reader/ojd-prevalence-areas
Descriptors: sheep, ovine Johne’s disease, prevalence
of disease, area maps, surveillance data, 2 year collection period, Australia.
Naugle, A.L.; Saville, W.J.A.; Shulaw, W.P.; Wittum, T.E.; Love, B.C.;
Dodaro, S.J.; McPhail, I.L. Comparison of management practices between
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: dairy farms, herd health,
paratuberculosis, Mycobacterium avium
subsp. paratuberculosis, comparison
of herd management practices, testers and non-testers,
Nielsen, S.S.; Kolmos, B.; Christoffersen, A.B. Comparison of contamination and growth of
Mycobacterium avium subsp. paratuberculosis on two different media.
Journal of Applied Microbiology. 2004; 96(1): 149-153. ISSN: 1364-5072.
URL: http://www.blackwellpublishing.com/journal.asp?ref=1364-5072
Descriptors: Mycobacterium avium subsp. paratuberculosis, comparison study,
growth and degree of contamination, Herrold’s egg yolk medium (HEYM) and
modified Lowenstein-Jensen medium, culture of 2513 fecal sample from dairy cows,
read at 5, 8 and 12 weeks, HEYM was better growth medium.
Olsen,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8%20
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium, Mycobacterium avium
subsp. avium, IS110 family, ISMpal of
1500 bp and 1 ORE encoding a putative transposase, detected in 11 Mycobacterium avium subsp. paratuberculosis strains but not in
most other Mycobacterium strains
examined including 10 Mycobacterium
avium subsp. avium isolates of
human, avian and porcine origins, 2 porcine Mycobacterium avium subsp. avium isolates and reference strain
IWGMT49 did have ISMpa1, other molecular information explored, potentially
useful to differentiate strains when used with IS900, cytochrome P-450, open
reading frames, oxygenases, transposable elements.
O'Mahony, Jim; Hill, Colin. Rapid real-time PCR assay for detection and
quantitation of Mycobacterium avium
subsp. paratuberculosis DNA in
artificially contaminated milk. Applied and Environmental
Microbiology. 2004; 70(8):
4561-4568. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3
AP5
Descriptors: Mycobacterium avium subsp. paratuberculosis, spiked milk, PCR
based rapid detection assay, primers, probes, IS900, highly sensitive,
reproducible, DNA isolation method, 3 hr time period.
Parimal Roy; Edwin, P.G.; Vajiravel-Jayakumar; Hemalatha, S.; Purushothaman,
V. An outbreak of Johne's disease among sheep
in an organized farm. Indian Journal of Animal Sciences. 2004; 74(11): 1118-1119.
NAL Call
No.: 41.8
IN22
Descriptors: sheep, Johne’s disease diagnosed, rectal
pinch and lymph samples, antibody detection via AGID tests, Mycobacterium avium subsp. paratuberculosis, case report,
clinical aspects, diagnosis, Tamil Nadu, India.
Paustian, M.L.; Amonsin, A.; Kapur, V.; Bannantine, J.P. Characterization of novel coding sequences
specific to Mycobacterium avium
subsp. paratuberculosis: implications
for diagnosis of Johne's Disease. Journal of Clinical Microbiology. 2004; 42(6): 2675-2681. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/full/42/6/2675
Descriptors: rabbits, mice, cattle, Johne’s disease,
Mycobacterium avium complex, Mycobacterium avium subsp. paratuberculosis,
subspecies differentiation, sera
testing from infected animals, diagnostic techniques, recombinant proteins,
potential for diagnostic gene sequences, PCR, open reading frames,
paratuberculosis.
Pavlik,
URL: http://vetmed.vri.cz/
NAL
Call No.: 41.9
C333
Descriptors: horses, Mycobacterium tuberculosis, Mycobacterium avium complex, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium smegmatis, Mycobacterium terrae, Mycobacterium africanum, Mycobacterium microti, disease
prevalence, disease transmission, disease reservoir, epidemiology, atypical
course of infection, clinical aspects, diagnostic techniques, histopathology,
molecular genetics, risk factors, zoonoses.
Pearce, L.E.; Truong, H.T.; Crawford, R.A.; de Lisle, G.W. Kinetic studies on the heat inactivation of
Mycobacterium avium subsp. paratuberculosis (MAP) during
turbulent-flow pasteurization. Bulletin of the International Dairy
Federation. 2004; (392): 49-52.
ISSN: 0250-5118.
NAL Call
No.: 44.9
IN82B
Descriptors: treatment of milk contaminated with Mycobacterium avium subsp. paratuberculosis, raw milk, milk
spiked with fecal material from Johne’s positive animal, different pathogenic
strains, heat tolerance, heat treatment, pasteurization, pasteurizers, kinetics,
strains, 9 temperature treatments, susceptibility, UHT
milk.
Pence, M.; Thomson, J.U.; Cole, D. Important elements of the HACCP process to
control Johne's disease, bovine viral diarrhoea virus (BVDV, and bovine
leukaemia virus (BLV). Bovine Practitioner. 2004; 38(2): 126-132. ISSN: 0524-1685. Note: In English with a French summary.
NAL Call
No.:
SF779.5.A1B6
Descriptors: cattle diseases control programs, HACCP,
bovine diarrhea virus, bovine leukemia virus, Mycobacterium avium subsp. paratuberculosis, adaptable for on farm
production problems, disease risk, critical control points for a specific
disease, leads to best practices, corrective action when needed, meat and milk
production.
Picoux, J.B.; Maillard, R.; Douart, A. Studio clinico della paratubercolosi
bovina. [Clinical study of bovine
paratuberculosis.] Summa. 2004; 21(6): 23-26. Note: In Italian. Review article.
Descriptors: cattle disease, Mycobacterium avium subsp. paratuberculosis, clinical picture,
diagnosis, pathology.
Pouillot, Regis; Dufour, Barbara; Durand, Benoit. A deterministic and stochastic simulation
model for intra-herd paratuberculosis transmission. Veterinary Research. 2004; 35(1): 53-68. ISSN: 0928-4249.
NAL Call
No.: SF602.A5
Descriptors: cattle herds, Mycobacterium avium subsp. paratuberculosis, herd level
certification procedure, cost/benefit analysis, deterministic and stochastic
simulation model for intra-herd transmission, economic impact, single infected
heifer, model difficult to validate.
Raizman, E.A.; Wells, S.J.; Jordan, P.A. Can Mycobacterium avium subspecies paratuberculosis be transmitted from
cattle to deer and rabbits, and vice versa? In: Smith, R.A. [Editor] Proceedings of the Thirty Seventh Annual
Conference, American Association of Bovine Practitioners, Forth Worth, Texas,
City, USA, September 23-25, 2004. Published by the Association. 2004; 206-207, 273-274. ISSN: 0743-0450. Note: In English and French.
NAL Call No.:
SF961.A5
Descriptors: dairy cattle, wild deer, wild rabbits,
dairy farms, Mycobacterium avium
subsp. paratuberculosis, disease
prevalence, disease transmission, wild animal feces as reservoirs, Minnesota,
United States.
Raizman, E.A.; Wells, S.J. Distribution of Mycobacterium avium paratuberculosis in
NAL Call No.:
SF961.A5
Descriptors: dairy farms, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
disease prevalence, pooled fecal sampling, ELISA, Minnesota, United
States
Raizman, E.A.; Wells, S.J.; Godden, S.M.; Bey, R.F.; Oakes, M.J.; Bentley,
D.C.; Olsen, K.E. The distribution of Mycobacterium avium ssp. paratuberculosis in the environment
surrounding
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: dairy farms, 208 dairy herds,
environmental reservoir, Mycobacterium
avium subsp. paratuberculosis,
fecal sampling, 5 cow pools, cow alley ways, manure storage, calving area, sick
cow pen, water runoff, postweaned calves areas, alternative screening areas,
Minnesota.
Raizman, E.A.; Wells, S.J.; Godden, S.M.; Bey, R.F.; Oakes, M.J.; Bentley,
D.C.; Olsen, K. E. Use of environmental sampling as a herd
screening diagnostic tool for the detection of Mycobacterium avium subsp. paratuberculosis on
NAL Call No.:
SF961.A5
Descriptors:
dairy cows, herd health screening,
environmental sampling, disease prevalence, diagnostic approach for Mycobacterium avium subsp. paratuberculosis, disease detection,
Reddacliff,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: tracer sheep, sentinels for natural
infection, field trial, early detection, Mycobacterium avium subsp. paratuberculosis,
Reddacliff,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
Descriptors: sheep, lambs, Mycobacterium avium subsp. paratuberculosis, experimental
infection, Peyer’s patches, lymph nodes, antibodies, cell mediated immunity,
immunoperoxidase technique, lysozyme.
Robbe-Austerman, S.; Thomson, J.U.; Pence, M.; Smith, P. Survey of veterinarians and producers on
Johne's disease in
URL: http://www.jarvm.com/
Descriptors: cattle, Johne’s disease control program
of Iowa, cattle veterinarians, cattle producers, diagnosis, survey state, need
for continuing eduation, use and interpretation of diagnostic test, disease
control program, potential support for a United States Federal control program,
vaccination, results of survey, Iowa, United States.
Rodriguez-Lazaro, David; Lloyd, Joy; Herrewegh, Arnold; Ikonomopoulos, John;
D'Agostino, Martin; Pla, Maria; Cook, Nigel. A
molecular beacon-based real-time NASBA assay for detection of Mycobacterium avium subsp. paratuberculosis in water and
milk. FEMS Microbiology Letters. 2004; 237(1): 119-126. ISSN: 0378-1097.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=fml
NAL
Call No.:
QR1.F44
Descriptors: Mycobacterium avium subsp. paratuberculosis, assays, water, milk,
strain detection methods, gene amplification, gene sequences,
isolates.
Rodriguez-Lazaro, D.; D'Agostino, M.; Pla, M.; Cook, N. Construction strategy for an internal
amplification control for real-time diagnostic assays using nucleic acid
sequence-based amplification: development and clinical application. Journal of Clinical Microbiology. 2004; 42(12): 5832-5836. ISSN: 0095-1137.
URL: http://jcm.asm.org/cgi/content/abstract/42/12/5832
Descriptors: Mycobacterium avium subsp. paratuberculosis, diagnostic assay
techniques, DNA amplification, RNA amplification, internal amplification control
(IAC), molecular beacon-based real time nucleic acid sequence-based
amplification (NASBA) assays.
Roy, Parimal; Edwin, Prabakher G.; Jayakumar, Vajiravel; Hemalatha, S;
Purushothaman, V. An outbreak of Johne's disease among sheep
in an organized farm. Indian Journal of Animal Sciences. 2004; 74(11): 1118-1119. ISSN:
0367-8318.
NAL Call No.: 41.8
IN22
Descriptors: sheep, Johne's disease, ovine
paratuberculosis, epidemiology, diagnosis, etiology, chronic granulomatous
enteritis, pathology, mortality,
Secott, T.E.; Lin, T.L.; Wu, C.C.
Mycobactetium avium subsp. paratuberculosis fibronectin attachment
protein facilitates M-cell targeting and invasion through a fibronectin bridge
with host integrins. Infection and Immunity. 2004; 72(7): 3724-3732. ISSN: 0019-9567.
URL: http://iai.asm.org/cgi/content/abstract/72/7/3724
NAL Call No.:
QR1.I57
Descriptors: mice, rats, animal model, antibodies,
experimental infections, fibronectins, intestines, pathogenesis, peptides Peyer
patches, proteins, murine gut loops, formation fibronectin bridge formed between
FAP-P of Mycobacterium avium subsp.
paratuberculosis and integrins on M
cells.
Semret, M.; Zhai, G.; Mostowy, S.; Cleto, C.; Alexander, D.; Cangelosi, G.;
Cousins, D.; Collins, D.M.; van Soolingen, D.; Behr, M.A. Extensive genomic polymorphism within Mycobacterium avium. Journal of Bacteriology. 2004; 186(18): 6332-6334. ISSN: 0021-9193.
URL: http://jb.asm.org/cgi/content/abstract/186/18/6332
NAL Call No.: 448.3
J82
Descriptors: Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium subsp. avium, 14 large sequence polymorphisms,
comparative genomic analysis, mycobactin biosynthesis operons,
siderophores.
Shin, S.J.; Yoo HanSang; McDonough, S.P.; Chang, Y.F. Comparative antibody response of five
recombinant antigens in relation to bacterial shedding levels and development of
serological diagnosis based on 35 kDa antigen for Mycobacterium avium subsp. paratuberculosis. Journal of Veterinary Science. 2004; 5(2): 111-117. ISSN: 1229-845X.
URL: http://www.vetsci.org/
NAL
Call No.:
SF604.J68
Descriptors: cows with different shedding rates of Mycobacterium avium subsp. paratuberculosis, cloned eighty five
complex (85A, 85B and 85C) 35 kDa antigen, superoxide dismutase (SOD), antigens
in ELISA, serological reactivity, curve analysis, usefulness as a diagnostic
agent.
Shin, S.J.; Chang, Y.F.; Huang, C.; Zhu, J.Q.; Huang, L.; Yoo HanSang; Shin,
K.S.; Stehman, S.; Shin, S.J.; Torres, A. Development of a polymerase chain reaction
test to confirm Mycobacterium avium
subsp. paratuberculosis in
culture. Journal of Veterinary Diagnostic
Investigation. 2004; 16(2):
116-120. ISSN: 1040-6387.
NAL Call
No.:
SF774.J68
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
detection assay, PCR, primer set from ISMav2, description of the primer,
diagnostic value, no amplification of 494 bp DNA fragment detected in 11
bacterial species, Mycobacterium
spp., Mycobacterium avium subsp., Escherichia coli, Pseudomonas
aeruginosa, Actinobacillus
pleruopneumonias, Lepsospira
interrogans serovar Pomona, Corynebacterium pseudotuberculosis, Salmonella typhimurium, Borrelia burgdorferi, Staphylococcus aureus, Scedosporium sp.
Siguroardottir, Olof G.; Valheim, Mette; Press, Charles McL. Establishment of Mycobacterium avium subsp. paratuberculosis infection in the
intestine of ruminants. Advanced Drug Delivery Reviews. 2004; 56(6): 819-834. ISSN: 0169-409X.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=4953&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=e38c212aafd26b014558ba729b28a4f1
Singh, B.B.; Gumber, S.; Randhawa, S.S.; Aradhana; Dhand, N.K. Prevalence of bovine tuberculosis and
paratuberculosis in Punjab. Indian Veterinary Journal. 2004; 81(11): 1195-1196. ISSN: 0019-6479.
NAL Call No.: 41.8
IN2
Descriptors: 251 cows, 376 buffaloes, intradermal
test, Johne’s, disease, tuberculosis, Mycobacterium bovis, Mycobacterium avium
subsp. paratuberculosis, incidence of
disease, sex differences, species differences,
Singh, B.B.; Sharma, S.; Kumar, H.; Dhand, N.K. Surveillance of diseases in organized dairy
farms of Punjab. Journal of Research,
NAL Call No.: S19.P8
Descriptors: 3 dairy cattle farms, animal health
monitoring, repeat breeders, reproductive disorders, anestrus, cattle diseases,
parasites, disease surveillance, epidemiology, disease prevention and control,
abortion, etiology, babesiosis, bovine mastitis, brucellosis, paratuberculosis,
theileriosis, trypanosomiasis, tuberculosis, Babesia, bovine herpesvirus 1, Brucella, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Theileria, Trypanosoma, vaccination, Punjab,
India.
Singh, S.V.; Vihan, V.S. Detection of Mycobacterium avium subspecies paratuberculosis in goat milk. Small Ruminant Research. 2004; 54(3): 231-235. ISSN:
0921-4488.
NAL Call No.: SF380.I52
Descriptors: Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
goats, raw goat milk, goat diseases, disease detection, food pathogens,
bacterial contamination, food contamination, foodborne infections,
Sreedevi,B.; Krishnappa, G. Standardization of polymerase chain
reaction for the detection of Mycobacterium tuberculosis complex
organisms from bovines. Indian Journal of Animal Sciences. 2004; 74(11): 1120-1123. ISSN: 0367-8318.
NAL Call
No.: 41.8
IN22
Descriptors: cattle, intradermal tuberculin test
positive, biopsy of prescapular lymph nodes, culture of isolates, Mycobacterium tuberculosis, Mycobacterium
bovis complex, differential diagnosis, PCR IS6110, Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium bovis BCG strain, Mycobacterium
phlei.
Stabel, J.R.; Bosworth, T.L.; Kirkbride, T.A.; Forde, R.L.; Whitlock, R.H.
A simple, rapid, and effective method for
the extraction of Mycobacterium
paratuberculosis DNA from fecal samples for polymerase chain reaction.
Journal of Veterinary Diagnostic
Investigation. 2004; 16(1):
22-30. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: subclinical and clinically infected
animals, Mycobacterium avium subsp. paratuberculosis, fecal culture single
diagnostic test for both clinical states, DNA extraction from fecal samples and
modification of PCR assay for optimal sensitivity, method can detect animals
shedding less than 1 cfu/g.
Stabel, J.R.; Hurd, S.; Calvente, L.; Rosenbusch, R.F. Destruction of Mycobacterium paratuberculosis, Salmonella spp., and Mycoplasma spp. in raw milk by a
commercial on-farm high-temperature, short-time pasteurizer. Journal of Dairy Science. 2004; 87(7): 2177-2183. ISSN: 0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.:
44.8 J822
Abstract: The 2002 NAHM's Dairy Survey indicated
that 87.2% of dairy farms in the
Descriptors: calves, neonates, safer calf feeding,
feeds, cattle microbial diseases, disease transmission, efficacy of short time
pasteurization, high temperature, raw milk treatment, cow colostrums,
immunoglobulin G., Mycobacterium avium subsp. paratuberculosis, Salmonella enterica, various Mycoplasma species, plate count, feed
processing technology.
Stabel, J.R.; Goff, J.P. Efficacy of immunologic assays for the
detection of Johne's disease in dairy cows fed additional energy during the
periparturient period. Journal of Veterinary Diagnostic
Investigation. 2004; 16(5):
412-420. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: dairy cows, postparturient period,
immunosuppression effect on diagnostic tests for Johne’s, detection, energy
balance, experimental nutrition study, rumen cannulas, ad libitum goup and
forced additional manual feeding, parturition effects on immunity, immunoassay,
immunoglobulins, immunosuppression, effects on response to diagnostic tests for
paratuberculosis.
Stabel, J.R.; Lambertz, A. Efficacy of pasteurization conditions for
the inactivation of Mycobacterium
avium subsp. paratuberculosis in
milk. Journal of Food Protection. 2004; 67(12): 2719-2726. ISSN:
0362-028X.
NAL Call No.: 44.8 J824
Descriptors: food preservation, raw milk,
pasteurization, UHT treatment, UHT milk, Mycobacterium avium subsp. paratuberculosis, paratuberculosis, risk
reduction, Crohn’s disease.
Sternberg, S.; Lindberg, A.; Englund,
NAL
Call No.: 41.9
SV23
Descriptors: beef cattle, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, potential zoonotic
disease, Crohn’s disease in humans, control program, animal and public health
concerns, epidemiology,
Stewart, D.J.; Vaughan, J.A.; Stiles, P.L.; Noske, P.J.; Tizard, M.L.V.;
Prowse, S.J.; Michalski, W.P.; Butler, K.L.; Jones, S.L. A
long-term study in Merino sheep experimentally infected with Mycobacterium avium subsp. paratuberculosis: clinical disease,
faecal culture and immunological studies. Veterinary Microbiology. 2004; 104(3/4): 165-178. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: Merino sheep, experimental infection
with Mycobacterium avium subsp. paratuberculosis, long term study,
clinical picture, fecal culture, immunological studies, antibodies, antibody
formation, cell mediated immunity, interferon gamma test, absorbed ELISA,
diagnosis, diagnostic techniques.
Stich, R.W.; Byrum, B.; Love, B.; Theus, N.; Barber, L.; Shulaw, W.P. Evaluation of an automated system for
non-radiometric detection of Mycobacterium avium paratuberculosis in bovine feces. Journal of Microbiological Methods.
2004; 56(2): 267-275. ISSN: 0167-7012.
URL: http://dx.doi.org/doi:10.1016/j.mimet.2003.10.013
Descriptors: evaluation of a broth-based automated
culture system, Mycobacterium avium
subsp. paratuberculosis, bovine
fecal testing, tested various dilutions of spiked bovine feces, Mycobacteria confirmed with IS900-based
PCR assay, and acid fast staining, validated against Herrold’s egg yolk solid
medium and defined test specimens.
Stratmann, J.; Strommenger, B.; Goethe, R.; Dohmann, K.; Gerlach, G.F.;
Stevenson, K.; Li, L.L.; Zhang, Q.; Kapur, V.; Bull, T.J. A
38-kilobase pathogenicity island specific for Mycobacterium avium subsp. paratuberculosis encodes cell surface
proteins expressed in the host. Infection and Immunity. 2004; 72(3): 1265-1274. ISSN: 0019-9567.
URL: http://iai.asm.org/cgi/content/abstract/72/3/1265
NAL
Call No.: QR1.I57
Descriptors: functional genomics, pathogenicity, Mycobacterium avium subsp. paratuberculosis, novel ABC transporter
operon, gene expression, nucleotide sequences, open reading frames, Johne’s
disease of cattle, paratuberculosis, surface proteins MptD, transposable
elements.
Sung, N.; Takayama, K.; Collins, M.TA.
Possible association of GroES and antigen 85 proteins with heat
resistance of Mycobacterium
paratuberculosis. Applied and Environmental Microbiology.
2004; 70(3): 1688-1697. ISSN:
0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3 AP5
Abstract: Conflicting reports on the heat
resistance of Mycobacterium
paratuberculosis prompted an examination of the effect of culture medium on
this property of the organism. M. paratuberculosis was cultured in
three types of media (fatty acid-containing medium 7H9-OADC (oleic
acid-albumin-dextrose-catalase supplement) and glycerol-containing media WR-GD
and 7H9-GD [glycerol-dextrose supplement]) at pH 6.0. M.
paratuberculosis grown under these three culture conditions was then tested
for heat resistance in distilled water at 65+C. Soluble proteins and mycolic acids of M. paratuberculosis were evaluated by
two-dimensional electrophoresis (2-DE) and thin-layer chromatography (TLC),
respectively. The type of culture
medium used significantly affected the heat resistance of M. paratuberculosis. The decimal reduction times at 65+C
(D(65+C) values; times required to reduce the concentration of bacteria by a
factor of 10 at 65+C) for M.
paratuberculosis strains grown in 7H9-OADC were significantly higher than
those for the organisms grown in WR-GD medium (P < 0.01). When the glycerol-dextrose supplement of
WR was substituted for the fatty acid supplement (OADC) in 7H9 medium (resulting
in 7H9-GD), the D(65+C) value was significantly lower than that for the organism
grown in 7H9-OADC medium (P = 0.022) but higher than that when it was cultured
in WR-GD medium (P = 0.005). Proteomic analysis by 2-DE of soluble
proteins extracted from M.
paratuberculosis grown without heat stress in the three media (7H9-OADC,
7H9-GD, and WR-GD) revealed that seven proteins were more highly expressed in
7H9-OADC medium than in the other two media. When the seven proteins were subjected to
matrix-assisted laser desorption ionization-mass spectrometric analysis, four of
the seven protein spots were unidentifiable. The other three proteins were identified
as GroES heat shock protein, alpha antigen, and antigen 85 complex B (Ag85B;
fibronectin-binding protein). These
proteins may be associated with the heat resistance of M. paratuberculosis. Alpha antigen and Ag85B are both
trehalose mycolyltransferases involved in mycobacterial cell wall assembly.
TLC revealed that 7H9-OADC medium
supported production of more trehalose dimycolates and cell wall-bound mycolic
acids than did WR-GD medium. The
present study shows that in vitro culture conditions significantly affect heat
resistance, cell wall synthesis, and protein expression of M. paratuberculosis and emphasize the
importance of culture conditions on in vitro and ex vivo studies to estimate
heat resistance.
Descriptors: Mycobacterium avium subsp. paratuberculosis, animal pathogenic
bacteria, bacterial antigens, bacterial proteins, heat shock proteins, organic
acids and salts, heat tolerance, cell culture, 3 types of culture media,
proteome, proteomics, protein content, lipids, cell walls, mycolic acid.
Sung, N.; Collins, M.T. Variation in resistance of Mycobacterium paratuberculosis to acid
environments as a function of culture medium. Bulletin of the International Dairy
Federation. 2004; (392):
68. ISSN: 0250-5118.
NAL Call
No.: 44.9
IN82B
Descriptors: Mycobacterium avium subsp. paratuberculosis, in vitro growth
medium either high fatty acid (7H9-OADC) or glycerol (WR-GD and 7H9-GD), acid
resistance, pH levels 6.0 and 6.8, resistance to acetate buffer at pH 3, 4, and
6, bacterial proteins, culture media, fatty acids, food safety, glycerol, growth
rate, heat resistance, morphology, radiometric culture method (BACTEC) and D
values, soluable proteins analyzed by SDS-PAGE,
susceptibility.
Taddei, S.; Robbi, C.;
NAL Call
No.:
SF774.J68
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, disease detection,
feces, DNA, polymerase chain reaction, PCR, analytical kits, cell culture,
diagnostic techniques, disease diagnosis.
Tavornpanich, S.;
NAL Call No.: 41.8 AM3A
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
pooled fecal cultures, evaluation of the reliability of detection
method.
Tooker, B.C.; Coussens, P.M. Phagocytosis of M. paratuberculosis fails to activate
expression of NADH dehydrogenase and nucleolin-related protein in bovine
macrophages. Immunology Letters. 2004; 93(2-3): 137-142. ISSN:
0165-2478.
URL: http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T75-4C56HGV-1&_user=10&_handle=B-WA-A-W-WU-MsSAYZA-UUA-AUEBEWCAUZ-AUEACUCEUZ-CVYUDDEBB-WU-U&_fmt=summary&_coverDate=05%2F15%2F2004&_rdoc=6&_orig=browse&_srch=%23toc%235049%232004%23999069997%23502730!&_cdi=5049&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5a4b860fb6e08b39c0067dc3fe211769%20
Tremblay, Robert. Emerging threats for public health
associated with dairy cattle. Medecin Veterinaire du
Descriptors: dairy cattle, zoonotic diseases, Coxiella burnetii, Cryptosporidium parvum,
Mycobacterium avium subsp.
paratuberculosis, Crohn's disease, dairy cattle, foodborne diseases,
paratuberculosis, Q fever, reviews.
Tryland, Morten; Olsen, Ingrid; Vikoren, Turid; Handeland Kjell; Arnemo, Jon
M.; Tharaldsen, Jorun; Djonne, Berit; Josefsen, Terje D.; Reitan, Liv J. Serologic survey for antibodies against Mycobacterium avium subsp. paratuberculosis in free-ranging
cervids from Norway. Journal of Wildlife Diseases. 2004; 40(1): 32-41. ISSN:
0090-3558.
URL: http://www.jwildlifedis.org/
NAL Call
No.: 41.9
W64B
Descriptors: red deer, Cervus elaphus, moose, Alces alces, roe deer, Capreolus capreolus, reindeer, Rangifer tarandus tarandus, antibodies,
ELISA, Johne’s disease, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, serological surveys,
affinity between protein G and immunoglobulins, screening method, Norway.
Valentin Weigand, P. Intracellular invasion and persistence:
survival strategies of Streptococcus
suis and Mycobacterium avium ssp.
paratuberculosis. Berliner und Munchener Tierarztliche
Wochenschrift. 2004;
117(11/12): 459-463. ISSN: 0005-9366.
NAL Call No.: 41.8
B45
Descriptors: pigs, ruminants, Streptococcus suis and Mycobacterium avium ssp. paratuberculosis, comparison study,
bacterial pathogens, host specificity, tissue tropism, differences in tissue
preferences, differences in intracellular behaviors and persistence, persistence
in macrophages.
Valheim, M.; Sigurdardottir, O.G.; Storset, A.K.; Aune, L.G.; Press, C.
McL. Characterization of macrophages and
occurrence of T cells in intestinal lesions of subclinical paratuberculosis in
goats. Journal of Comparative Pathology. 2004; 131(2-3): 221-232. ISSN:
0021-9975.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6861&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=6091bef4d15aae1adbceffba708c6eb8%20
Descriptors: goats, intestines, lesions, latent
infections, Mycobacterium avium
subsp. paratuberculosis, apoptosis,
CD4+ lymphocytes, CD8+ lymphocytes, CD 68+, T lymphocytes, cell mediated
immunity, characterization, glycoproteins, macrophages, paratuberculosis,
phenotypes, surface antigens.
Van Leeuwen, John. Impacts and control of insidious infectious
diseases - Beat them before they beat you and your clients Mycobacterium avium subspecies paratuberculosis, Neospora caninum, bovine leukemia virus,
and bovine viral diarrhea virus in dairy cattle. Medecin Veterinaire du Quebec. 2004; 34(1-2): 53-54. ISSN: 0225-9591. Note: In English with a French summary.
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, Neospora caninum, bovine leukemia virus,
bovine viral diarrhea virus, disease control and
prevention.
Vansnick, E.; de Rijk, P.; Vercammen, F.; Geysen, D.; Rigouts, L.; Portaels,
F. Newly developed primers for the detection
of Mycobacterium avium subspecies paratuberculosis. Veterinary Microbiology. 2004; 100(3/4): 197-204. ISSN:
0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: cattle,
Vesosky, B.; Turner, O.C.; Turner, J.; Orme, I.M. Gamma interferon production by bovine gamma
delta T cells following stimulation with mycobacterial mycolylarabinogalactan
peptidoglycan. Infection and Immunity. 2004; 72(8): 4612-4618. ISSN: 0019-9567.
URL: http://iai.asm.org/cgi/content/abstract/72/8/4612
NAL Call No.:
QR1.I57
Descriptors: cattle, bovine gamma delta T
lymphocytes, production of IFN-gamma, in vitro cell culture, exposed to Mycobacterium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium tuberculosis, nonspecific
immunostimulation, immune response,
interferon, interferon, interleukin-2, lipids, monocytes, peptidoglycans,
lipoarabinomannan.
Villarino, M.A.; Jordan, E. Effect of management related disease
control methods on the development of Johne's disease in dairy cattle in
NAL Call No.:
SF961.A5
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
management related disease control methods,
Walker, B. Stock permitted into NSW BJD Protected
Zones. Agnote NSW Agriculture. 2004; (DAI-322 (1st Edition)): 6. ISSN: 1034-6848.
URL: http://www.agric.nsw.gov.au/reader/bjd-zoning/stock-into-bjd-prot-zones.htm
Descriptors: beef cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease
control, zoning program, protected zoning, exemptions from movement restriction,
testing of exempted cows, steers and other cattle for slaughter, veterinary
approved for movement, CHECKTEST herds,
Beef Cattle Trade Assurance Scheme, outline of long term goals of
Australian cattle industry, Australia.
Wang, YiQin; Bao, YongGan; Hu, LieShan. Rapid detection of paratuberculosis in
cattle and sheep by ELISA. Chinese Journal of Animal Quarantine.
2004; 21(11): 27-28. ISSN: 1005-944X. Note: In Chinese with an English summary.
Descriptors: cattle, sheep, blood
serum sampling, Mycobacterium avium
subsp. paratuberculosis, detection
method, ELISA, antigen coated microplate, HRPO, color reaction, sensitive and
accurate assay, absorbing sera with Mycobacterium phlei prior to
test.
Ward, Michael P.; Perez, Andres M.
Association between soil type and
paratuberculosis in cattle herds. American Journal of Veterinary Research.
2004; 65(1): 10-14. ISSN: 0002-9645.
URL: http://avmajournals.avma.org/loi/ajvr
NAL
Call No.: 41.8
AM3A
Descriptors: 92 cattle herds, soil type at herd
location, Mycobacterium avium subsp. paratuberculosis, ELISA, bacterial
survival may be enhanced by silt or sand content in loamy soils,
Waters, W.R.; Nonnecke, B.J.; Palmer, M.V.; Robbe-Austermann, S.; Bannantine,
J.P.; Stabel, J.R.; Whipple, D.L.; Payeur, J.B.; Estes, D.M.; Pitzer, J.E.;
Minion, F.C. Use of recombinant ESAT-6:CFP-10 fusion
protein for differentiation of infections of cattle by Mycobacterium bovis and by M. avium subsp. avium and M. avium subsp. paratuberculosis. Clinical and Diagnostic Laboratory
Immunology. 2004; 11(4):
729-735. ISSN:
1071-412X.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=84
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium,
Mycobacterium bovis, bacterial
antigens, cattle diseases, immunodiagnosis, immunological techniques,
interferon, mycobacterial diseases, nitric oxide, recombinant proteins TNF,
tumor necrosis factor, early secretory antigenic target 6 culture filtrate
protein 10 fusin protein, invitro testing of blood leukocytes, IFN-gamma
inducing antigens, diagnosis of infected animals.
Weber, M.F.; van Roermund, H.J.W.; Assink, H.B.J.; Stegeman, J.A. Rate and structure of cattle transfers
between cattle herds considered to be free of paratuberculosis. In: Reid, S.W.J.; Menzies, F.D.; Russell,
A.M. Society for Veterinary Epidemiology and
Preventive Medicine Proceedings of a Meeting Held at the Martigny,
Descriptors: cattle, transport between 206 herds free
of Mycobacterium avium subsp. paratuberculosis, disease
transmission, paratuberculosis, transport of animals, The
Netherlands.
Weber, M.F.; Groenendaal, H.; van Roermund, H.J.W.; Nielen, M. Simulation of alternatives for the Dutch
Johne's disease certification-and-monitoring program. Preventive Veterinary Medicine. 2004; 62(1): 1-17. ISSN: 0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
Descriptors: disease free dairy herds, dairy cattle
herd monitoring, a stochastic simulation model ("JohneSSim"), optimal methods
for certification, monitoring schemes, disease surveillance, disease control,
simulation models, disease transmission, Mycobacterium avium subsp. paratuberculosis, paratuberculosis,
disease detection, disease prevalence, animal pathogenic bacteria, cattle
diseases, The Netherlands.
Weiss, D.J.; Evanson, O.A.; Deng, M.; Abrahamsen, M.S. Sequential patterns of gene expression by
bovine monocyte-derived macrophages associated with ingestion of mycobacterial
organisms. Microbial Pathogenesis. 2004; 37(4): 215-224. ISSN:
0882-4010
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6954&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=0ce0cc81f81ede9640040947d652abf1
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, animal pathogenic
bacteria, paratuberculosis, microarray technology.
Whittington, R.J.; Marshall, D.J.; Nicholls, P.J.; Marsh, I.B.; Reddacliff,
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3 AP5
Descriptors: Mycobacterium avium subsp. paratuberculosis, animal pathogenic
bacteria, pathogen survival, dormancy in the environment, disease reservoirs,
feces, sheep, animal manures, fecal contamination, grassland soils, pastures,
soil pollution, soil pH, soil water, effects of ultraviolet radiation, solar
radiation, shade, sandy loam soils, structural genes, DNA binding proteins,
kinases, dormancy associated genes, Dps protein, GTP pyrophosphokinase, relA
gene, dps gene, New South Wales.
Wilks, C.R. Another brick in the
wall. Australian Veterinary Journal. 2004; 82(12): 762. ISSN:
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: Johne’s disease, cattle, horses, fish,
pigs, animal pathogen, disease control.
Wikse, S.E. Preventive medicine procedures for
cattle. In: Smith, R.A. [Editor] Proceedings of the Thirty Seventh Annual
Conference, American Association of Bovine Practitioners, Forth Worth, Texas,
City, USA, 23-25-September, 2004. Published by the Association. 2004; 199-200, 265-266. ISSN: 0743-0450. Note: In English and
French.
NAL Call No.:
SF961.A5
Descriptors: cattle, veterinary technicians, cattle
preventive medicine, processing calves, processing replacement heifers and in
collection of samples for herd biosecurity programs, disease monitoring for
bovine diarrhea, Johne’s disease.
Wiszniewska, Agnieszka; Szteyn, Joanna; Fus, Maria Monika. Porownanie wzrostu Mycobacterium avium subsp. paratuberculosis na trzech podlozach
mikrobiologicznych. [Comparison of
growth of Mycobacterium avium subsp.
paratuberculosis on three
microbiological media.] Medycyna Weterynaryjna. 2004; 60(9): 982-984. ISSN: 0025-8628. Note: In Polish.
NAL Call No.: 41.8 M463
Descriptors: Mycobacterium avium subsp. paratuberculosis, comparison study,
growth on 3 culture media, antibiotics, microbial contamination, milk testing,
paratuberculosis, Johne’s disease.
Worthington, R.W. The diagnosis of Johne's disease. Surveillance
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, diagnosis difficult
in subclinical infections of livestock, combination of tests, cellular immune
response, serology, bacterial culture, histopathology.
Yan, Si Tong; Lin, Zhi Xiong; Zhu, Dao Zhong; Yu, Hai Qiong; Cai, Zhi Ling.
Study of microcomplement fixation test for
cattle paratuberculosis and sheep paratuberculosis. Chinese Journal of Animal Quarantine.
2004; 21(11): 23-26. ISSN: 1005-944x. Note: In Chinese with an English summary.
Descriptors: cattle, sheep, Mycobacterium avium subsp. paratuberculosis, microcomplement
fixation test.
Abbott, K.A.; Whittington, R.J.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: sheep, disease survey,
Mycobacterium avium subsp. paratuberculosis, post slaughter data,
disease prevalence, epidemiology,
Adaska, John M.; Anderson, Randall J.
Seroprevalence of Johne's-disease
infection in dairy cattle in
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: dairy cattle, 65 dairy
herds, Mycobacterium avium subsp. paratuberculosis, disease distribution,
disease prevalence, seroprevalance, 1950 serum samples, antibody testing, ELISA
kit, epidemiology, paratuberculosis, regional disease data, California, United
States.
Aho, Abraham D.; McNulty, Amanda M.; Coussens, Paul M. Enhanced expression of interleukin-1alpha
and tumor necrosis factor receptor-associated protein 1 in ileal tissues of
cattle infected with Mycobacterium avium
subsp. paratuberculosis. Infection and Immunity. 2003; 71(11): 6479-6486. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: Holstein cattle, Mycobacterium avium subsp. paratuberculosis, comparison study,
disease positive and negative, gene expression profiles of ileal tissues, gene
expression profiles, bovine total leukocyte (BOTL-3) cDNA microarray, infected
animals, tumor necrosis factor receptor-associated protein 1 (TRAF1),
interleukin-1alpha (IL-1alpha), MCP-2, N-cadherin, and beta1 integrin (CD29),
upregulation of IL-1alpha (21.5-fold) and TRAF1 (27.5-fold) gene expression in
tissues of Johne's disease positive.
Ahrens, P.; Bolske, G.; Djonne, B.; Klausen, J.; Christensen, B. [Editors]
Paratuberculosis, Proceedings of the 15th
Symposium of the Nordic Committee for Veterinary Scientific Cooperation (NKVet),
Copenhagen, Denmark, 18-19 May 2001. Acta Veterinaria Scandinavica. 2003; 44(3/4): 207-295. ISSN:
0044-605X.
NAL Call No.: 41.8
AC87
Descriptors: goats, Johne’s disease,
present knowledge, eradication, diagnosis, control programs and strategies, Mycobacterium avium subsp. paratuberculosis, possible cause of
Crohn’s disease in humans, herd level antibodies, milk contamination,
Anonymous. Animal health following drought. Agnote
DAI-224. Agnote NSW Agriculture. 2003; (DAI-224
(2nd Edition)): 8 p. ISSN: 1034-6848.
URL: http://www.agric.nsw.gov.au/reader/5747
Descriptors: cattle, bulls, Johne’s
disease, animal health, animal welfare, stocking density, vaccination, drought
grass tetany, brucellosis, helminthes, leptospirosis,
Arsenault, J.; Girard, C. Particularites ovines de la
paratuberculose. [Particularities
of ovine paratuberculosis.] Medecin Veterinaire du Quebec. 2003; 33(1-2): 28-31. ISSN: 0225-9591. Note: In French.
Descriptors: sheep, Johne’s disease,
clinical aspects, diagnosis, disease transmission, disease prevention and
control, risk factors, paratuberculosis.
Arsenault, Julie; Girard, Christiane; Dubreuil, Pascal; Daignault, Danielle;
Galarneau, Jean Rene; Boisclair, Julie; Simard, Carole; Belanger, Denise. Prevalence of and carcass condemnation from
maedi-visna, paratuberculosis and caseous lymphadenitis in culled sheep from
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: culled sheep, ewes,
rams, Corynebacterium
pseudotuberculosis, Mycobacterium
avium subsp. paratuberculosis,
lung and mammary gland lesions, caseous lymphadenitis, ELISA testing, histologic
lesions in terminal ileum, ileocecal lymph node/ ileocecal valve, sex and age
differences, carcass condemnation, disease distribution, disease prevalence,
epidemiology, lymphadenitis, paratuberculosis, seroprevalence, sex differences,
visna maedi virus, Quebec, Canada.
Australia NSW OJD Advisory
Committee. Future Management of OJD is in Your
Hands. 2003; 5
p.
Descriptors: sheep, Johne’s disease,
disease control, disease prevalence, disease prevention,
Balseiro, A.; Prieto, J.M.; Espi, A.; Perez, V.; Garcia-Marin, J.F. Presence of focal and multifocal
paratuberculosis lesions in mesenteric lymph nodes and the ileocaecal valve of
cattle positive to the tuberculin skin test. Veterinary Journal. 2003; 166(2): 210-212. ISSN: 1090-0233.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=7163&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f68d9c40dd58509407a11a133122c879
NAL
Call No.:
SF601.V484
Descriptors: cattle, animal with
positive (91 animals) and negative (43 animals) tuberculin skin tests,
immunohistochemistry testing for Mycobacterium avium subsp. paratuberculosis, small intestine,
cecum, mesenteric lymph nodes, ileum, ileocecal valve, clinical aspects,
granulomas, mesentery, pathology.
Bannantine, J.P.; Hansen, J.K.; Stabel, J.R.; Kapur, V. Evaluation of novel Mycobacterium avium subsp. paratuberculosis antigens as potential
diagnostic reagents. Abstracts of the General Meeting of the
American Society for Microbiology. 2003; 103: U-051. ISSN: 1060-2011. Note: 103rd American Society for Microbiology
General Meeting,
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium subsp. avium, differentiation between the 2
species, 21 predicted coding sequences unique to MAP, amplified and cloned into
an E. coli expression vector,
immunoblotting studies, sera from rabbits and mice, 5 gene products detected in
all sera, same proteins in infected cattle, method to identify novel
antigens.
Bannantine, John P.; Zhang, Qing; Li, Ling Ling; Kapur, Vivek. Genomic homogeneity between Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis belies their divergent
growth rates. BMC Microbiology. 2003; 3(10): (Cited June 13, 2003). ISSN: 1471-2180.
URL:
http://www.biomedcentral.com/1471-2180
Descriptors: Mycobacterium avium, Mycobacterium avium subsp. avium, Mycobacterium avium subsp. paratuberculosis, nucleotide sequences,
genome similarities, genomic comparison study, oligonucleotide primers,
conserved gene order in the oriC locus of Mycobacterium avium subsp. paratuberculosis, genetic variation
between species, growth rate differences, open reading
frames.
Bannantine, John P.; Huntley, Jason F.J.; Miltner, Elizabeth; Stabel, Judith
R.; Bermudez, Luiz E. The Mycobacterium avium subsp. paratuberculosis 35 kDa protein plays
a role in invasion of bovine epithelial cells. Microbiology. 2003; 149(8): 2061-2069. ISSN: 1350-0872.
URL: http://mic.sgmjournals.org/contents-by-date.0.shtml
NAL
Call No.:
QR1.J64
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, E. coli , Johne’s disease, antibodies,
DNA cloning, gene expression, 35kDa major membrane proteins (MMP), bacterial
invasion of bovine epithelial cells, intestinal environment of low oxygen and
high osmolarity, surface proteins, virulence factors.
Barrington, G.M.; Gay, J.M.;
Eriks, I.S.; Davis, W.C.; Evermann, J.F.; Emerson, C.; O' Rourke, J.L.;
NAL Call No.:
SF774.J68
Descriptors: cows, Mycobacterium avium subsp. paratuberculosis, diagnosis, diagnostic
techniques and strategies, ELISA, paratuberculosis, PCR of blood, milk, liver,
feces, temporal variation, fecal cultures, diagnostic sensitivity
figures.
Benedictus, G.; Kalis, C.J.H. Paratuberculosis: eradication, control and
diagnostic methods. Acta Veterinaria Scandinavica. 2003; 44(3/4): 231-241. ISSN:
0044-605X.
NAL Call No.: 41.8
AC87
Descriptors: sheep, goats, cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
control programs, culling of sick animals, diagnostic techniques, disease
control, vaccination, immunity, immunizations, reviews,
ODGE.
Boegli-Stuber, K.; Glanemann, B.; Seitert, G.; Kohler, C.; Wittwer, M.;
Wittenbrink, M.M.; Bissig-Choisat, B.
Development and validation of a
real-time PCR assay for the detection of Mycobacterium avium subspecies paratuberculosis (MAP) in fecal samples
and its correlation to culture. FEMS Congress of European Microbiologists
Abstract Book. 2003; (1):
54. Note: 1st Federation of European
Microbiological Societies (FEMS) Congress of European Microbiologists,
Descriptors: Mycobacterium avium subsp. paratuberculosis, fecal sampling,
detection methods, real-time PCR.
Bolske, G.; Englund, S. Ongoing research on paratuberculosis in
NAL Call No.: 41.8
AC87
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, research programs on
Johne’s disease, control programs, diagnosis, diagnostic techniques, ELISA, PCR,
Buddle, B.M.; McCarthy, A.R.; Ryan, T.J.; Pollock, J.M.; Vordermeier, H.M.;
Hewinson, R.G.; Andersen, P.; De Lisle, G.W. Use of mycobacterial peptides and
recombinant proteins for the diagnosis of bovine tuberculosis in skin
test-positive cattle. Veterinary Record
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8 V641
Descriptors: bovine tuberculosis,
cattle, synthetic peptides, antigen detection, skin lesions, skin tests,
paratuberculosis, diagnostic techniques, cross reaction, tuberculin, recombinant
proteins, disease diagnosis, Mycobacterium bovis, interferons, skin
folds, vaccination, Mycobacterium avium
subsp. paratuberculosis, animal
pathogenic bacteria.
Buergelt, C.D.; Williams, E. In utero infection of pregnant cattle by Mycobacterium avium subspecies paratuberculosis detected by nested
polymerase chain reaction. Journal of Applied Research in Veterinary
Medicine. 2003; 1(4): 279-284.
ISSN:
1471-2180.
URL: http://www.jarvm.com/
NAL
Call No.:
SF601.J63
Descriptors: nested PCR using 2 sets
of primers, detection of Mycobacterium
avium subsp. paratuberculosis in
fetal fluid and fetal tissues, 3 pregnant cows with clinical Johne’s disease,
necropsy, various tissues tested, Mycobacterium avium subsp. paratuberculosis found in various
tissues, PCR assay useful for in utero infection.
Bull, Richard. Assessment of the NSW Ovine Johne's Disease
Program: [Summary]. NSW Ministry of Agriculture,
NAL Call No.: SF969.P34 B86 2003
Descriptors: sheep, paratuberculosis,
Mycobacterium avium subsp. paratuberculosis, assessment of the
current Ovine Johne's Disease (OJD) program, recommendation for the future,
Bull, T.J.; Sidi-Boumedine, K.; McMinn, E.J.; Stevenson, K.; Pickup, R.;
Hermon-Taylor, J. Mycobacterial interspersed repetitive units
(MIRU) differentiate Mycobacterium
avium subspecies paratuberculosis
from other species of the Mycobacterium
avium complex. Molecular and
Cellular Probes. 2003; 17(4):
157-164. ISSN:
0890-8508.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6959&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=a1d954773ca83f03ff7b5c0d870580ef
NAL
Call No.: RB43.7
M63
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium subsp. avium, Mycobacerium avium complex,
mycobacterial interspersed repetitive units, 18 conserved loci, 6 loci differ,
locus specific PCR, Mycobacterium
avium subsp. paratuberculosis
segregated into 2 major groups, ovine pigmented Mycobacterium avium subsp. paratuberculosis and vaccine strains, Mycobacterium avium subsp. avium differentiated into 5 profiles, Mycobacterium intracellulare, mycobacterial
interspersed repetitive units locus 1 and mycobacterial interspersed repetitive
units locus 4 distinguished between Mycobacterium avium subsp. paratuberculosis and Mycobacerium avium
complex.
Buza, Joram J.; Mori, Yasuyuki; Bari, Abusaleh M.; Hikono, Hirokazu; Aodon
Geril; Hirayama, Sachiyo; Shu, Yujing; Momotani, Eiichi. Mycobacterium avium subsp. paratuberculosis infection causes
suppression of RANTES, monocyte chemoattractant protein 1, and tumor necrosis
factor alpha expression in peripheral blood of experimentally infected
cattle. Infection and Immunity.
2003; 71(12): 7223-7227. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors:
Caspersen, O. Spildt ko: afmagrede malkekoer med Darlig
velfaerd er et stigende problem.
Wasted cows. [Emaciated
dairy cattle with poor welfare status are a growing problem.] Dansk Veterinaertidsskrift. 2003; 86(17): 12-14. ISSN: 0106-6854. Note: In
Danish.
Descriptors: dairy cattle,
generalized muscular atrophy, failing pre-slaughter inspection, post mortem
inspections show chronic intestinal inflammation, probably Mycobacterium avium subsp. paratuberculosis, increasing trend,
economic costs, animal welfare concerns, Denmark.
Checkley, S.L.; Waldner, C.L.; Appleyard, G.D.; Campbell, J.R.; Forsythe,
L.A.; Janzen, E.D. The comparison of 5 diagnostic tests for
diagnosis of Johne's disease in
URL:
http://www.jarvm.com/
NAL
Call No.:
SF601.J63
Descriptors: 5 diagnostic tests for
Mycobacterium avium subsp. paratuberculosis, Johne’s disease
compared, 1) ELISA, 2) fecal culture slants of HEYM, 3) AGID, 4-5) 2 PCR, 5
populations of cattle, testing results varied with populations, Canada.
Christopher-Hennings, J.; Dammen, M.A.; Weeks, S.R.; Epperson, W.B.; Singh,
S.N.; Steinlicht, G.L.; Fang, Y.; Skaare, J.L.; Larsen, J.L.; Payeur, J.B.;
Nelson, E.A. Comparison of two DNA extractions and
nested PCR, real-time PCR, a new commercial PCR assay, and bacterial culture for
detection of Mycobacterium avium
subsp. paratuberculosis in bovine
feces. Journal of Veterinary Diagnostic
Investigation. 2003; 15(2):
87-93. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: cattle, bacterial
diseases, Johne’s disease, detection of Mycobacterium avium subsp. paratuberculosis, fecal testing, 5
combinations of 2 DNA extractions and 3 polymerase chain reaction (PCR)
techniques, compared, diagnostic techniques, southern blotting, all showed
similar sensitivities.
Collins, M.T. Paratuberculosis: review of present
knowledge. Acta Veterinaria Scandinavica. 2003; 44(3/4): 217-221. ISSN: 0044-605X. Note: Review article.
NAL Call No.: 41.8
AC87
Descriptors: cattle, humans, Mycobacterium avium subsp. paratuberculosis, Crohn’s disease,
Johne’s disease, pathogenesis, clinical aspects, disease prevalence, disease
prevention and control, economic impacts of disease, potential zoonotic disease,
food safety, public health concerns.
Collins, M.T. Update on paratuberculosis. 1. Epidemiology
of Johne's disease and the biology of Mycobacterium paratuberculosis.
Irish Veterinary Journal. 2003; 56(11): 565-574. ISSN: 0368-0762.
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
epidemiology, host range of bacterial pathogen, disease distribution, disease
prevalence, disease transmission, pathogenicity, virulence, survival mechanisms,
cold tolerance, heat tolerance, pasteurization.
Collins, M.T. Update on paratuberculosis. 2. Pathology
and diagnosis. Irish Veterinary Journal. 2003; 56(12): 619-620, 622-623. ISSN: 0368-0762.
Descriptors: goats, cattle, sheep, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis clinical aspects,
lesions, histopathology, diagnosis, diagnostic techniques.
Corner, L.A.L.; Pfeiffer, D.U.; Abbott, K.A. Unanswered questions about the transmission
of Mycobacterium avium subspecies paratuberculosis. Veterinary Journal. 2003; 165(3): 182-183. ISSN: 1090-0233.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=7163&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f68d9c40dd58509407a11a133122c879
NAL
Call No.:
SF601.V484
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, disease transmission,
disease vectors.
Coussens, Paul M.; Colvin, Christopher J.; Rosa, Guilherme J.M.; Laspiur,
Juliana Perez; Elftman, Michael D.
Evidence for a novel gene
expression program in peripheral blood mononuclear cells from Mycobacterium avium subsp. paratuberculosis-infected cattle. Infection and Immunity. 2003; 71(11): 6487-6498. ISSN:
0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: Holstein-Fresian cattle,
infected and uninfected animals, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, gene expression
profiles, peripheral blood mononuclear cells (PBMCs) cell mediated immunity, in
vivo and in vitro comparison, gene expression, complementary DNA, immune
response, interferon, lymphocytes, molecular genetics.
Cywinska, A.; Bas, M. Czy paratuberkuloza jest zoonoza? [Is paratuberculosis a
zoonosis?]. Zycie Weterynaryjne. 2003; 78(3): 155-160. ISSN: 0137-6810. Note: In Polish with an English summary.
NAL Call No.: SF604.Z9
Descriptors: ruminants, humans, Mycobacterium avium subsp. paratuberculosis, Johne’s disease in
animals, Crohn’s disease in humans, disease transmission possibilities, raw
milk, food contamination, food safety, zoonoses.
Dagleish, M.; Goddard, P. Dealing with disease. Deer Farming. 2003; (74):
23-25.
Descriptors: deer, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, diagnosis,
pathology, epidemiology, pathogenesis, disease control, vaccination,
Daniels, Mike J.; Hutchings, Michael R.; Beard, Philippa M.; Henderson,
Dennis; Greig, Alastair; Stevenson, Karen; Sharp, J. Michael. Do non-ruminant wildlife pose a risk of
paratuberculosis to domestic livestock and vice versa in
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: non-ruminant wildlife,
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis, disease
surveys, disease transmission, disease vectors, epidemiological surveys,
epidemiology paratuberculosis, risk assessment, pasture contamination, rabbits,
canid, mustelid, corvid, murids, review, Scotland.
Daniels, M.J.; Henderson, D.; Greig, A.; Stevenson, K.; Sharp, J.M.;
Hutchings, M.R. The potential role of wild rabbits Oryctolagus cuniculus in the
epidemiology of paratuberculosis in domestic ruminants. Epidemiology and Infection. 2003; 130(3): 553-559. ISSN: 0950-2688.
URL: http://journals.cambridge.org/action/displayJournal?jid=HYG&bVolume=y
NAL
Call No.:
RA651.A1E74
Descriptors: cattle, sheep,
ruminants, Mycobacterium avium subsp.
paratuberculosis found in wild
rabbits, Oryctolagus cuniculus, fecal
pellets, urine, field contaminations, 4 farms, rabbit control should be
considered as part of a disease control strategies,
Daniels, Mike J.; Lees, Jon D.; Hutchings, Michael R.; Greig, Alastair. The ranging behaviour and habitat use of
rabbits on farmland and their potential role in the epidemiology of
paratuberculosis. Veterinary Journal. 2003; 165(3):
248-257. ISSN: 1090-0233.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=7163&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f68d9c40dd58509407a11a133122c879
NAL
Call No.: SF601
V484
Descriptors: rabbits, potential
disease reservoir, Mycobacterium
avium subsp. paratuberculosis,
grazing animals, non-avoidance of rabbit pellets, infected farm study,
seasonal effects and spatial differences in rabbit feces deposition, management
practices to reduce livestock exposure, Scotland.
Daniels, M.J.; Hutchings, M.R.; Greig, A. The risk of disease transmission to
livestock posed by contamination of farm stored feed by wildlife
excreta. Epidemiology and Infection. 2003;
130(3): 561-568. ISSN: 0950-2688.
URL:
http://journals.cambridge.org/action/displayJournal?jid=HYG&bVolume=y
NAL
Call No.:
RA651.A1E74
Descriptors: wild mice and rats, Apodemus sylvaticus, Mus domesticus, Musculus, Rattus novegicus, wild birds, Passer domesticus, Columba livia, pigeons, livestock,
cattle, sheep, livestock feed, role of feed contamination by wild animal feces,
microbial disease transmission, disease reservoirs, cryptosporidiosis,
salmonellosis, Salmonella, Mycobacterium avium subsp. paratuberculosis, infectious
probabilities, indications feed is a potential source of the 3 diseases, Scotland, United
Kingdom.
De A. Pinto, P.S. Atualizacao em
controle da tuberculose no contexto da inspecao de carnes. [Tuberculosis control update at the meat
inspection context.] Bioscience Journal. 2003; 19(1): 115-121. ISSN: 1516-3725. Note: In Portuguese with an English summary.
NAL Call No.:
QH301.R485
Descriptors: cattle, humans, pigs,
Mycobacterium avium subsp. paratuberculosis, Johne’s disease, Mycobacterium bovis, tuberculosis, pathogenecity,
lesions, diagnosis, disease control, food safety, meat inspections tuberculosis,
zoonotic diseases.
De Lisle, G.W.; Yates, G.F.;
NAL
Call No.: 41.8
N483
Descriptors: 619 deer, 299 farmed
deer herds, Mycobacterium avium
subsp. paratuberculosis, disease
prevalence, epidemiology, case histories, statistics of infection presented,
diagnostic techniques,
Denmark Danish Cattle
Federation. Annual Report - Danish Cattle Federation,
2003. Danish Agricultural
Advisory Service, National Centre.
Descriptors: cattle farming status,
marketing, EU reforms, cattle feeding, nutrient standards, feed quality,
breeding and breeding value across Nordic Countries, dry periods of dairy cows,
housing, welfare, disease prevention, control, monitoring programs, Salmonella Dublin and Mycobacterium avium subsp. paratuberculosis,
Denmark.
Deutz, A.; Spergser, J.; Rosengarten, R.; Kofer, J. Erstnachweis der intrauterinen Ubertragung
von Paratuberkulose bei Rot- und Gamswild.
[First detection of intrauterine transmission of paratuberculosis in
URL: http://springerlink.metapress.com/(opn50t45wrpt3u55vedijdvb)/app/home/journal.asp?referrer=parent&backto=linkingpublicationresults,1:110828,1
NAL
Call No.:
SK351.Z45
Descriptors:
Deutz, A.; Spergser, J.; Wagner, P.; Steineck, Th.; Kofer, J.; Rosengarten,
R. Increase of patatuberculosis in wild animal
species in Styria. FEMS Congress of European Microbiologists
Abstract Book. 2003; (1):
496. Note: 1st Federation of European
Microbiological Societies (FEMS) Congress of European Microbiologists,
Descriptors: wild animal species,
mouflon, fallow deer,
Deutz, A.; Spergser, J.; Wagner, P.; Steineck, Th; Koefer, J.; Rosengarten,
R. Paratuberkulose bei Wildtieren: Haeufung
klinischer Faelle in freier Wildbahn.
[Paratuberculosis in wild animals: An observed increase in the clinical
incidence.] Tieraerztliche
Umschau. 2003; 58(9): 482-489.
ISSN: 0049-3864. Note: In German with an English summary.
NAL Call
No.: 41.8
T445
Descriptors: Mycobacterium avium subsp. paratuberculosis, disease incidence,
wild animals, red deer, roe deer, chamois, mouflon, fallow deer, yellow necked
mouse, factors for increase, potential for improved diagnostic methods,
prevention measures, meat hygiene issues, Stryia, South
Austria.
Djonne, B.; Jensen, M.R.; Grant, I.R.; Holstad, G. Detection by immunomagnetic PCR of Mycobacterium avium subsp. paratuberculosis in milk from dairy
goats in
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.:
SF601.V44
Descriptors: goats, goat milk, Mycobacterium avium subsp. paratuberculosis, subclinical
infections, epidemiological surveys, paratuberculosis, PCR, vaccination,
Djonne, B.; Jensen, M.R.; Grant, I R.; Holstad, G. Detection of Mycobacterium avium subsp. paratuberculosis in goats milk by
immunomagnetic PCR. FEMS Congress of European Microbiologists
Abstract Book. 2003; (1):
453. Note: 1st Federation of European
Microbiological Societies (FEMS) Congress of European Microbiologists,
Descriptors: Mycobacterium avium subsp. paratuberculosis, detection method,
immunomagnetic PCR, goat’s milk.
Djonne, B.; Ahrens, P.; Pavlik,
Descriptors: cattle, goats, Mycobacterium avium subsp. paratuberculosis, isolate typing,
Djonne, B. Paratuberculosis in goats - a special focus
on the Nordic countries. Acta Veterinaria Scandinavica. 2003; 44(3/4): 257-259. ISSN:
0044-605X.
NAL Call No.: 41.8
AC87
Descriptors: goats, Johne’s disease, vaccination,
animal pathogen, Mycobacterium avium
subsp. paratuberculosis, clinical
picture, histopathology, diagnosis, disease control and transmission,
vaccination, Denmark, Finland, Iceland, Norway, Sweden, Scandanavian.
Dohmann, K.; Strommenger, B.; Stevenson, K.; Gerlach, G. Analysis of different Mycobacterium avium ssp. paratuberculosis specific DNA regions in
M. avium ssp. paratuberculosis isolates of different
host groupings. Abstracts of the General Meeting of the
American Society for Microbiology. 2003; 103: U-061. ISSN: 1060-2011. Note: 103rd American Society for Microbiology
General Meeting,
Descriptors: Mycobacterium avium subsp. paratuberculosis, DNA analysis of 13
isolates, different host grouping, cattle, sheep, goat, human, PCR, high
homology.
Dohmann, K.; Strommenger, B.; Stevenson, K.; de Juan, L.; Stratmann, J.;
Kapur, V.; Bull, T.J.; Gerlach, G.F. Characterization of genetic differences
between Mycobacterium avium subsp. paratuberculosis type I and type II
isolates. Journal of Clinical Microbiology. 2003; 41(11): 5215-5223. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=81
NAL
Call No.:
QR46.J6
Descriptors: cattle, sheep, Mycobacterium avium subsp. paratuberculosis, isolate
differences, type I from sheep, type
II from cattle, nucleotide sequences, genetic variations, molecular biology,
molecular genetics, evolutionary hypothesis.
Englund, Stina. IS900/ERIC-PCR as a tool to distinguish Mycobacterium avium subsp. paratuberculosis from closely related
mycobacteria. Veterinary Microbiology. 2003; 96(3): 277-287. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.:
SF601.V44
Descriptors: Mycobacterium avium subsp. paratuberculosis, methods to separate
closely related mycobacteria, strain typing, comparison study, rep PCR and
conventional RFLP, genetic fingerprints, enterobacterial intergenic consensus
(ERIC) sequence, MAP specific insertion sequence IS900, Mycobacterium avium subsp. avium, Mycobacterium intracellulare,
other Mycobacterium
species.
Ekbom, A. Paratuberculosis and Crohn's disease -
possible linkage? Acta Veterinaria Scandinavica. 2003; 44(3/4): 267-268. ISSN: 0044-605X.
NAL Call
No.: 41.8
AC87
Descriptors: humans, animals, Crohn’s
disease, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
epidemiology, zoonotic potential, risk factors.
Fischer, O.A.; Matlova, L.; Bartl, J.; Dvorska, L.; Svastova, P.; Du Maine,
R.; Melicharek, I.; Bartos, M.; Pavlik, I. Earthworms (Oligochaeta, Lumbricidae) and
mycobacteria. Veterinary Microbiology. 2003; 91(4): 325-338. ISSN:
0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Abstract: The objective of the study was to define
the role of earthworms in the survival of mycobacteria in animal populations.
In 13 sampling sites mycobacteria
were detected in 53 (5.5%) samples of faeces and parenchymatous tissues from
animals, in 25 (7.3%) environmental and in nine (8.2%) earthworm samples. In cattle and goat farms affected by Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) of IS900
restriction fragment length polymorphism (RFLP) type B-C1 was isolated from 37
(4.6%) faecal samples, three (1.4%) environmental and one (3.1%) earthworm
sample. Investigations of aviaries
affected by avian tuberculosis detected M. avium of genotype IS901+ and IS1245+
in six (7.9%) bird's faecal and in four (4.4%) environmental samples. M. avium (genotype IS901- and IS1245+)
was detected in four (4.4%) and M.
abscessus in one (1.1%) environmental sample. M.
avium of genotype IS901- and IS1245+ and M. gastri were isolated from three
(6.4%) earthworm samples. In pig
farm with mycobacteriosis M. avium of
genotype IS901- and IS1245+ was detected in five (20.0%) faecal samples from
pigs and in four (12.9%) environmental samples. M.
scrofulaceum was isolated in one (4.6%) sample of Lumbricus rubellus. In laboratory experiments identical RFLP
types of M. paratuberculosis were
isolated from bodies and faeces of earthworms 1-2 days after the last contact
with the faeces contaminated with the same RFLP type of M. paratuberculosis. The results suggest that earthworms may
become vectors of mycobacteria.
Descriptors: earthworms, disease
vectors, Mycobacterium avium subsp. paratuberculosis, mortality, fecal
sampling, parenchyma, cattle, goats, pigs, farms, RFLP, Mycobacterium avium, contamination, Mycobacterium abscessus, Mycobacterium
gastri, Mycobacterium scrofulaceum.
Fischer, O.A.; Matlova, L.; Dvorska, L.; Svastova, P.; Pavlik, I. Nymphs of the Oriental cockroach
(Blatta orientalis) as passive
vectors of causal agents of avian tuberculosis and paratuberculosis. Medical and Veterinary Entomology. 2003; 17(2): 145-150. ISSN:
0269-283X.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=mve%20
NAL Call No.:
RA639.M44
Descriptors: Mycobacterium avium, Mycobacterium avium subsp paratuberculosis, disease vectors, Blatta orientalis, Oriental cockroach
nymphs, experimental oral infection, isolated pathogens via RFLP, nymphs can
have and shed viable and virulent mycobacteria, Czech Republic.
Fredriksen, B.; Jarp, J. Factors affecting the herd level of
antibodies against Mycobacterium
avium subsp. paratuberculosis - a
case-control study. Acta Veterinaria Scandinavica. 2003; 44(3/4): 283. ISSN: 0044-605X.
NAL Call
No.: 41.8
AC87
Descriptors: dairy cattle, dairy
herds, antibody survey, Johne’s disease prevalence, disease transmission,
epidemiology, wild animals as disease reservoirs, risk factors,
Fridriksdottir, V.; Gunnarsson, E.; Sigurdarson, S.; Gudmundsdottir, K.B.
Paratuberculosis in
NAL Call
No.: 41.8
AC87
Descriptors: cattle, sheep, Mycobacterium avium subsp. paratuberculosis, Johne’s disease
research program, disease control, diagnostic techniques.
Fus, M.M.; Szteyn, J.; Wiszniewska, A.; Herman, L. Comparison of three methods of releasing
DNA from Mycobacterium avium subsp.
paratuberculosis cells. Bulletin of the Veterinary Institute in
Puawy. 2003; 47(1):
107-112. ISSN: 0042-4870.
Descriptors: Mycobacterium avium subsp. paratuberculosis, DNA release methods,
cell wall lysis, SDS, NaOH, sodium hydroxide, high and low temperatures,
mini-bead beater.
Grant, I.R.; Kirk, R.B.; Hitchings, E.; Rowe, M.T. Comparative evaluation of the MGITTM and
BACTEC culture systems for the recovery of Mycobacterium avium subsp. paratuberculosis from milk. Journal of Applied Microbiology. 2003; 95(1): 196-201. ISSN: 1364-5072.
URL: http://www.blackwellpublishing.com/journal.asp?ref=1364-5072%20
Descriptors: Mycobacterium avium subsp. paratuberculosis, spiked milk, testing
for bacterial contamination, methods, Mycobacterium Growth Indicator Tubes,
MGITTM, BACTEC460TB culture system, detection comparison, culture
media.
Grant, I.R. Mycobacterium paratuberculosis and
milk. Acta Veterinaria Scandinavica. 2003; 44(3/4): 261-266. ISSN: 0044-605X.
NAL Call No.: 41.8
AC87
Descriptors: cattle, humans, Mycobacterium avium subsp. paratuberculosis contaminated milk,
research on the risk of transfer to humans, milk testing, bacterial can survive
pasteurization, raw and commercial milk can be source of Mycobacterium avium subsp. paratuberculosi.
Groenendaal, H. Controlling Johne's disease: results of
computer modelling. Cattle Practice. 2003; 11(4): 219-225. ISSN: 0969-1251.
NAL Call No.:
SF961.C37
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, "JohneSSim model"
computer simulation model, evaluates economic and epidemiological 3 disease
control strategies, 1) test and cull, 2) calf hygiene management, 3)
vaccination, The Netherlands, United States.
Groenendaal, Huybert; Galligan, David T. Economic consequences of control programs
for paratuberculosis in midsize dairy farms in the
NAL Call No.: 41.8
AM3
Descriptors: dairy herds, dairy
farms, Mycobacterium avium subsp. paratuberculosis, disease
prevalence, control programs,
epidemiology, vaccination, paratuberculosis simulation models,
vaccination.
Groenendaal, Huybert; Nielen, Mirjam; Hesselink, Jan Willem. Development of the Dutch Johne's disease
control program supported by a simulation model. Preventive Veterinary Medicine. 2003; 60(1): 69-90. ISSN:
0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: dairy cattle herds, beef cattle herds, Mycobacterium avium subsp. paratuberculosis, disease control,
simulation model—JohneSSim, test and cull strategies, not economical, improved
calf hygiene management, Paratuberculosis Program Netherlands (PPN), The
Netherlands.
Gunnarsson, E.; Fridriksdottir, V.; Sigurdarson, S. Control of paratuberculosis in
NAL Call
No.: 41.8 AC87
Descriptors: cattle, sheep, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
diagnosis, mortality, disease prevalence, prevention, vaccination, disease
transmission,
Hanson, Timothy E.; Johnson, Wesley O.; Gardner, Ian A.; Georgiadis, Marios
P. Determining the infection status of a
herd.
Journal of Agricultural Biological and Environmental Statistics.
2003; 8(4): 469-485. ISSN: 1085-7117.
NAL Call No.: S566.55.J68
Descriptors: dairy herds, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
disease prevalence, hierarchical model, hypergeometric or binomial sample,
animal screening data, variables, infection status of herd, diagnostic test
accuracy, herd prevalence.
Hendrick, S.; Duffield, T.; Kelton, D.; Leslie, K.; Lissemore, K.;
Archambault, M. A relative comparison of diagnostic tests
for Johne's disease. Journal of Dairy Science. 2003; 86(Suppl. 1): 84-85. ISSN: 0022-0302. Note: Joint Annual Meeting of the American
Dairy Science Association, the American Society of Animal Science and the
Mexican Association of Animal Production,
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: cattle, Johne’s disease,
diagnostic tests, comparison study.
Hickey, S M.;
NAL Call No.: 49.9
N483
Descriptors: Mycobacterium avium subsp. paratuberculosis, Merino sheep breed,
Romney sheep breed, heritability of disease resistance, Johne’s disease
susceptibility, quantitative genetics, not a very viable approach, AgResearch's
Tokanui Station, New Zealand.
Hill, B.B.; West, M.; Brock, K.V. An estimated prevalence of Johne's disease
in a subpopulation of
NAL Call No.:
SF774.J68
Descriptors: beef cattle, estimate
the overall prevalence of animals infected with Mycobacterium avium subsp. paratuberculosis, antibody testing of
sera, 79 beef herds in Alabama Brucellosis Certification program, ELISA test,
disease prevalence, disease surveys, 50% of the herds infected with MAP, overall
prevalence of 8%,
Hines,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8%20
NAL
Call No.:
SF601.V44
Descriptors: Mycobacterium avium subsp. paratuberculosis, cell wall deficient
forms, Crohn's disease, humans, immune response, pathogenesis, ultrastructure,
Johne’s disease, cattle.
Holliman, A. Restocking problems post-FMD. Cattle Practice. 2003; 11(4): 311-312. ISSN:
0969-1251.
NAL Call No.:
SF961.C37
Descriptors: cattle, restocking after
depopulations due to FMD, importation of heifers, disease transmission from
outside, lack of biosecurity to prevent diseases transferred, tuberculosis, BVD,
IBR,
Holmstrom, A.; Kyhlstedt, U.; Robertsson, J.A.; Stengarde, L. Control of paratuberculosis in
NAL Call
No.: 41.8
AC87
Descriptors: beef cattle, Johne’s
control programs, disease prevalence,
Holstad, G.; Sigurdardottir, O.; Valheim, M.; Storset, A.; Olsen, L.;
Halldorsdottir, S.; Djonne, B.; Fredriksen, B.
Mycobacterium avium subspecies
paratuberculosis - a review of
present research in
NAL Call
No.: 41.8
AC87
Descriptors: cattle, goats, sheep,
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis, animal
disease research, epidemiology, disease transmission, diagnostics, Johne’s
disease research in
Horwood, P.; McGowan, M.; Orpin, P.; Thompson,
NAL Call No.:
SF961.C37
Descriptors: dairy cattle, Johne’s
disease, Mycobacterium avium subsp. paratuberculosis, identify an accurate
and cost effective test, comparing testing sera and milk, available ELISA
assays,
Hostetter, J.; Steadham, E.; Haynes, J.; Bailey, T.; Cheville, N. Phagosomal maturation and intracellular
survival of Mycobacterium avium subspecies paratuberculosis in J774 cells. Comparative Immunology Microbiology and
Infectious Diseases. 2003;
26(4): 269-283. ISSN:
1085-7117.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5003&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=d84c7d4df471489f36fcab6d30fb7920
NAL
Call No.:
QR180.C62
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium smegmatis, inhibition of
phagosomal maturation, bacteria reside in phagosomal component of non-mature
phagolysome, macrophages, surface proteins, bacterial survival, transferring,
zymosan.
Huda, A.; Lind P.; Christoffersen, A.B.; Jungersen, G.
Analysis of repeated tests for interferon-gamma (IFN-gamma) response and
faecal excretion for diagnosis of subclinical paratuberculosis in Danish cattle.
Veterinary Immunology and
Immunopathology. 2003; 94(3-4):
95-103. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.:
SF757.2.V38
Descriptors: 425 dairy cattle, 10
infected and 5 non-infected dairy herds, Mycobacterium avium subsp. paratuberculosis, 3 consecutive
samplings, whole blood, fecal culture, diagnosis, diagnostic techniques,
INF-gamma, IDEXX-criteria, recommendations for test use and sensitivity,
interferon, paratuberculosis, Denmark.
Huda, A.; Jensen, H.E. Comparison of histopathology,
cultivation of tissues and rectal contents, and interferon-gamma and serum
antibody responses for the diagnosis of bovine paratuberculosis. Journal of Comparative Pathology. 2003; 129(4): 259-267. ISSN: 0021-9975.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6861&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=6091bef4d15aae1adbceffba708c6eb8%20
NAL
Call No.: 41.8
J82
Descriptors: cattle, infected and
non-infected dairy herds, Mycobacterium
avium subsp. paratuberculosis,
immune response, interferon, antibodies, diagnosis, diagnostic techniques,
histopathology of tissues, culture of serial rectal contents, testing blood for
IFN gamma and antibody responses, large intestine, small intestine tissue
samples, mesemteric lymph nodes, pharyngeal tonsil, retropharyngeal,
mediastinal, hepatic and supramammary lymphoid sampling, lymphnodes draining
jejunum, tissue culture.
Huda, A.; Jungersen, G.; Christoffersen, A.B.; Lind, P. Diagnosis of bovine paratuberculosis by
interferon-gamma (IFN- gamma ) test.
Acta Veterinaria Scandinavica.
2003; 44(3/4): 281. ISSN: 0044-605X.
NAL Call
No.: 41.8
AC87
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
diagnosis with interferon-gamma, immunodiagnosis.
Inglis, Neil F.; Stevenson, Karen; Heaslip, Darragh G.; Sharp, J. Michael.
Characterisation of IS901 integration sites
in the Mycobacterium avium
genome. FEMS Microbiology Letters. 2003; 221(1): 39-47. ISSN:
0378-1097.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=fml
NAL
Call No.:
QR1.F44
Descriptors: Mycobacterium avium, strains, cervine strain
JD88/118 and IS901, identification
and characterization, 17 chromosomal integration loci of element IS901, IS900,
IS901 inserts preferentially between a putative ribosome-binding sequence (RBS)
and translational start codon of an open reading frame
(ORF).
Jessep, T. Keeping bovine Johne's off your property.
Agnote NSW Agriculture. 2003; (DAI-50 (2nd Edition)): 1-4. ISSN: 1034-6848.
URL: http://www.agric.nsw.gov.au/reader/585
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, disease prevention
and control,
Jungersen, G. Infektionsforlob og immunologisk diagnostik
ved paratuberkulose. [The course of
infection and the immunological diagnosis of paratuberculosis.] Dansk Veterinaertidsskrift. 2003; 86(4): 6-10. ISSN: 0106-6854. Note: In Danish.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, symptoms, 5 stages of
course of infection outlined, immune response, immunological techniques,
diagnosis, diagnostic tests for different for each stage of the disease,
bacteria in feces, antibodies in blood serum, measurement cell mediated immune
response, interferon-gamma test for screening, ELISA rapid indication of
defective immune response.
Jungersen, G. Ongoing research on paratuberculosis in
Denmark 2001. Acta Veterinaria Scandinavica. 2003; 44(3/4): 279-280. ISSN: 0044-605X.
NAL Call
No.: 41.8
AC87
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
pathogenesis, epidemiology, diagnostic related research, disease prevalence,
disease transmission, research programs,
Kalis, C.H.J.; Collins, M.T.; Hesselink, J.W.; Barkema, H.W. Specificity of two tests for the early
diagnosis of bovine paratuberculosis based on cell-mediated immunity: the Johnin
skin test and the gamma interferon assay. Veterinary Microbiology. 2003; 97(1/2): 73-86. ISSN: 0378-1135.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.:
SF601.V44
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, assays for cell
mediated immunity, looking for early diagnosis, Johnin skin test, IFN gamma
test, diagnostic tests.
Kennedy, James A. Methodology and Computer Modeling of Pooled
Fecal Cultures to Determine Herd Status of Johne's Disease in Beef
Cattle. 2003; viii, 60 p.,
ill. Note: Thesis (M.S.).
Descriptors: Mycobacterium avium subsp. paratuberculosis, beef cattle, disease
status of herd, pooled fecal cultures, computer model, methods,
Khare, S.; Zhang, S.; Nunes, J.E.S.; Figueiredo, J.F.; Ficht, T.A.;
Rice-Ficht, A.C.; Adams, L.G. Bovine ligated ileal loop infected with Mycobacteium avium subspecies paratuberculosis: Ultrastructural
analysis of Peyer's patches and early changes in gene expression profiles of C-C
cytokines and C-X-C cytokine. Abstracts of the General Meeting of the
American Society for Microbiology. 2003; 103: Z-007. ISSN: 1060-2011. Note: 103rd American Society for Microbiology
General Meeting,
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, interaction between
intestinal mucus and pathogen, bovine ligated ileal, injected with live
pathogen, pathogen uptake, times sampling post infection, real time PCR,
invasion of Peyer’s patches.
Klausen, Joan; Huda, Anna; Ekeroth, Lars; Ahrens, Peter. Evaluation of serum and milk ELISAs for
paratuberculosis in Danish dairy cattle.
Preventive Veterinary
Medicine. 2003; 58(3-4):
171-178. ISSN: 0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: 580 dairy cows, 6 dairy herds with MAP, 2
dairy herds negative for Johne’s disease, Mycobacterium avium subsp. paratuberculosis, blood serum sampling,
milk comparison study, diagnostic methods, analytical methods, antibody testing,
ELISA and complement fixation tests, fecal sample culture, disease prevalence,
immunological techniques, paratuberculosis.
Kruip, T.A.M.; Muskens, J.; van Roermund, H.J.W.; Bakker, D.;
Stockhofe-Zurwieden, N. Lack of association of Mycobacterium avium subsp. paratuberculosis with oocytes and
embryos from moderate shedders of the pathogen. Theriogenology. 2003; 59 (7): 1651-1660. ISSN:
0093-691X.
NAL Call No.: QP251.A1T5
Abstract: Paratuberculosis is a chronic and
progressive disease of the intestine in ruminants caused by Mycobacterium avium subsp. paratuberculosis (Map). The bacterium is transmitted to young
animals, becomes manifest in adulthood and leads to economic losses. The aim of this study is to investigate
if cows shedding Map possess oocytes and embryos that are carriers of the
bacterium. New genetical material
can enter the dairy farm using embryo transfer but the question as to whether
this technique is safe with respect to transmission of paratuberculosis has yet
to be addressed. We selected and
bought 16 cows, all proven to be moderate shedders of the bacterium in the
faeces immediately prior to the experiment but none were clinically sick. One sample of uterine content was
collected from each animal by flushing the uterus on the day of heat and five
samples of homogenised uterine tissue were collected on the eighth day of the
same cycle by biopsy. In addition,
217 cumulus-oocyte complexes (COCs), ranging from 3 to 35 COCs per animal, were
collected using ultrasound guided transvaginal puncture of the ovarian follicles
(OPU). On the seventh day of the
subsequent cycle 31 embryos were obtained using the classic technique of super
ovulation induction, artificial insemination (AI), followed by flushing of the
uterus. These embryos have been
washed and trypsinised. Fourteen of
the 16 cows were treated again for super ovulation in the subsequent cycle and
19 foetuses were collected by opening of the uterus after euthanasia on Days
35-49 of the cycle. All samples
were cultured for presence of Map and checked every 2 months during 1 year for
bacterial growth. None of the
samples showed growth of Map after 12 months of culture. Pathological examination of the cows
revealed different degrees of severity of pathological alterations of the
intestinal tract and mesenteric lymph nodes. However, the results suggest that
neither in vivo embryo's nor oocytes are carriers of the bacteria and do not
form an extra risk at transfer. However, due to the limited size of the
experiment (sample size of 16 cows), a certain margin for error
remains.
Descriptors: dairy cows,
paratuberculosis, Mycobacterium avium
subsp. paratuberculosis, chronic
diseases, disease transmission
transplacental transmission, embryo transfer, superovulation, embryo
animal, cell culture, lymphadenitis, enteritis, histopathology, disease course,
cattle diseases, vertical transmission, embryo donors, The =Netherlands.
Kudahl, A.; Nielsen, S.S.; Sorensen, J.T. Effects of paratuberculosis on productivity
in Danish dairy cows. Acta Veterinaria Scandinavica Supplementum.
2003; (suppl. 98): 274. ISSN:
0065-1699. Note. J.F. Agger and N. Toft edited the
special issue.
Descriptors: dairy cows, effects of Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, age at first
calving, lactation, milk yields, protein content, culling, slaughter weights,
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=imm
NAL
Call No.: 448.3
IM6:
Descriptors: mice, animal disease
model, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
subsp. avium, macrophages, CD4+ T lymphocytes, cytokines, disease
models, immune response, major histocompatibility complex.
Lillini, E.; Macri, G.; Fagiolo, A.; Cersini, A.
Efficiency of laboratory methods in a bovine herd affected by Johne's
disease. In: Thanawongnuwech, R.; Ingkaninun, P. [Editors] Proceedings 11th International
Symposium of the World Association of Veterinary Laboratory Diagnosticians and
OIE Seminar on Biotechnology,
Descriptors: Mycobacterium avium subsp. paratuberculosis, diagnosis,
efficiency of diagnostic techniques, disease prevalence, epidemiology,
immunological techniques, PCR,
Lesser, A. Paratuberkulose: Ein weit verbreitetes
Problem in Rinderbestnden.
[Paratuberculosis. A very widespread problem in dairy herds.] Milchpraxis. 2003; 41(4): 172-175. ISSN: 0343-0200. Note: In German.
NAL Call
No.: SF221
M5
Descriptors: dairy calves, neonates,
dairy cows, colostral immunity, Mycobacterium avium subsp. paratuberculosis, disease prevention,
disease prevalence,
Lipiec, Marek. Paratuberkuloza jako zoonoza. [Paratuberculosis as a zoonosis.]
NAL Call No.: 41.8
M463
Descriptors: Mycobacterium avium subsp. paratuberculosis, potential as a
zoonotic disease via contaminated milk and milk products, Crohn's disease,
humans, review.
Lucas, J.N.; Cousins, D.V.; Mills, A.J.; Van Wijk, J.G.A. Identification of Mycobacterium avium subsp avium in an alpaca with lesions
resembling paratuberculosis. Australian Veterinary Journal. 2003; 81(9): 567-569. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: alpacas, Mycobacterium avium subsp. paratuberculosis, Johne’s disease, case
reports, clinical aspects, diagnosis, identification, histopathology,
paratuberculosis.
Mackintosh, C.G.; Wilson, P.R. Impact of diseases on the NZ deer
industry. Proceedings of the
NAL Call No.: 49.9
N483
Descriptors: deer farming, farmed
deer industry, economic impacts of diseases, animal health care costs, clinical
and subclinical disease states, disease control and prevention, better disease
screening technologies, nutritional deficiencies and toxicities, bacterial
diseases, leptospirosis, malignant catarrhal fever, nematode parasites, bovine
tuberculosis, Johne’s disease, New Zealand.
Manning, Elizabeth J.B.; Augenstein, Monica; Collins, Michael T.; Nelson,
Kathryn M. Case report: Johne's disease: The recipient
risk. Bovine Practitioner. 2003; 37(1): 20-22. ISSN: 0524-1685. Note: In English with a French summary.
NAL Call No.:
SF779.5.A1B6
Descriptors: calves, cows, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
embryo transfer, intrauterine transmission, became test positive during
pregnancy, calf diagnosed 2 years later, no postnatal exposure, vertical
transmission concerns, case reports, Wisconsin, United
States.
Manning, E.J.B.; Steinberg, H.; Krebs, V.; Collins, M.T. Diagnostic testing patterns of natural Mycobacterium paratuberculosis infection
in pygmy goats. Canadian Journal of Veterinary Research.
2003; 67(3): 213-218. ISSN: 0830-9000. Notes: In English with a French summary.
URL:
http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=133
NAL
Call No.: SF601.C24
Descriptors: 13 pigmy goats, Capra hircus, naturally infected herd,
Mycobacterium avium subsp. paratuberculosis, 4 diagnostic assays,
gamma interferon (IFN gamma), serum antibody ELISA and agar gel diffusion
(AGID), radiometric fecal culture, tissues collected at necropsy, isolates
confirmed with IS900 PCR, false positives and false negatives, need to use
multiple tests.
Manning, Elizabeth J.B.; Kucera, Thomas E.; Gates, Natalie B.; Woods, Leslie
M.; Fallon McKnight, Maura. Testing for Mycobacterium avium subsp. paratuberculosis infection in
asymptomatic free-ranging tule elk from an infected herd. Journal of Wildlife Diseases. 2003; 39(2): 323-328. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: 45 tule elk, free
ranging asymptomic animals, Cervus
elaphus nannodes, Mycobacterium
avium subsp. paratuberculosis,
ELISA, agar gel immunodiffusion assay (AGID), fecal culture, 22 elk showed MAP,
10 of 22 euthanazed animals had histopathologic lesions, immunodiffusion, Point
Reyes National Seashore, Marin County, California, United
States.
Mercier, P. Sante: la paratuberculose caprine. [Paratuberculosis in goats.] Chevre. 2003; (254): 30-31. ISSN: 0045-6608. Note: In French.
Descriptors: goats, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, symptoms, lesions,
bacteriology, epidemiology, economic costs, methods of reducing incidence,
culling of sick animals, separation of kids, disinfection of buildings and
pastures.
Mork, Tormod; Heier, Berit Tafjord; Alvseike, Kristin Ruud;
Descriptors: terrestrial and aquatic
animals, bovine spongiform encephalopathy, BSE, Mycobacterium avium subsp. paratuberculosis, Salmonella, disease
control, epidemiological surveys,
Morris,
Descriptors: sheep breeds, Romneys,
Merinos, breed differences, crossbreds, disease prevalence of Johne’s disease,
epidemiology, New
Motiwala, A.S.; Strother, M.; Amonsin, A.; Byrum, B.; Naser, S.A.; Stabel,
J.R.; Shulaw, W.P.; Bannantine, J.P.; Kapur, V.; Sreevatsan, S. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited
strain diversity, strain sharing, and identification of unique targets for
diagnosis. Journal of Clinical Microbiology. 2003; 41(5): 2015-2026. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?iid=4818
NAL
Call No.:
QR46.J6
Descriptors: Mycobacterium avium subsp. paratuberculosis, molecular diversity of
animal and human strains, US isolates, sheep, cows, Johne’s disease (203
isolates), human Crohn’s disease (7 isolates), searching for specific diagnostic
molecular markers, multiplex PCR of IS900 integration loci (MPIL) and amplified
fragment length polymorphism (AFLP) analyses, DNA fingerprinting, identified a
high degree of genetic similarity between cow strains, relatively higher degree
of genetic heterogeneity among human and ovine strains.
Motiwala, A.S.; Strother, M.; Manning, E.; Sreevatsan, S. Restricted diversity within Mycobacterium avium subsp. paratuberculosis isolated from exotic
animal species from diverse geographic locations. Abstracts of the General Meeting of the
American Society for Microbiology. 2003; 103: U 039. ISSN: 1060-2011. Note: 103rd American Society for Microbiology
General Meeting,
Descriptors: cattle, captive and free
ranging wildlife, bison, duiker, elk, gnu, nyala, impala, and oryx, survey, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium subsp. avium, radiometric culture of fecal and
tissue samples, 16 isolates, ATCC19698, broth cultures, DNA molecular markers,
IS900, Mycobacterium avium subsp. paratuberculosis locus 251, HSP 65,
IS1311, restriction endomuclease analyses, single monomorphic clone of Mycobacterium avium subsp. paratuberculosis widespread
dissemination for cross species, United States.
Muehlherr, J.E.; Zweifel, C.; Corti, S.; Blanco, J.E.; Stephan, R. Microbiological quality of raw goat's and
ewe's bulk-tank milk in
URL:
http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: dairy goats, dairy
sheep, testing raw bulk milk, plate counts, Enterobacteriaceae counts, Staphylococcus aureus, Campylobacter spp., Shiga toxin
producing Escherichia coli, Salmonella spp., and Mycobacterium avium subsp. paratuberculosis, risk assessment
program for milk from small ruminants, Switzerland.
Mullerad, J.; Hovav, A.H.; Nahary, R.; Fishman, Y.; Bercovier, H.
Immunogenicity of a 16.7 kDa Mycobacterium paratuberculosis
antigen. Microbial Pathogenesis. 2003; 34(2): 81-90. ISSN: 0882-4010.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6954&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=0ce0cc81f81ede9640040947d652abf1
NAL
Call No.:
QR175.M53
Descriptors: mice as laboratory
animal models, Mycobacterium avium
subsp. paratuberculosis,
adjuvants, immune response, interferon, antigens biochemistry, delayed type
hypersensitivity, vaccination, immunization interleukin 10, interleukin 6,
nitric oxide, oxidoreductases, peroxidases, splenocytes.
Muskens, J.; Elbers, A.R.W.; van Weering, H.J.; Noordhuizen, J.P.T.M. Herd management practices associated with
paratuberculosis seroprevalence in Dutch dairy herds. Journal of Veterinary Medicine Series B.
2003; 50(8): 372-377. ISSN: 0931-1793
URL: http://www.blackwellpublishing.com/journal.asp?ref=0931-1793&site=1
NAL
Call No.: 41.8
Z52
Descriptors: dairy cows, 370 dairy
herds, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
epidemiology, disease prevention and control, management practices,
questionnaire study, risk factors, serological surveys, seroprevalence,
comparison between seropostive and seronegative herds, The
Netherlands.
Muskens, J.; Mars, M.H.; Elbers, A.R.W.; van Maanen, K.; Bakker, D. The results of using faecal culture as
confirmation test of paratuberculosis-seropositive dairy cattle. Journal of Veterinary Medicine Series B.
2003; 50(5): 231-234. ISSN:
0931-1793.
URL: http://www.blackwellpublishing.com/journal.asp?ref=0931-1793&site=1
NAL
Call No.: 41.8
Z52
Descriptors: 15,822 dairy cattle, 378
herds, ELISA, Mycobacterium avium
subsp. paratuberculosis, ages 3-6
year, age differences, confirmatory tests, fecal culture, disease control and
prevention, serology, vaccination.
URL: http://www.nap.edu/books/0309086116/html/
NAL Call No.: SF809.P375 D52 2003
Descriptors: diagnosis,
paratuberculosis, treatment, Mycobacterium avium subsp. paratuberculosis, various
methodologies.
Nielsen, S.S.; Toft, N.; Houe, H.; Enevoldsen, C. Paratuberkulose som sandsynlighedsdiagnose
- Brug af diagnoser - simple go komplekse.
[Probability diagnosis of paratuberculosis: use in diagnosis - simple or
complex.] Dansk Veterinaertidsskrift. 2003; 86(8): 6-10. ISSN: 0106-6854. Note: In Danish with an English summary.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, diagnostic
techniques, Johne’s disease, decision support system for diagnosis of complex
disease, computer model, animal characteristics.
Nielsen, S.S. Possibilities for intervention against
paratuberculosis in Danish dairy herds. Acta Veterinaria Scandinavica. 2003; 44(3/4): 289-290. ISSN:
0044-605X.
NAL Call No.: 41.8
AC87
Descriptors: dairy cattle, dairy
herds, ELISA diagnostic techniques, Mycobacterium avium subsp. paratuberculosis, disease control
programs, disease prevention,
Nielsen, S.S.; Agger, J.F. Comparison of milk and serum enzyme-linked
immunosorbent assays adjusted for time-related factors for the detection of
paratuberculosis in dairy cattle. Acta Veterinaria Scandinavica,
Supplementum. 2003; (Suppl.
98): 239. ISSN: 0065-1699. Note: J.F. Agger and N. Toft edited the
special issue.
NAL Call No.: 41.8 AC87
Suppl.
Descriptors: dairy cattle, Johne’s
disease, antibodies, milk, diagnosis, Mycobacterium avium subsp. paratuberculosis, diagnostic techniques,
ELISA, immune serum.
Olsen,
Descriptors: Mycobacterium avium subsp. paratuberculosis, IS element, ISMpal.
Ostrowski, M.; Mundo, S.L.; Harris, N.B.;
URL:
http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=sji
NAL
Call No.:
QR180.S3
Descriptors: cattle, infected
animals, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
immune response, antigens, bacteriophages, amino acid sequences, antibodies, B
lymphocytes epitopes, immune response, peptides, surface protein p34, T helper 1
(Th1) to a Th2 profile.
Ozbek, Ahmet; Michel, Frederick C. Jr. ; Strother, Megan; Motiwala, Alifiya
S.; Byrum, Beverly R.; Shulaw, William P.; Thornton, Charles G.; Sreevatsan,
Srinand. Evaluation of two recovery methods for
detection of Mycobacterium avium
subsp. paratuberculosis by PCR:
Direct-dilution-centrifugation and C18-carboxypropylbetaine processing. FEMS Microbiology Letters. 2003; 229(2): 145-151. ISSN: 0378-1097.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=fml
NAL
Call No.:
QR1.F44
Descriptors: : cattle, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
assays, diagnostic assays, asymptomatic infections, PCR, IS900 integration
sites, feces sampling, 2 recovery methods, direct dilution centrifugation
method, C18 carboxypropylbetaine (CB-18) based method, sensitive for subclinical
animals, diagnosis, diagnostic techniques.
Pak, S.I.; Kim, D.; Salman, M. Estimation of paratuberculosis prevalence
in dairy cattle in a
URL: http://www.ksvs.or.kr/
NAL
Call No.:
SF604.J68
Descriptors: dairy cows, cattle
diseases, paratuberculosis, Mycobacterium
avium subsp. paratuberculosis,
bacterial infections, disease prevalence, screening, antibody detection, disease
detection, ELISA, epitopes, recombinant proteins, accuracy, statistical
analysis, Bayesian theory, Korea Republic.
Paolicchi, F.A.; Zumarraga, M.J.; Gioffre, A.; Zamorano, P.; Morsella, C.;
Verna, A.; Cataldi, A.; Alito, A.; Romano, M. Application of different methods for the
diagnosis of paratuberculosis in a dairy cattle herd in
URL: http://www.blackwellpublishing.com/journal.asp?ref=0931-1793&site=1
NAL
Call No.:
41.8
Z52
Descriptors: cows, dairy cattle,
dairy cows, dairy herds, Mycobacterium
avium subsp. paratuberculosis,
various strains, interferon, diagnosis, diagnostic techniques, ELISA,
immunodiffusion, PCR, methodology, paratuberculosis,
Patel, D.; Goddik, L.; Bermudez, L.
Invasion of Mycobacterium avium subsp paratuberculosis in bovine epithelial
cells and bovine mammary epithelial cells.
Journal of Dairy Science.
2003; 86(Suppl. 1): 8. ISSN: 0022-0302. Note: Joint Annual Meeting of the American
Dairy Science Association, the American Society of Animal Science and the
Mexican Association of Animal Production,
URL:
http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: Mycobacterium avium subsp. paratuberculosis, bovine epithelial
cells, bovine mammary epithelial cells, cell invasion by bacterial
pathogen.
Payne, T.E.; Guillou, L. III; Awong Taylor, J. A
comparison of methods for detection of Mycobacterium paratuberculosis in bovine
milk by IS900 PCR. Abstracts of the General Meeting of the
American Society for Microbiology. 2003; 103: U-026. ISSN: 1060-2011. Note: 103rd American Society for Microbiology
General Meeting,
Descriptors: bovine milk, method for
detection, IS900PCR, Mycobacterium
avium subsp. paratuberculosis, an
isolation and concentration method utilizing Cetyltrimethylammonium Bromide
(CTAB), pasteurized and unpasteurized milk.
Pence, M.; Baldwin, C.; Black, C.C., III. The seroprevalence of Johne's disease in
NAL Call No.:
SF774.J68
Descriptors: beef cattle, dairy
cattle, culled animals, sale barns sales, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, epidemiology, 5307
sera of 200,000 were tested, ELISA test kit, levels of Johne’s disease culled
animals was economically significant, Georgia, United
States.
Pilipcinec, E.; Svicky, E.; Pistl, J.; Dorko, E.; Bugarsky, A.
Ochorenia lymfatickeho systemu vyvolane primarne bakteriami a plesnami.
[Diseases of the lymph system caused primarily by the bacteria and moulds.]
Slovensky Veterinarsky Casopis. 2003; 28(3): 34-39. ISSN: 1335-0099. Note: In Czech with an English summary.
Descriptors: pigs, cats, horses,
sheep, goats, other domestic animals, pathogens of the lymph system, zoonotic
diseases, Corynebacterium
pseudotuberculosis, Streptococcus
equi subsp. equi, Rhodococcus equi, Streptococcus porcinus, Streptococcus canis, Histoplasma capsulatum subsp. farciminosum, Sporothrix schenckii, Streptococcus equi subsp. zooepidemicus, Yersinia pseudotuberculosis, Y. enterocolitica, Burkholderia mallei, B. pseudomallei, Mycobacterium avium subsp. paratuberculosis, Mycobacterium spp., Actinomyces spp., Nocardia spp., Aspergillus spp., Staphylococcus aureus, Actinobacillus equuli, Actinobacillus suis, Arcanobacterium pyogenes.
Pislak, M.; Ocepek, M.; Piano, J.Z.; Pogacnik, M. Comparison of four methods for isolation of
Mycobacterium avium subsp. paratuberculosis DNA from tissue
samples. Slovenian Veterinary Research. 2003; 40(2): 91-97. ISSN: 1581-6915. Note: In English with a summary in Slovenian.
Descriptors: 11 positive small
ruminants, sheep, Mycobacterium avium
subsp. paratuberculosis, 30
intestinal and lymph node samples, 4 methods of DNA extraction: (1) High Pure
PCR Template Preparation Kit, Roche, Mannheim commercial kit; (2) treatment of
samples with HPC (hexadecylpyridinium chloride) and isolation and kit; (3)
Gwozdz’s method of digestion with proteinase K adding NaCl and
cetyltrimethylammonium bromide (CTAB); (4) treatment with HPC and isolation with
the method described by Gwozdz, method 2 was most
efficient.
Pons, L. Sequencing the bad guys.
Agricultural Research. 2003; 51(4): 19. ISSN:
0002-161X.
URL: http://www.ars.usda.gov/is/AR/archive/apr03/bact0403.htm
NAL Call No.: 1.98 AG84
Descriptors: cattle diseases,
sequence analysis, nucleotide sequences, Mycobacterium avium subsp. paratuberculosis, Brucella melitensis biovar abortus, Leptospira interrogans serovar hardjo.
Radunz, B. Johne's disease. Agdex no: 420/653.
Agnote Northern Territory of
Descriptors: buffalo, camelids,
cattle, deer, goats, Mycobacterium avium
subsp. paratuberculosis, Johne’s
disease, symptoms, spread, detection, incidence, disease transmission,
mortality, epidemiology, Northern Territory, Australia.
Rajkhowa, S.; Rajkhowa, C.; Bujarbaruah, K.M. Diseases of mithun (Bos frontalis) - a review. Veterinary Bulletin. 2003; 73(4): 1R-6R. ISSN: 0042-4854.
Descriptors: mithun, Bos frontalis, animal diseases, foot and
mouth disease, catarrhal fever, rinderpest, bacterial diseases, Mycobacterium avium subsp. paratuberculosis, bronchopneumonia by Pseudomonas spp., black quarter, Clostridium chauvoei, anthrax and
brucellosis, nutritional edema, parasitoses, theileriasis, reviews.
Reddacliff,
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, tissue
homogenates, the terminal ileum (TI), ileocaecal valve (ICV), mesenteric lymph
nodes (MLN), Mycobacterium avium
subsp. paratuberculosis, samples
pooled for each sheep, freezing and thawing, experimental infection, tissue
culture, pooled as alternative to individual tissue
analysis.
Reddacliff,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.:
SF601.V44
Descriptors: Mycobacterium avium subsp. paratuberculosis, sheep strain, animal
tissues, clinical samples, spiking tissues and feces, decontamination, culture
techniques.
Reddacliff,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
NAL
Call No.: SF601.V44
Descriptors: recently weaned Merino
lambs, sheep, experimental infection, Mycobacterium avium subsp. paratuberculosis, Australian S strain,
oral doses similar to natural exposure, detection time, humoral immunity,
interferon, pathogenesis, tissue culture, skin testing, skin testing,
intradermal Johnin, whole blood IFN-gamma.
Reddacliff, Leslie A.; Nicholls, Paul J.; Vadali, Aparna; Whittington,
Richard J. Use of growth indices from radiometric
culture for quantification of sheep strains of Mycobacterium avium subsp. paratuberculosis. Applied and Environmental Microbiology.
2003; 69(6): 3510-3516. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83
NAL
Call No.: 448.3 AP5
Abstract: A simple method for using growth indices
from radiometric BACTEC cultures was evaluated for the enumeration of Australian
sheep strains of Mycobacterium avium
subsp. paratuberculosis. The numbers of viable organisms in
inocula were determined by end-point titration in BACTEC cultures. Growth indices were measured by using a
BACTEC 460 machine. There was a
linear relationship between the number of days taken for the cumulative growth
index to reach 1,000 (dCGI1000) and log10 inoculum size. The use of dCGI1000 was shown to be as
effective as the use of growth index data from the entire growth cycle for the
estimation of inoculum size. For
particular isolates characterized by end-point titration, the dCGI1000 of a
single BACTEC vial provided estimates of viable numbers within narrow prediction
limits. Predictive relationships
were also established for the enumeration of M. avium subsp. paratuberculosis from field samples by
using the dCGI1000 of a single BACTEC vial, with prediction limits of ½1 to 2
log units. Organisms from feces or
contaminated soil grew more slowly than those from cultures or tissues, and
separate equations were developed for enumeration from these sources.
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, bacterial strains,
growth indices, cell culture, culture media, animal pathogenic bacteria,
microbial growth, laboratory techniques, enumeration strains, paratuberculosis,
sheep diseases, radiometric BACTEC culture, diagnosis, diagnostic techniques.
Reid, S.W.J.; Menzies, F.D. Global context, generic tools: epidemiology
for disease control on an international stage. Preventive Veterinary Medicine. 2003; 60(1): 132. ISSN: 0167-5877. Note: An issue of 8 papers by a variety of
authors on a variety of topics.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: infectious disease
epidemiology, animal health, a variety of bacterial and viral diseases, risk
analysis, disease control and prevention, the Dutch Johne’s disease control
program.
Rodriguez Lazaro, D.; Lloyd, J.; Pla, M.; Ikonomopoulos,
Descriptors: Mycobacterium avium subsp. paratuberculosis, DNA analysis, sequence
based amplification of nucleic acids, enzyme uses.
Rosa, G.J.M.; Tempelman, R.J.; Suchyta, S.; Madsen, S.A.; Burton, J.L.;
Coussens, P.M. Normalization, replication, and
significance tests in cDNA microarray experiments.
Journal of Dairy Science. 2003; 86(Suppl. 1): 159. ISSN: 0022-0302. Note: Joint Annual Meeting of the American
Dairy Science Association, the American Society of Animal Science and the
Mexican Association of Animal Production,
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: cattle disease, Johne’s
disease, Mycobacterium avium subsp. paratuberculosis, cDNA, molecular
genetics.
Rossiter-Burhans,
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8
J822
Descriptors: Johne’s disease, disease
control program, disease prevention,
Saunders, V.F.; Eamens, G.J.; Turner, M.J.; Jessep, T.M. Identification of a new RFLP type of Mycobacterium avium subsp. paratuberculosis in epidemiological
tracing of bovine Johne's disease. Australian Veterinary Journal. 2003; 81(9): 564-566. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8
AU72
Descriptors: cattle, disease
prevalence, disease transmission, epidemiology, genes, RFLP,
Seuna, E.; Seppanen, J. National control strategies and ongoing
research in
NAL Call No.: 41.8
AC87
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, diagnosis, disease
surveys, paratuberculosis, national Johne’s disease control program,
Sergeant, E.S.G. Estimated flock-prevalence and
distribution of ovine Johne's disease in
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
distribution,
Sergeant, E.S.G.; Marshall, D.J.; Eamens, G.J.;
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis, body condition,
Johne’s disease detection, known infected and non-infected flocks, diagnosis,
diagnostic techniques, sensitivities and specificities, absorbed ELISA, agar gel
immunodiffusion tests, histological lesion score, paratuberculosis,
logistic-regression analysis on lesion and condition scores, New South Wales,
Australia.
Sheridan, Joe M.; Bull, Tim J.; Hermon-Taylor, John. Use of bioinformatics to predict a function
for the GS element in Mycobacterium
avium subspecies
paratuberculosis. Journal of Molecular Microbiology and
Biotechnology. 2003; 5(1):
57-66. ISSN: 1464-1801.
URL: http://www.jmmb.net/
NAL
Call No.:
QR74.J68
Descriptors: Mycobacterium avium subsp. paratuberculosis, homology of GS genes,
ser2 region, Mycobacterium avium
subsp. avium, bioinformatics,
Johne’s disease, cell wall GPL, possible drug target, Crohn's disease,
paratuberculosis.
Shin, S.J.; Chang, Y.F.; Yoo, H.S.
Immunological comparison of major
proteins in Mycobacterium avium spp.
paratuberculosis. FEMS Congress of European Microbiologists
Abstract Book. 2003; (1):
55-56. Note: 1st Federation of European
Microbiological Societies (FEMS) Congress of European Microbiologists,
Descriptors: Mycobacterium avium subsp. paratuberculosis, proteins, immunology,
comparative immune response.
Shulaw, W.P.; Larew-Naugle, A. Paratuberculosis: a food safety
concern? In:
NAL Call
No.:
QR115.M4564
2003
Descriptors: Mycobacterium avium subsp. paratuberculosis, etiology, zoonotic
concerns, food borne disease, Crohn’s disease, food contamination, food safety.
Singh, D.K. Prevention and control of infectious
diseases of buffaloes. Intas Polivet. 2003; 4(2): 292-298. ISSN: 0972-1738.
Descriptors: buffalo, infectious
diseases, animal pathogens, bacteria, viruses, parasites, disease prevention and
control, anthrax, Brucella, foot and
mouth disease; hemorrhagic septicemias, rabies, rhinotracheitis, rinderpest,
trypanosoma, tuberculosis, paratuberculosis, bovine diarrhea virus, bovine
ephemeral fever virus, buffalo poxvirus, Campylobacter fetus, Clostridium chauvoei, Mycobacterium avium subsp. paratuberculosis, Mycobacterium tuberculosis, Pasteurella multocida, rabies virus,
rinderpest virus.
Singh, S.V.; Vihan, V.S. Incidence of Mycobacterium avium sub sp. paratuberculosis in clinicaly suspected
small ruminants. Indian Journal of Small Ruminants. 2003; 9(1): 56-59. ISSN: 0971-9857.
Descriptors: goats, sheep, incidence
of disease, Mycobacterium avium
subsp. paratuberculosis,
microscopic examination, 1038 clinically suspected animals,
Sivakumar, P., Tripathi, B.N., Nem Singh. Comparison of different methods of DNA
extraction from Mycobacterium avium
subsp. paratuberculosis infected
tissues of buffaloes. Indian Journal of Comparative Microbiology,
Immunology and Infectious Diseases. 2003; 24(1): 43-47. ISSN: 0970-9320.
Descriptors: buffalo, infected with
Mycobacterium avium subsp. paratuberculosis, different methods of
DNA extraction of bacterial pellets, mucosal homogenate of infected intestines,
extraction methods, freezing thawing and freezing boiling, centrifugation,
diagnosis, diagnostic techniques, PCR DNA amplification.
Smith, W.L.; McGarvey, K.L.; Cullor, J.S. The use of spiral plating and microscopic
colony counting for the rapid quantitation of Mycobacterium paratuberculosis. Letters in Applied Microbiology. 2003; 36(5): 293-296. ISSN: 0266-8254.
URL: http://www.blackwell-synergy.com/links/doi/10.1046/j.1472-765X.2003.01311.x/abs/
NAL Call No.:
QR1.L47
Descriptors: Mycobacterium avium subsp. paratuberculosis, quantitation by spiral
plating and microscopic colony counting, broth and milk cultures, varying
incubation periods, Middlebrook agar plates counted 8-14 days and 27-28
days.
Sorensen, O.; Rawluk, S.; Wu, J.; Manninen, K.; Ollis, G. Mycobacterium paratuberculosis in dairy
herds in
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: 50 dairy herds, herd
level prevalence, Mycobacterium avium
subsp. paratuberculosis, pooled
fecal culture, ELISA of serum,
Sreedevi, B.; Krishnappa, G. Detection of Mycobacterium tuberculosis complex
organisms in clinical samples of cattle by PCR and DNA probe methods. Indian Journal of Comparative Microbiology,
Immunology and Infectious Diseases. 2003; 24(2): 167-171. ISSN: 0970-9320.
Descriptors: cattle, diagnosis,
diagnostic techniques, DNA probes, polymerase chain reaction, tuberculin,
tuberculosis, IS6110 element, Mycobacterium tubuculosis complex,
differential subspecies separation, Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium bovis BCG strain, Mycobacterium phlei, Mycobacterium tuberculosis, Karnataka,
India.
Srivastava, Bejai Inder Sahai; Srivastava, Maya Devi. A novel, more rapid method for the
detection and discrimination of Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis. FASEB Journal. 2003; 17(4-5): Abstract no. 408.5. ISSN: 0892-6638. Note: FASEB Meeting on Experimental Biology:
Translating the Genome,
URL: http://www.fasebj.org/
NAL Call No.:
QH301.F3
Descriptors: detection and
discrimination between Mycobacterium
avium subsp. avium and Mycobacterium avium subsp. paratuberculosis, methods, CaCo2 cell
line, SRIK-NKL cell line, bacterial growth differences.
Stabel, J.R.; Goff, J.P.; Kimura, K. Effects of supplemental energy on metabolic
and immune measurements in periparturient dairy cows with Johne's diseases.
Journal of Dairy Science. 2003; 86(11):
3527-3535. ISSN:
0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8 J822
Abstract: The present study was designed to
evaluate whether feeding supplemental energy would improve the metabolic profile
and alleviate some of the immunosuppression typically noted during the
periparturient period in dairy cows with Johne's disease. Twelve dairy cows naturally infected with
Mycobacterium paratuberculosis were
fitted with rumen cannulas in late gestation and assigned to treatment groups:
control, n = 6; or stuffed, n = 6. Cows in the control group were allowed to
consume feed ad libitum. Cows
assigned to the stuffed treatment group were also fed ad libitum but received
additional total mixed rations by manually stuffing their rumens with refused
feed to maintain dry matter intake of 2% body weight per day before calving and
2.5% body weight per day after calving. Serum nonesterified fatty acid levels
were significantly decreased in stuffed cows compared with control cows,
indicating that stuffing to maintain dry matter intake improved the energy
balance in the cows. In addition,
periparturient serum calcium and magnesium concentrations were significantly
higher in stuffed cows. Stuffing
modulated cell-mediated immunity by reducing lymphocyte proliferative responses
to T-cell mitogens during early lactation. Stuffing resulted in an increase in the
secretion of in vitro immunoglobulin by peripheral blood mononuclear cells after
parturition when compared to control cows. These data demonstrate that energy
balance is improved by providing additional energy in this manner and suggest
energy supplementation can improve some aspects of immune function during the
periparturient period.
Descriptors: dairy cows, perinatal
period, cow feeding, rumen cannulas, voluntary intake, overfeeding, energy
balance, paratuberculosis, cattle bacterial diseases, Mycobacterium avium subsp. paratuberculosis, blood serum, calcium,
magnesium, phosphorus, lymphocyte proliferation, blood lipids, free fatty acids,
blood glucose, calcitriol, cell mediated immunity, humoral immunity.
Stabel, J.R.; Palmer, M.V.; Whitlock, R.H. Immune responses after oral inoculation of
weanling bison or beef calves with a bison or cattle isolate of Mycobacterium avium subsp. paratuberculosis. Journal of Wildlife Diseases. 2003; 39(3): 545-555. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.:
41.9
W64B
Descriptors: young animals, domestic
and wild ruminants, cattle, bison calves, beef calves, host immune responses,
pathologic changes, pathogenesis, physiopathology, experimental infection with
Mycobacterium avium subsp. paratuberculosis that are both cattle or
bison strains, oral dosing, cattle
isolate, bison strain, blood sampling, fecal sampling, tissues samples at
necropsy, disease resistance, demonstrated species differences to pathogen
challenge, lesions, jejunum, distal ileum, IFN gamma, species response
differences.
Sternberg, S.; Viske, D. Control strategies for paratuberculosis in
NAL Call No.: 41.8
AC87
Descriptors: cattle, control program
for Johne’s, Mycobacterium avium
subsp. paratuberculosis,
diagnosis, diagnostic techniques,
Storset, A.K. Immunology of Mycobacterium avium subsp. paratuberculosis infection -
immunodiagnostic methods. Acta Veterinaria Scandinavica. 2003; 44(3/4): 223-229. ISSN: 0044-605X.
NAL Call
No.: 41.8
AC87
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, immune response,
immunity, interferon, immunodiagnosis, immunodiffusion tests, immunology,
diagnostic techniques, ELISA, skin tests.
Stott, A.W.; Jones, G.J.; Humphry, R.W.; Gunn, G.J.
An economic evaluation of Johne's disease (paratuberculosis) in the dairy
herd using dynamic programming. Acta Veterinaria Scandinavica
Supplementum. 2003; (supp. 98):
262. ISSN: 0065-1699. Note: J.F. Agger and N. Toft edited the
special issue.
NAL Call No.: 41.8 AC87
suppl
Descriptors: dairy cattle, dairy
herds, economic impact of Johne’s disease, Mycobacterium avium subsp. paratuberculosis, culling sick animals,
milk prices, dynamic programming, Great Britain.
Sung, N.; Collins, M.T. Variation in resistance of Mycobacterium paratuberculosis to acid
environments as a function of culture medium. Applied and Environmental Microbiology.
2003; 69(11): 6833-6840. ISSN: 0099-2240.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=83%20
NAL Call No.: 448.3
AP5
Descriptors: Mycobacterium avium subsp. paratuberculosis, in vitro culture
conditions, acid resistance, fatty acid medium, glycerol containing medium, both
at pH 6.0, 6.8., reistant to acetate buffer at pH 3,4,5 6 at 20 degrees C, BACTE
used to identify viable cells, measured soluable proteins, death, growth rate,
morphology, comparison study, culture conditions are very
important.
Tharaldsen, J.; Djonne, B.; Fredriksen, B.; Nyberg, O.; Sigurdardottir, O.
The national paratuberculosis program in
NAL Call
No.: 41.8
AC87
Descriptors: cattle, goats, llamas,
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis, disease
seroprevalence, disease surveys, epidemiology, immunodiagnosis, national control
program,
Tiwari, A.; VanLeeuwen, J.A.; Dohoo, I.R.; Stryhn, H.; Keefe, G.P.
Effect of seropositivity for bovine leukaemia virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum on the calving to
conception interval in maritime Canadian dairy cattle.
Proceedings of a Meeting -
Society for Veterinary Epidemiology and Preventive Medicine. [
NAL Call
No.: SF780.9.S63
Descriptors: dairy cattle, bovine
leukemia virus, Mycobacterium avium
subsp. paratuberculosis, Neospora
caninum, seroprevalence, reproductive efficiency,
Toman, M.; Faldyna, M.; Pavlik,
URL: http://vetmed.vri.cz/
NAL
Call No.:
41.9
C333
Descriptors: cattle infected with
Johne’s disease, disease progression, clinical aspects, Mycobacterium avium subsp. paratuberculosis, antibodies,
leukocytes, lymphocytes, monocytes, neutrophils, CD4+ lymphocytes, CD8+
lymphocytes, cell mediated immunity, interferon.
Tortoli, Enrico. Impact of genotypic studies on
mycobacterial taxonomy: The new mycobacteria of the 1990s. Clinical Microbiology Reviews. 2003; 16(2): 319-354. ISSN: 0893-8512.
URL:
http://www.pubmedcentral.gov/articlerender.fcgi?artid=153142
NAL
Call No.:
QR67.C54
Descriptors: Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
subsp. avium, Mycobacterium avium
subsp. caprae, Mycobacterium avium subsp. hominissuis, Mycobacterium avium subsp.
silvaticum, non-pigmented, pigmented,
rapid growers, slow growers, taxonomy.
Uhart, Marcela M.;
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: pampas deer, free
ranging, hematology, serum chemistries, minerals, metals, fecal parasites,
seasonal evaluation of fecal ova and parasites, animal diseases, bluetongue,
brucellosis, bovine respiratory syncytial virus infection, bovine viral
diarrhea/mucosal disease, infectious bovine rhinotracheitis, Johne's disease
(paratuberculosis), foot and mouth disease (FMD), leptospirosis (eight
serovars), epizootic hemorrhagic disease, and parainfluenza-3 (PI-3), negative
for paratuberculosis, Campos del Tuyu Wildlife Reserve, Buenos Aires,
Argentina.
Underwood, S.C.; Decaminada, E.C.; Grimoldi, F.; Moras, E.V.; Carfagnini,
J.C. Estudio de la prevalencia de brucelosis,
tuberculosis y paratuberculosis en cabras lecheras y carniceras pertenecientes a
minifundistas de
Descriptors: dairy and meat goats, 31
farms with10 animals/farm, prevalence of brucellosis, Brucella melitensis, BPA test,
tuberculosis, Mycobacterium bovis,
Johne’s disease, cervical comparative test for Mycobacterium avium subsp. paratuberculosis, percentages of disease
incidence, Argentina.
Uzonna, J.E.; Chilton, P.; Whitlock, R.H.; Habecker, P.L.; Scott, P.;
Sweeney, R.W. Efficacy of commercial and field-strain Mycobacterium paratuberculosis
vaccinations with recombinant IL-12 in a bovine experimental infection model.
Vaccine. 2003; 21(23): 3101-3109. ISSN: 0264-410X.
NAL
Call No.:
QR189.V32
Descriptors: calves, vaccine testing
model, Mycobacterium avium subsp. paratuberculosis, commercial Strain 18
and field isolate, vaccine response, strong local systemic and enteric IFN-gamma
responses, field isolate showed reduced bacterial colony formation, field
isolate vaccine recommended over Strain 18.
Van Schaik, G.; Rossiter, C.R.; Stehman, S.M.; Shin, S.J.; Schukken,
Y.H. Longitudinal study to investigate variation
in results of repeated ELISA and culture of fecal samples for Mycobacterium avium subsp paratuberculosis in commercial dairy
herds. American Journal of Veterinary Research.
2003; 64(4): 479-484. ISSN:
0002-9645.
URL: http://avmajournals.avma.org/toc/ajvr/64/4
NAL
Call No.: 41.8 AM3A
Descriptors: Mycobacterium avium subsp. paratuberculosis, dairy herd, Johne’s
disease, fecal samples, fecal cultures, ELISA, consistency of results,
diagnostic method comparison, repeated tests of 112 cows on 6 commercial dairy
farms, New York, United States.
Van Schaik, G.; Stehman, S.M.; Schukken, Y.H.; Rossiter, C.R.; Shin, S.J.
Pooled fecal culture sampling for Mycobacterium avium subsp. paratuberculosis at different herd sizes
and prevalence. Journal of Veterinary Diagnostic
Investigation. 2003; 15(3):
233-241. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: dairy cows, dairy herds,
whole herd testing, Johne’s disease, stochastic spreadsheet model, disease
prevalence of Mycobacterium avium
subsp. paratuberculosis,
detection, diagnosis, disease distribution, epidemiology, pooled fecal sampling,
fecal testing of individuals from farms with pooled positives, paratuberculosis,
allocation of disease status as 1) not shedding, 2) low shedder, 3) moderate
shedder, 4) heavy shedder, efficiency depends on ratio of positives to herd size
of pooled samples, New York State, United States.
Van Schaik, G.; Schukken, Y.H.; Crainiceanu, C.; Muskens, J.; Van Leeuwen,
J.A. Prevalence estimates for paratuberculosis
adjusted for test variability using Bayesian analysis. Preventive Veterinary Medicine. 2003; 60(4): 281-295. ISSN: 0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: cattle herd testing, Mycobacterium avium subsp. paratuberculosis, ELISA testing,
diagnostic techniques, disease prevalence, mathematical models, Bayesian theory,
testing sensitivity and specificity, estimating true disease prevalence of
Johne’s disease, epidemiology.
Veerabramhaiah, K.; Kumar, K.S.; Rao, S.T.V.; Naidu, P.T. Clinico-pathological aspects of an unusual
paratuberculosis in a crossbred cow. Intas Polivet. 2003; 4(1): 32-33. ISSN: 0972-1738.
Descriptors: crossbred cow, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
unusual case, clinical aspects, mortality, post mortem examination, animal
pathology, case reports, Andhra Pradesh, India.
Wapenaar, W.; Van Schaik, G.; Leids, P.; Denney, L.; Schukken, Y.H.; Stehman,
S.M.; Huntley, J. NYSCHAP Johne's disease module, a program
to change management of dairy farms to reduce Johne's disease prevalence. Bovine Practitioner. 2003; 37(1): 23-29. ISSN: 0524-1685. Note: In English with a French summary.
NAL Call No.:
SF779.5.A1B6
Descriptors: dairy cows, dairy farms,
New York State Cattle Health Assurance Program, Johne’s disease control,
epidemiology, Johne’s Disease Module, success of training, adoption of
management practices, milk production, disease prevalence, epidemiology,
reviews, New York State, United States.
Wapenaar, W.; Leids, P.; Denney, L.; Van Schaik, G.; Stehman, S.; Schukken,
Y.H.; Huntley, J. A program to change management of dairy
farms to reduce Johne's disease prevalence. Acta Veterinaria Scandinavica,
Supplementum. 2003; (Suppl.
98): 240. ISSN: 0065-1699. Note: J.F. Agger and N. Toft edited the
special issue.
NAL Call No.: 41.8 AC87
Suppl.
Descriptors: dairy cattle, dairy
farms, Mycobacterium avium subsp. paratuberculosis, disease control
programs, disease prevalence, epidemiology farm management, biosecurity,
Waters, W.R.; Miller, J.M.; Palmer, M.V.; Stabel, J.R.; Jones, D.E.;
Koistinen, K.A.; Steadham, E.M.; Hamilton, M.J.; Davis, W.C.; Bannantine, J.P.
Early induction of humoral and cellular immune responses during
experimental Mycobacterium avium
subsp. paratuberculosis infection of
calves. Infection and Immunity. 2003; 71(9): 5130-5138. ISSN: 0019-9567.
URL: http://www.jarvm.com/
NAL
Call No.:
QR1.I57
Descriptors: cattle, young animals,
calves, experimental infections, Mycobacterium avium subsp. paratuberculosis, early immune
response, antibodies CD4+
lymphocytes, interferon, nitric oxide, paratuberculosis, Johne’s disease.
Wells, S.J.; Godden, S.M.; Lindeman, C.J.; Collins, J.E. Evaluation of bacteriologic culture of
individual and pooled fecal samples for detection of Mycobacterium paratuberculosis in dairy
cattle herds. Journal of the American Veterinary Medical
Association. 2003; 223(7):
1022-1025. ISSN: 0003-1488.
URL: http://avmajournals.avma.org/toc/javma/223/7
NAL
Call No.:
41.8
AM3
Descriptors: 24 dairy cattle herds,
detecting Mycobacterium avium subsp. paratuberculosis, individual and
pooled fecal samples, in vitro culture methods, using pooled sampling and
testing is cost effective, disease prevalence, Minnesota, United States.
Whittington, R. The
Future of OJD Control in
Descriptors: sheep, ovine Johne's
disease (OJD), National OJD Control and Evaluation Programme (NOJDP), aims,
delivery, policies to control spread, surveys, program structure,
Whittington, R.J.; Marsh, I.B.;
URL:
http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: sheep, goats, disease
prevalence, Mycobacterium avium
subsp. paratuberculosis, isolation
from the environment, soil, feces, water, sediment, microbial contamination of
the environment, effect of removing pathogen carrying animals, paratuberculosis,
radiometric culture in environmental samples, reduction of pathogens after
animal removal.
Whittington, R.J.; Eamens, G.J.; Cousins, D.V. Specificity of absorbed ELISA and agar gel
immunodiffusion tests for paratuberculosis in goats with observations about use
of these tests in infected goats. Australian Veterinary Journal. 2003; 81(1-2): 71-75. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.: 41.8 AU72
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, various isolates of
bovine, or caprine origin, specificity of serological tests, laboratory
experiments, 4 diagnostic test studied, AGID, ELISA< CSL PARACHEK, Johne’s
absorbed ELISA, comparison study, antigen testing, diagnostic value,
immunodiagnosis, immunodiffusion tests, paratuberculosis, quality
controls.
Yousof-Beygi, G.; Ramin, A.G.; Faraji-Vand, A.R. Study on the prevalence of subclinical
cattle Johne's disease in the Urmia abattoir. Archives of Razi Institute. 2003; (55): 63-69. ISSN:
0365-3439.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, prevalence of
subclinical Johne’s, post slaughter tissue collection, 97 male and 196 female
cattle, fecal sampling, epithelial tissue from between ileum and caecum,
seasonal differences, no differences between different ages and sexes,
Iran.
Zhu, Wenming; Plikaytis, Bonnie B.; Shinnick, Thomas M.
Resuscitation factors from mycobacteria: Homologs of Micrococcus luteus
proteins. Tuberculosis. 2003; 83(4): 261-269. ISSN: 1472-9792.
URL: http://www.sciencedirect.com/science?_ob=IssueURL&_tockey=%23TOC%237161%232003%23999169995%23442814%23FLA%23&_auth=y&view=c&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=a50f3e526fd7006af102643d661aaa81
Descriptors: cloning and
characterizing resuscitation promoting factors, Mycobacterium avium subsp. paratuberculosis, Mycobacterium
tuberculosis, recovery from late stationary culture.
Adaska, J.M.;
NAL Call
No.:
SF774.J68
Descriptors: cattle, dairy cows,
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis, serum
sampling, 201 individual animals, antibody testing, diagnosis, diagnostic
techniques, immunodiagnosis, ELISA kit, test kit variability, optical density
variation, inconsistency of results complicates management
decisions.
Amadori, M.; Lyashchenko, K.P.; Gennaro, M.L.; Pollock, J.M.; Zerbini,
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5190&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=7e99acb030d8f79b52d4e03a1c31a5f8
Descriptors: cattle, calves, Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, ELISA, analytical
diagnostic methods, diagnostic test reliability and sensitivity, antibody
testing, antigens, immune response, interferon, paratuberculosis, recombinant
proteins, tuberculosis, zoonoses.
Australia
Descriptors: sheep flocks,
strategies, management, options to reduce impact of Johne’s, Mycobacterium avium subsp. paratuberculosis, disease control and
prevention, immunization with vaccination,
Baba, A.I.; Catoi, C.; Denes, C. Histopathological aspects of avian
tuberculosis. Buletinul Universitatii de Stiinte Agricole
si Medicina Veterinara Cluj Napoca, Seria Medicina Veterinara. 2002; 58: 583-586. ISSN: 1454-2382. Note: In English with a Rumanian summary.
Descriptors: 14,000 birds necropsied,
hens, pigeons, turkeys, disease survey, Mycobacterium avium, Mycobacterium avium
subsp. paratuberculosis, many tissues
sampled, amyloid in liver and spleen,
Bakker, D. Keynote: Johne's disease in the
Netherlands. Research in Veterinary Science. April 2002; 72(Suppl.
A): 28-29. ISSN: 0034-5288. Note: 56th Annual Conference of the Association of
Veterinary Teachers and Research Workers on Current Topics in Veterinary
Science, Scarborough, England, UK, March 25-27,
2002.
NAL Call No.: 41.8
R312
Descriptors:
epidemiology, Mycobacterium avium
subsp. paratuberculosis, cattle, The Netherlands, Johne’s
disease.
Ball, R.L.;
Descriptors:
captive zoo animal, nyala, Tragelaphus angassi, forage diet,
calcium metabolism changes, excretion, phosphorus, potassium, sodium, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis.
Ballarini, G.; Martelli, P. Paratubercolosi bovina: importanza della
profilassi nel vitello. [Bovine
paratuberculosis: importance of prevention in calves.] Obiettivi e Documenti Veterinari. 2002;
23(2): 5-8. ISSN: 0392-1913. Note: In Italian.
Descriptors: calves, Mycobacterium avium subsp. paratuberculosis, importance of disease
prevention, reviews.
Bannantine, J.P.; Baechler, E.; Zhang, Q.; Li, L.L.; Kapur, V. Genome scale comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium reveals potential diagnostic
sequences. Journal of Clinical Microbiology. 2002; 40(4): 1303-1310. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=140397
Descriptors: Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, Mycobacterium avium
subsp. avium, genes, genetic
comparisons, genome analysis, nucleotide sequences, codons, diagnosis,
diagnostic techniques, analytical methods.
Bannantine, John P.; Stabel, Judith R. Killing of Mycobacterium avium subspecies
paratuberculosis within macrophages. BMC Microbiology.
January 30, 2002; 2(2 Cited May 17, 2002): 1-7. ISSN: 1471-2180.
Article URL: http://www.biomedcentral.com/content/pdf/1471-2180-2-2.pdf
[cited July 16, 2002]
URL:
http://www.biomedcentral.com/1471-2180
Descriptors:
ruminant animal pathogen, cultured macrophages, interplay between bacterium and
host, replication time, immunogold labeling of infected macrophages with
antibodies, using transmission electron microscopy and viability
counts.
Blackburn, C. de W.; McClure,
P.J. [Editors] Foodborne Pathogens: Hazards, Risk Analysis
and Control. Woodhead
Publishing Ltd.,
NAL Call
No.: RA601.5.F659
2002
Descriptors: effective detection
measures, control measures and application to individual pathogens, HACCP
systems implementation, safe handling at every stage, Escherichia coli, Salmonella, Listeria monocytogenes, Campylobacter and Arcobacter, viruses, parasites, Mycobacterium avium subsp. paratuberculosis, many additional
organisms addressed.
Borody, T. J.; Leis, S.; Warren, E. F.; Surace, R. Treatment of severe Crohn's disease using
antimycobacterial triple therapy: Approaching a cure? Digestive and
Liver Disease. January 2002; 34(1): 29-38. ISSN: 1590-8658.
Descriptors: causal
role, Mycobacterium
avium subsp. paratuberculosis, Crohn’s disease, triple
macrolide-based anti-mycobacterial therapy, rifabutin (450 mg/d), clarithromycin
(750 mg/d) and clofazimine (2 mg/kg/d), anti microbial treatment.
Burton, L.; Voges, H. Control of Johne's
disease in dairy cattle. Proceedings of the New Zealand Society of
Animal Production. 2002; 62: 299-302. ISSN: 0370-2731.
NAL Call No.: 49.9 N483
Descriptors: dairy
cattle, Mycobacterium
avium subsp. paratuberculosis, Crohn’s disease,
contaminated milk products, infection level data, economic impacts, possible
control measures, vaccines, management practices, breeding for genetic
resistance, New Zealand.
Catton, B.A. Paucibacillary paratuberculosis in a
goat. Canadian Veterinary Journal. 2002; 43(10): 787-788. ISSN: 0008-5286. Note: In English with a French summary.
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, etiology, clinical
aspects, pathogenesis, case report.
Cerri, D.; Cantile, C.; Ebani, V. V.; Montagnese, M.; Voltini, B.; Arispici,
M. Diagnosis of paratuberculosis in naturally
infected goats. Microbiologica. April 2002; 25(2): 131-137. ISSN:
1121-7138.
NAL Call No.:
QR1
M57
Descriptors:
goats, immunohistochemical method, agar gel immunodiffusion (AGID), diagnosis,
Mycobacterium avium
subsp. paratuberculosis, pathology, isolated from various
organs, intestines, mesenteric lymph nodes,
macrophages.
Chi, Junwook; Van Leeuwen, John A.; Weersink, Alfons; Keefe, Gregory P. Direct production losses and treatment
costs from bovine viral diarrhoea virus, bovine leukosis virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum. Preventive Veterinary Medicine. 2002;
55(2): 137-153. ISSN:
0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: cattle, production
losses, production costs, animal diseases, milk losses, premature culling,
reduced slaughter, mortality, abortion and reproductive losses, veterinary
services, drug therapy, medication costs, extra farm labor, partial-budget
model, 50 cow herd, viral diarrhea virus, bovine leucosis virus, Neospora canium, Mycobacterium avium
subsp. paratuberculosis, milk
yield effects, Maritime provinces, New Brunswick, Nova Scotia, Prince Edward
Island, Canada.
Chi Junwook; Weersink, A.; Van Leeuwen, J.A.; Keefe, G.P. The economics of controlling infectious
diseases on dairy farms. Canadian Journal of Agricultural
Economics. 2002; 50(3):
237-256. ISSN: 0008-3976. Note: In English with a French summary.
NAL Call No.: 281.8
C16
Descriptors: livestock diseases,
empirical model, optimal set of control strategies, 4 cattle diseases, bovine
viral diarrhea (BVD), enzootic bovine leukosis (EBL), Johne's disease, neosporosis, direct production losses and
control expenditures for each disease, new animal screening, vaccination
protection.
Chi, Junwook; Van Leeuwen, J.A.; Weersink, A.; Keefe, G.P. Management factors related to
seroprevalences to bovine viral-diarrhoea virus, bovine-leukosis virus, Mycobacterium avium subspecies paratuberculosis, and Neospora caninum in dairy herds in the
Canadian Maritimes. Preventive Veterinary
Medicine.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: dairy cattle, on farm
productivity lowered by diseases, bovine diarrhea virus, bovine leukemia virus,
Mycobacterium avium subsp. paratuberculosis, Neospora caninum, epidemiology, disease
prevalence, risk assessment, animal husbandry, seroprevalence, disease control,
vaccination, hygiene, Prince Edward Island, Nova Scotia, New Brunswick, Canada.
Cliver, D.O. Infrequent microbial infections. In: Cliver, D.O.; Riemann, H.P. [Editors]
Foodborne Diseases. 2nd edition. Academic Press.
NAL Call
No.:
QR201.F62 F67
2002
Descriptors: food borne diseases
described, zoonotic diseases, historic agents, occasionally transmitted agents,
agents that can affect susceptible people, emerging foodborne pathogens, Escherichia coli O157:H7, Bacillus cereus, Mycobacterium avium subsp. paratuberculosis, Listeria monocytogenes, Giardia duodenalis, prions causing
variant Creutzfeldt-Jakob disease.
Cocito, Carlo; Coene, Marc; De Kesel, Myriam; Gilot, Philippe. Polypeptides from Mycrobacterium
paratuberculosis. Official Gazette of the United States Patent
and Trademark Office Patents. [e-file] May 14, 2002; 1258(2): No
Pagination. ISSN: 0098-1133.
NAL Call
No.:
T223.A21
Descriptors:
Johne’s disease, bacterial pathogen, 101 amino acids of FIG 8, Mycobacterium
bovis, Mycobacterium avium, Mycobacterium phlei, Mycobacterium
tuberculosis, and possibly against Mycobacterium leprae, Mycobacterium
intracellulare, Mycobacterium scrofulaceum, Mycobacterium fortuitum,
Mycobacterium gordonae and Mycobacterium smegmatis, Johne’s
positive cattle sera.
Collins, D.M.; de Zoete, M.; Cavaignac, S.M. Mycobacterium avium subsp. paratuberculosis strains from cattle
and sheep can be distinguished by a PCR test based on a novel DNA sequence
difference. Journal of Clinical Microbiology. 2002; 40(12): 4760-4762. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=154624
NAL
Call No.:
QR46.J6
Descriptors: Mycobacterium avium subsp. paratuberculosis, strain differences,
identifying sheep types and cattle types, DNA sequences,
PCR.
Collins, M.T. Interpretation of a commercial bovine
paratuberculosis enzyme-linked immunosorbent assay by using likelihood
ratios. Clinical and Diagnostic Laboratory
Immunology. 2002; 9(6):
1367-1371. ISSN: 1071-412X.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=130105
Descriptors: 143 infected diary
cattle, 2974 free of Johne’s disease, sera testing for Mycobacterium avium subsp. paratuberculosis, commercial ELISA,
diagnosis, disease control.
Corti, Sabrina; Stephan, Roger. Detection of
Mycobacterium avium
subsp. paratuberculosis specific IS900 insertion sequences in
bulk-tank milk samples obtained from different regions throughout Switzerland.
BMC Microbiology. June 26, 2002; 2(15 Cited August 6, 2002): No
Pagination. ISSN: 1471-2180.
URL:
http://www.biomedcentral.com/1471-2180
Descriptors:
possible relationship of Mycobacterium avium
subsp. paratuberculosis to Crohn’s disease etiology, possible
hazards of raw milk, bulk tank milk sampling, dairy stock subclinical
infections, Switzerland.
Coussens, P.M.; Colvin, C.J.; Wiersma, K.; Abouzied, A.; Sipkovsky, S. Gene expression profiling of peripheral
blood mononuclear cells from cattle infected with Mycobacterium paratuberculosis. Infection and Immunology. 2002; 70(10): 5494-5502. ISSN:
0019-9567.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=128350
NAL
Call No.:
QR1.I57
Abstract: A bovine-specific cDNA microarray system
containing 721 unique leukocyte expressed sequence tags (ESTs) and amplicons
representing known genes was used to compare gene expression profiles of
peripheral blood mononuclear cells (PBMCs) from clinical and subclinical Johne's
disease-positive Holstein cows (n = 2 per group). Stimulation of PBMCs from clinically
infected cows with Mycobacterium
paratuberculosis tended to decrease expression of 83 genes (fold change,
>1.5). Of these 83 genes, 16
displayed significant down regulation across both clinical cows (P < 0.1),
including genes encoding microspherule protein 1, fibroblast growth factor, and
the Lyn B protein kinase. Only
eight genes from PBMCs of clinically infected cows exhibited a modest up
regulation following stimulation with M.
paratuberculosis, including those encoding bovine CD40L, gamma interferon,
interleukin-10 (IL-10), and tissue inhibitor of matrix metalloproteinases (TIMP)
4. In contrast, stimulation of
PBMCs from subclinically infected cows with M. paratuberculosis tended to up
regulate expression of 71 genes representing 68 unique transcripts. Of these, 11 genes showed significant up
regulation (fold change, >1.5; P < 0.1) across both animals, including
those encoding bovine CD40L, several matrix metalloproteinases, and SPARC
(secreted protein, acidic and rich in cystine). Repression of gene expression was also
observed in PBMCs from the subclinical cows, with 16 genes being significantly
down regulated (fold change, >1.5; P < 0.1) across both animals, including
those encoding the bovine orthologs of cytochrome oxidase subunit III, IL-1
receptor type I, and fibrinogen-like 2 protein. Only one clone, representing an unknown
bovine EST, was similarly down regulated in PBMCs from both the clinical and
subclinical cows. Thus, the most
prominent change induced by exposure of PBMCs from clinical cows to M. paratuberculosis in vitro tended to
be repression of gene expression, while changes in similarly treated PBMCs from
subclinical cows was balanced between gene activation and repression. Comparison
of gene expression profiles between PBMCs from clinical and uninfected (control)
cows stimulated with the general mitogen concanavalin A were highly similar
(overall r = 0.84), suggesting that M.
paratuberculosis-induced gene repression in clinically infected cow PBMCs
was not due to a general failure of the immune response in these
animals.
Descriptors: messenger RNA.
leukocytes, leukocyte tags, gene expression profiles, peripheral blood
mononuclear cells, clinical and subclinical Johne’s disease, Holstein cows, in
vitro exposure, Mycobacterium
paratuberculosis, immune responses.
Cvetnic, Z.; Brlek, K.; Trstenjak, J.; Ocepek, M.; Spicic, S.; Mitak, M.;
Krt, B. Gospodarska vaznost paratuberkuloze u
uzgoju mlijecnih goveda. [Economic
importance of paratuberculosis in a breeding herd of dairy cows in
Descriptors: dairy cattle, reasons
for culling/slaughtering 1056 cows, 1995-2000, various conditions and diseases
found, 19.7% clinical Johne’s, Mycobacterium avium subsp. paratuberculosis,
Croatia.
Cvetnic, Z. Paratuberkuloza ovaca i koza u Republici
Hrvatskoj. [Paratuberculosis in
sheep and goats in the
Descriptors: sheep, goats, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
disease surveys, seroprevalence, 7058 sera samples, percentages of positives
given, complement fixation tests, immunoenzyme techniques, ELISA,
paratuberculosis, seroprevalence, Republic of Croatia.
Daniels, M.J.; Hutchings, M.R.; Allcroft, D.J.; Mckendrick I.J.; Greig A.
Risk factors for Johne's disease in
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8 V641
Descriptors: farm surveys mailed to 127 farms, risk factors for
Johne’s disease, Mycobacterium avium
subsp. paratuberculosis,
paratuberculosis, wildlife and farm management practices, large numbers of
livestock and rabbits, access of wildlife to feed stores clearest and most
consistent risks, application of manure to grazing pasture, type of water supply
for cattle, numbers of cows, cattle, cattle husbandry, disease prevalence,
disease control, feeds, manures, drinking water, Corvus, East Scotland.
Davies, P.R. Is Crohn's disease caused by
M. avium subsp. paratuberculosis? Proceedings of
the New Zealand Society of Animal Production. 2002; 62: 290-293. ISSN:
0370-2731.
NAL Call No.: 49.9
N483
Descriptors:
Johne’s disease, role of disease in Crohn’s disease, discussion of
possible zoonotic aspects of Mycobacterium avium
subsp. paratuberculosis.
de Lisle, G.W. Johne's disease in
NAL Call No.: 41.8
N483
Descriptors: ruminants, deer, sheep,
cattle, Johne’s disease, disease control, Mycobacterium avium subsp. paratuberculosis,
D'Haese, Eva; Nelis, Hans J. Rapid detection
of single cell bacteria as a novel approach in food microbiology.
Journal of AOAC International. July-August 2002; 85(4): 979-983. ISSN:
1060-3271.
NAL Call No.:
S583.A7
Descriptors: solid
phase cytometry, food sampling, slow growing bacteria detection, of Mycobacterium avium
subsp. paratuberculosis, model example of a slow-growing
bacterium in milk.
Douart, A.; Maillard, R. Eziologia ed epidemiologia della
paratubercolosi bovina. [Etiology
and epidemiology of bovine paratuberculosis.] Summa. 2002; 19(8): 37-42. Note: In Italian with an English summary.
Descriptors: cattle, Johne’s disease,
epidemiology, Mycobacterium avium
subsp. paratuberculosis,
etiology, fecal sampling, intestinal infection, disease transmission,
environment.
Douart, A.; Maillard, R. Le controle de la paratuberculose
bovine. [Monitoring of bovine
paratuberculosis.] Point Veterinaire. 2002; 33(222): 34-37. ISSN: 0335-4997. Note: In French with an English summary.
Descriptors: cattle, Johne’s disease,
diagnosis, disease control, feces, paratuberculosis, Mycobacterium avium subsp. paratuberculosis.
Drennan, M. Important factors in suckler beef
production and influence of calving season on income. Irish Grassland Association Journal.
2002; 36: 129-136. ISSN: 0322-0588.
Descriptors: beef cattle, beef
production, suckler herds, beef cattle health, beef quality, calving, calving
season, cost benefit analysis, economic analysis, profitability, profits,
Ireland.
Dumonceaux, G.A.;
NAL Call
No.:
SF605.N672
Descriptors: zoo animals, Johne’s
disease, Mycobacterium bovis,
Mycobacterium avium subsp. paratuberculosis.
Englund, Stina; Bolske, Goran; Johansson, Karl Erik. An IS900-like sequence found in a
Mycobacterium sp. other than Mycobacterium avium
subsp. paratuberculosis. FEMS Microbiology
Letters. April, 9 2002; 209(2): 267-271. ISSN:
0378-1097.
URL: http://www.elsevier.com/locate/femslett
NAL
Call No.: QR1.F44
Descriptors:
IS 900, specificity, dairy cows, Mycobacterium cookii, recommendations
of gene other than IS900 for detection.
Fang, Y.; Wu, W.H.; Pepper, J.L.; Larsen, J.L.; Marras, S.A.E.; Nelson, E.A.;
Epperson, W.B.; Christopher-Hennings, J. Comparison of real-time, quantitative PCR
with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal
samples. Journal of Clinical Microbiology. 2002; 40(1): 287-291. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=120117
NAL
Call No.:
QR46.J6
Descriptors: bovine fecal sampling,
detection methods for Mycobacterium avium
subsp. paratuberculosis,
automated PCR with fluorescent probes, sensitivity and specificity compared to
fecal cultures, minimum quantity of 1.7x10-4 pg of DNA, correlating to 1 to 8
CFU, was detected.
Ferreira, R.; Fonseca, L.S.; Lilenbaum, W. Agar gel immunodiffusion test (AGID) evaluation for
detection of bovine paratuberculosis in Rio de Janeiro, Brazil.
Letters in Applied Microbiology. 2002;
35(3):173-175. ISSN: 0266-8254.
NAL Call No.:
QR1.L47
Descriptors:
epidemiology, immune response, bacterial infection, Mycobacterium
paratuberculosis, diagnostic screening method, agarose gel immunodiffusion
test, cattle sera, Brazilian herds, subclinical herd
infections.
Ferreira, R.; Fonseca, L.; Lilenbaum, W. Comparison between a commercial and an
in-house ELISA for anti-Mycobacterium
avium paratuberculosis antibodies detection in dairy herds in
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, diagnosis,
diagnostic techniques comparison study, 179 sera samples, PPA ELISA
(protoplasmic paratuberculosis antigen and monoclonal anti-bive IgG conjugated
to alkaline phosphatase), HerdChek Mpt (IDEXX), the PPA ELISA useful for
collective herd test, Rio do Janeiro, Brazil.
Flebbe, U. 15 Jahre Paratuberkulosebekampfung.
Erfahrungen der Niedersachsischen Tierseuchenkasse. [15 years of paratuberculosis
eradication programs in
NAL Call No.: 41.8
D482
Descriptors: Mycobacterium avium subsp. paratuberculosis, disease eradication
and control programs, diagnostic techniques, program results, Lower Saxony,
Germany.
Forbes, P.; Kingham, L. Played for it, got it. Experiences of OJD
extension. Wool and Sheepmeat Services Program Annual
Conference, Tocal Agricultural Centre,
Descriptors: sheep, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, extension services to
farmers, mycobacterial diseases, strategies for control and prevention,
Fujita, Hiroshi; Eishi, Yoshinobu; Ishige, Ikuo; Saitoh, Kiyoshi; Takizawa,
Touichirou; Arima, Terukatsu; Koike, Morio.
Quantitative analysis of bacterial DNA from Mycobacteria spp.,
Bacteroides vulgatus, and Escherichia coli in tissue samples
from patients with inflammatory bowel diseases. Journal of
Gastroenterology. July 2002; 37(7): 509-516. ISSN: 0944-1174.
Descriptors: possible role of
Mycobacterium, bowel diseases in humans.
Gerlach, G.F. Paratuberkulose: Erreger und
Uebertragungswege.
[Paratuberculosis: The pathogen and routes of infection.] DTW (Deutsche Tieraerztliche Wochenschrift).
2002; 109(12): 504-506. ISSN: 0341-6593. Note: In German with an English summary.
NAL Call
No.: 41.8
D482
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, disease control
programs, disease prevalence, paratuberculosis, North Rhine Westphalia, Germany.
Glanemann, B.; Hoelzle, L.E.; Wittenbrink, M.M. Bakteriologische Untersuchungen zur
Paratuberkulose in Rinderbestaenden in der Schweiz. [Bacteriological investigations about
paratuberculosis in dairy herds in
NAL Call
No.: 41.8
D482
Descriptors: cattle, antibodies,
disease prevalence, paratuberculosis, Johne’s disease, fecal sampling, blood
sera, ELISA assay, Mycobacterium
avium subsp. paratuberculosis,
Mycobacterium hassiacum, Mycobacterium thermoresistibile, genes,
Gomes, M.J.P.; Driemeier, D.; Ribeiro, V.R.; Wunder Junior, E.A.; Asanome,
W.; Lanzon, L.F.; Wald, V.B. Doenca de
Johne: isolamento do Mycobacterium
avium subsp. paratuberculosis
(MAP) em um rebanho leiteiro infectado na Regiao sul do Brasil. [Johne's disease: isolation of Mycobacterium avium subsp. paratuberculosis (MAP) from an infected
dairy herd in
Descriptors: 8 Holstein cows, other
animals, disease prevalence of Mycobacterium avium subsp. paratuberculosis, epidemiology,
isolated and identified strains of MAP in bovine tissues, intestinal and lymph
node, animals with and without clinical signs, culture in HEYM, estimate
prevalence in infected herds using absorbed and non-absorbed ELISA, AGID assay,
disease levels warrant a control program, Rio Grande do Sul,
Brazil.
Grant, Irene R.; Hitchings, Edward I.; McCartney, Alan; Ferguson, Fiona;
Rowe, Michael T. Effect of commercial-scale
high-temperature, short-time pasteurization on the viability of
Mycobacterium paratuberculosis in naturally infected cows' milk.
Applied and Environmental Microbiology. February 2002; 68(2): 602-607.
ISSN: 0099-2240.
NAL Call No.: 448.3
Ap5
URL:
http://www.journals.asm.org
Descriptors: milk
contamination control, APV HXP commercial scale pasteurizer, 4 different
treatments, immunomagnetic separation PCR detection method, effects of
homogenization, levels of contamination.
Grant, I.R.; Ball, H.J.; Rowe, M.T. Effectiveness of milk pasteurization in relation to
Mycobacterium paratuberculosis. Research in Veterinary
Science. April 2002; 72(Suppl. A): 29. ISSN: 0034-5288. Note: 56th Annual
Conference of the Association of Veterinary Teachers and Research Workers on
Current Topics in Veterinary Science, Scarborough, England, UK, March 25-27,
2002.
NAL Call No.: 41.8
R312
Descriptors: epidemiology, Mycobacterium avium
subsp. paratuberculosis, contamination control, milk
pasteurization treatments, Crohn’s disease, Johne’s
disease.
Grant, Irene R.; Ball, Hywel J.; Rowe, Michael T. Incidence of Mycobacterium paratuberculosis
in bulk raw and commercially pasteurized cows' milk from approved dairy
processing establishments in the United Kingdom. Applied and
Environmental Microbiology. May 2002; 68(5): 2428-2435. ISSN: 0099-2240.
URL:
http://www.journals.asm.org
NAL
Call No.: 448.3
Ap5
Descriptors: milk sampling, Mycobacterium avium
subsp. paratuberculosis, immunomagnetic PCR, cell culture, low
levels of Mycobacterium
avium subsp. paratuberculosis, commercially pasteurized
cows' milk, United Kingdom.
Greig, A.; Beard, P.; Daniels, M. J.; Henderson, D.; Hutchings, M.R.;
Stevenson, K. The potential role of wildlife in
the epidemiology of paratuberculosis in domestic animals. Research in
Veterinary Science. April 2002; 72(Suppl. A): 30. ISSN: 0034-5288. Note:
56th Annual Conference of the Association of Veterinary Teachers and Research
Workers on Current Topics in Veterinary Science, Scarborough, England, UK, March
25-27, 2002.
NAL Call No.: 41.8
R312
Descriptors: epidemiology, Mycobacterium avium
subsp. paratuberculosis, wildlife as a disease reservoir, fox,
rabbit, stoat, weasel, dairy cattle industry, Johne’s disease, transmission,
United Kingdom.
Groenendaal, H.; Nielen, M.; Jalvingh, A.W.; Horst, S.H.; Galligan, D.T.;
Hesselink, J.W. A simulation of Johne's disease
control. Preventive Veterinary Medicine. 2002; 54(3): 225-245. ISSN:
0167-5877.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5145&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=c5bc3d9e1bb66468352ae1f5475d522f
NAL
Call No.:
SF601.P7
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, simulation models,
disease control, bacterial diseases, epidemiology, economic analysis,
infections, culling, calves, vaccination, milk yield, diagnosis, treatment, case
reports, disease prevalence.
Guo, Hongyan; Naser, Saleh A; Ghobrial, George; Phanstiel, Otto IV. Synthesis and biological evaluation of new
citrate-based siderophores as potential probes for the mechanism of iron uptake
in mycobacteria. Journal of Medicinal Chemistry. May 9, 2002;
45(10): 2056-2063. ISSN: 0022-2623.
NAL Call
No.: RS403.A1J6
URL:
http://pubs.acs.org/jmc
Descriptors:
bacterial pathogen, Mycobacterium avium
subsp. paratuberculosis, iron uptake, mycobactin J,
deferrioxamine B, acinetoferrin, nannochelin A, trans 2 octenoyl motif, trans
cinnamoyl groups, iron binding ligands (C5), growth index values, at 2.4 muM a
trans 2 octenoylated, citrate containing imide 6.
Gwozdz, J. M.; Thompson, K. G. Antigen-induced production of interferon-gamma in
samples of peripheral lymph nodes from sheep experimentally inoculated with
Mycobacterium avium
subsp. paratuberculosis. Veterinary Microbiology.
January 23, 2002; 84(3): 243-252. ISSN: 0378-1135.
NAL Call No.:
SF601.V44
Descriptors: sheep,
IFN-gamma, experimental oral inoculation, blood sampling, complement fixation
test (CFT), agar gel diffusion test (AGID), enzyme-linked immunosorbent assay
(ELISA), IFN-gamma test.
Halldorsdottir, Stefania; Englund, Stina; Nilsen, Sigrun Fredsvold; Olsaker,
Ingrid. Detection of Mycobacterium avium
subsp. paratuberculosis by buoyant density centrifugation,
sequence capture PCR and dot blot hybridisation. Veterinary
Microbiology. July 22, 2002; 87(4): 327-340. ISSN: 0378-1135.
URL:
http://www.elsevier.com/locate/vetmic
NAL
Call No.:
SF601.V44
Descriptors:
detection methods, bovine fecal samples, Percoll and IS900, alternative to
bacterial culture.
Hammer, P.; Kiesner, C.; Walte, H.G.; Knappstein, K.; Teufel, P.
Heat resistance of Mycobacterium
avium ssp. paratuberculosis in
raw milk tested in a pilot plant pasteurizer. Kieler Milchwirtschaftliche
Forschungsberichte. 2002;
54(4): 275-297. ISSN: 0023-1347. Note: In English with summaries in German and
French.
NAL Call
No.: 44.9
K542
Descriptors: raw milk, Mycobacterium avium subsp. paratuberculosis, pasteurization, time
and temperature combination experiments, pathogen survival, heat treatment, heat
resistance, macrophages, phagocytosis.
Hancox, M. Bovine tuberculosis: Milk and meat
safety. Lancet North American Edition. February 23, 2002;
359(9307): 706-707. ISSN: 0099-5355.
NAL
Call No.: 448.8
L22
Descriptors: bovine based food
product safety, human health risks, Mycobacterium avium
subsp. paratuberculosis, Campylobacter spp, bacterial
disease contamination.
Harris, N. B.; Zinniel, D. K.; Hsieh, M. K.; Cirillo, J. D.; Barletta, R. G.
Cell sorting of formalin-treated pathogenic
Mycobacterium paratuberculosis expressing GFP.
Biotechniques. March 2002; 32(3): 522-527. ISSN: 0736-6205.
NAL Call No.:
RB37.A1B56
Descriptors: Mycobacterium avium
subsp. paratuberculosis, occupational safety, laboratory
employees, pathogenic organisms, GFP fluorophore, safe handling without
biosafety level II and III equipment.
Hasvold, H.J.; Valheim, M.; Berntsen, G.; Storset, A.K. In vitro responses to purified protein
derivate of caprine T lymphocytes following vaccination with live strains of Mycobacterium avium subsp. paratuberculosis. Veterinary Immunology and
Immunopathology. 2002; 90(1-2):
79-89. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.:
SF757.2.V38
Descriptors: goats, goat kids, Mycobacterium avium subsp. paratuberculosis, Johne’s disease, live
vaccines, vaccine development, T lymphocytes, immune response, immunity,
immunology, interferon, interleukin-2.
Hermon, Taylor John; Bull, Tim. Crohn's
disease caused by Mycobacterium avium subspecies paratuberculosis: A public
health tragedy whose resolution is long overdue. Journal of Medical
Microbiology. January, 2002; 51 (1): 3-6. ISSN: 0022-2615
NAL
Call No.: QR1.J62
Descriptors: animal and human
pathogen, zoonotic aspects, human health risks, contaminated animal products.
Hermon, Taylor J.; Bull, T.; Boumedine, K.; McMinn, E.; Skull, A. Keynote: Mycobacterium avium
subsp. paratuberculosis in animals, food and water supplies, and
its impact on human health. Research in Veterinary Science. April
2002; 72(Suppl. A): 28. ISSN: 0034-5288. Note: 56th Annual Conference of the
Association of Veterinary Teachers and Research Workers on Current Topics in
Veterinary Science, Scarborough, England, UK, March 25-27, 2002.
NAL
Call No.: 41.8 R312
Descriptors: epidemiology,
Mycobacterium avium
subsp. paratuberculosis, cattle, humans, rabbits, sheep, human
health risks, Johne’s disease.
Hermon, Taylor J. Treatment with drugs active
against Mycobacterium
avium subsp. paratuberculosis can heal Crohn's disease:
More evidence for a neglected public health tragedy. Digestive and
Liver Disease. January 2002; 34(1): 9-12. ISSN: 1590-8658.
Descriptors: clinical immunology,
bacterial infection, Mycobacterium avium
subsp. paratuberculosis, pathogens, clarithromycin, clofazimine,
rifabutin, Crohn's disease, therapy.
Herva, T. Turvallinen kumppani - hanke selvittaa
elaintautien esiintymista. [Safe
company - plan for solving the disease situation.] Suomen Elainlaakarilehti. 2002; 108(9): 507-510. ISSN: 0039-5501. Note: In Finnish.
NAL Call No.: 41.8
F49
Descriptors: cattle, disease
prevention and control, diseases of concern, bovine diarrhea virus, Mycobacterium avium subsp. paratuberculosis, Trichophyton verrucosum,
Hirst, Heather L.; Garry, Franklyn B.; Salman, M.D. Assessment of test results when using a commercial
enzyme-linked immunosorbent assay for diagnosis of paratuberculosis in repeated
samples collected from adult dairy cattle. Journal of the American
Veterinary Medical Association. June 1, 2002; 220(11): 1685-1689. ISSN:
0003-1488.
URL:
http://www.avma.org
NAL
Call No.: 41.8
Am3
Descriptors: dairy cows, cattle,
ELISA, antibody detection, Mycobacterium avium
subsp. paratuberculosis, serum samples, 2 sampling times,
control measures.
Homuth, M. Diagnostik der
Paratuberkulose. [Diagnostics for
paratuberculosis.] DTW (Deutsche Tieraerztliche Wochenschrift).
2002; 109(12): 516-519. ISSN: 0341-6593.
NAL Call No.: 41.8 D482
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
diagnostic techniques, control programs, paratuberculosis, various diagnostic
approaches, advantages and disadvantages of methods, review article.
Hostetter, Jesse M.; Steadham, Edward M.; Haynes, Joseph S.; Bailey, Theodore
B.; Cheville, Norman F. Cytokine effects on maturation of the
phagosomes containing Mycobacteria
avium subspecies paratuberculosis
in J774 cells. FEMS Immunology and Medical
Microbiology. 2002; 34(2):
127-134. ISSN: 0928-8244.
Descriptors: Mycobacterium avium subsp. paratuberculosis, J774 cell lines,
cytokines, interferon, lipopolysaccharides, lysosomes, macrophage activation,
paratuberculosis.
Hutchings, M.R.; Daniels, M.J.; Henderson, D.; Greig, A. Wildlife to ruminant transmission routes for M. a.
paratuberculosis. Research in Veterinary Science. April 2002;
72(Suppl. A): 30. ISSN: 0034-5288. Note: 56th Annual Conference of the
Association of Veterinary Teachers and Research Workers on Current Topics in
Veterinary Science, Scarborough, England, UK, March 25-27,
2002.
NAL Call No.: 41.8
R312
Descriptors: epidemiology, Mycobacterium avium
subsp. paratuberculosis, wildlife as a disease reservoir,
cattle, rabbit, rodents, dairy cattle industry, Johne’s disease, transmission,
United Kingdom.
Jones, P.H.; Farver, T.B.; Beaman, B.L.; Cetinkaya, B.; Morgan, K. L. Chronic gastrointestinal diseases in dairy farmers
in England and the Welsh borders: Is there an association between Crohn's
disease and bovine paratuberculosis? Research in Veterinary
Science. April 2002; 72(Suppl. A): 30-31. ISSN: 0034-5288. Note: 56th Annual
Conference of the Association of Veterinary Teachers and Research Workers on
Current Topics in Veterinary Science, Scarborough, England, UK, March 25-27,
2002.
NAL Call No.: 41.8
R312
Descriptors: epidemiology,
potential for zoonotic disease, Mycobacterium avium
subsp. paratuberculosis, possible work related illness, dairy
cattle industry, dairy farmers, Johne’s disease, United Kingdom.
Jungersen, G.; Huda, A.; Hansen, J.J.; Lind, P. Interpretation of the gamma interferon test
for diagnosis of subclinical paratuberculosis in cattle. Clinical and Diagnostic Laboratory
Immunology. 2002; 9(2):
453-460. ISSN: 1071-412X.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?action=archive&journal=84
Descriptors: Kongeaa project, 252
cattle with no signs of Johne’s in 10 infected herds, 117 cattle in 5 herds no
Johne’s, whole blood stimulated with bovine, avian and johnin purified protein
derivative, checked for IFN gamma release, specificity data, false positives
noted, cross reactions, Denmark.
Kalis, C.H.J.; Barkema, H.W.; Hesselink, J.W.; van Maanen, C.; Collins, M.T.
Evaluation of two absorbed enzyme-linked
immunosorbent assays and a complement fixation test as replacements for fecal
culture in the detection of cows shedding Mycobacterium avium subspecies paratuberculosis. Journal of Veterinary Diagnostic
Investigation. 2002; 14(3):
219-224. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: dairy cattle, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis, prevention of
disease from cows to calves, disease control with management strategies, 2
different ELISAs and a complement fixation test compared, carrier state,
diagnosis, diagnostic techniques, diagnostic value, level of pathogen shedding.
Kavanagh, N. Milk borne zoonotic infections. Cattle Practice. 2002; 10(1): 15-18. ISSN: 0969-1251.
NAL Call No.:
SF961.C37
Descriptors: food borne illness, raw
milk, other milk products, salmonellosis, Salmonella typhimurium DT104, E. coli 0157, Campylobacter, Mycobacterium avium
subsp. paratuberculosis, Crohn’s
disease, bovine tuberculosis, United Kingdom, Republic of
Ireland.
Kim Doo; Jeon KwanJoon; Kim JongTaek; Shin KwangSoon; Shin MyungKyun; Chang
GukHyun; Kim JeungKi; Kim OchSung; Jung JaeYoung.
Prevalence of paratuberculosis of dairy cattle in Kangwon area. Korean Journal of Veterinary Research.
2002; 42(1): 81-88. ISSN: 1225-0198. Note: In Korean with an English
summary.
Descriptors: 2261 dairy cows, 162
herds, serotesting, ELISA, immunoblotting with recombinant 43 KDa protein of Mycobacterium avium subsp. paratuberculosis, fecal culture, HEYM
with mycobactin J, PCR, sensitivity and specificity for each method, Korean
Republic.
Kim, S.G.; Shin, S.J.; Jacobson, R.H.; Miller, L.J.; Harpending, P.R.;
Stehman, S.M.; Rossiter, C.A.; Lein, D.A. Development and application of quantitative
polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for
detection and quantification of Mycobacterium avium subsp. paratuberculosis. Journal of Veterinary Diagnostic
Investigation. 2002; 14(2):
126-131. ISSN: 1040-6387.
NAL Call No.:
SF774.J68
Descriptors: development and
application of diagnostic techniques, Johne’s disease, nucleotide sequences,
PCR, IS900 TaqMan, useful in
determining viable cell numbers over the incubation period, Mycobacterium strain differences, Mycobacterium avium subsp. paratuberculosis ATCC 19698, Mycobacterium fortuitum, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium terrae, Mycobacterium ulcerans, Mycobacterium asiaticum, Mycobacterium simiae, Mycobacterium abscessus, Mycobacterium avium subsp. avium, Mycobacterium bovis, Mycobacterium fortuitum subsp. fortuitum, Mycobacterium scrofulaceum, Mycobacterium ulcerans, 9
non-mycobacterial species, Borrelia
burgdorferi, Chlamydia psittaci,
Ehrlichia canis, Ehrlichia equi, Ehrlichis risticii, Escherichia coli, Escherichia coli O157:H7, Streptococcus equi, Streptococcus
zooepidemicus.
Klawonn, W.; Cussler, K.; Draeger, K. G.; Gyra, H.; Koehler, H.; Zimmer, K.;
Hess, R.G. Zur Bedeutung von allergischem Hauttest mit
Johnin, Antikoerper-ELISA, kultureller Kotuntersuchung sowie der Impfung fuer
die Sanierung dreier chronisch Paratuberkulose-infizierter Milchviehherden in
Rheinland-Pfalz. [Evaluation of
intradermal test with Johnin, antibody ELISA, microbial culture and vaccination
for sanitation of three chronically paratuberculosis infected dairy herds in
Rhineland-Palatinate.] DTW (Deutsche Tieraerztliche Wochenschrift).
2002; 109(12): 510-516. ISSN: 0341-6593. Note: In German with an English summary.
NAL Call
No.: 41.8
D482
Descriptors: cattle, calves, culling
sick animals, Mycobacterium avium
subsp. paratuberculosis, antibodies,
diagnostic techniques, disease control, granuloma, immunization,
paratuberculosis, sanitation, skin tests, vaccination, Rhineland Palatinate,
Germany.
Koets, Ad; Rutten, Victor; Hoek, Aad; van Mil, Frans; Muller, Kerstin;
Bakker, Douwe; Gruys, Erik; van Eden,Willem. Progressive bovine paratuberculosis is associated with
local loss of CD4+ T cells, increased frequency of gammadelta T cells, and
related changes in T cell function. Infection and Immunity. July
2002; 70(7): 3856-3864. ISSN: 0019-9567.
NAL
Call No.: QR1.I57
Descriptors:
Mycobacterium avium
subsp. paratuberculosis, loss of cell mediated response, immune
reactivity of intestine, cows, etiology.
Krayc, B.; Schonthaler, D. [Editors]
Tagungsbericht 1. Fachtagung fur
Ziegenzuchter und -halter zum Thema Ziegenzucht und Ziegenhaltung, 12. November
und 13. November 2002, BAL Gumpenstein,
Descriptors: 12 papers, goats,
breeding, nutritional value of goat products, improving goats milk, milk protein
variations, grazing in alpine regions, feeding and feeds, inbreeding,
tuberculosis and Johne’s disease, other diseases, mastitis, Austria.
Langelaar, M.; Koets, A.; Muller, K.; van Eden, W.; Noordhuizen, J.; Howard,
C.; Hope, J.; Rutten, V. Mycobacterium
paratuberculosis heat shock protein 70 as a tool in control of
paratuberculosis. Veterinary Immunology and Immunopathology.
September 10, 2002; 87(3-4): 239-244. ISSN: 0165-2427.
NAL Call No.:
SF757.2.V38
URL:
http://www.elsevier.com/locate/vetimm
Descriptors:
Mycobacterium avium
subsp. paratuberculosis, cattle, antibody titers, rHsp 70,
shuttle antigen, interaction between APC and Fitc-labelled rHsp70, FACS
analysis, uptake.
Leid, J.G.; Hunter, D.;
NAL Call No.: 500 N484 v.
969
Descriptors: American bison,
experimental infection with Mycobacterium
avium subsp. paratuberculosis,
diagnostic monoclonal antibodies, mice hybridomas, Mycobacterium bovis antigen 85, sera
from 100 inoculated bison, indicate monoclonal antibodies can be reliable
diagnostic test.
Leine, N. Friskare geiter" - eit
smittesaneringsprosjekt: med malsetting a sanere sjukdommane CAE, byllesjuke og
paratuberkulose i norske geitebuskapar. ['Healthy goats' - a project for
the eradication of infectious diseases.]
Norsk
Veterinaertidsskrift. 2002;
114(3): 313-315. ISSN: 0332-5741. Note: In Norwegian.
Descriptors: goat herds, 20 farms
tested, disease elimination, caprine arthritis encephalitis, Johne's disease, Mycobacterium avium subsp. paratuberculosis, and caseous
lymphadenitis Corynebacterium
pseudotuberculosis, information dissemination, establishing a base line of
infections, serological survey,
Lewis, C. Developing a healthy flock. In Practice. 2002; 24(1): 12-16. ISSN: 0263-841X.
NAL Call No.:
SF601.I4
Descriptors: sheep, husbandry,
management, replacement rates, abortion, many diseases mentioned, toxicities,
pyrethroid insecticides, organophosphate insecticides, vaccination, transport of
animals, nematodes, avermectins, scrapie, various bacterial diseases including
Mycobacterium avium subsp. paratuberculosis, viral diseases,
external and internal parasites, disease prevention.
Links, I.J.; Evers, M.; Denholm, L.J. Progress with Ovine Johne's Disease Control
in
Descriptors: sheep, lambs, Johne’s
disease, mycobacterial diseases, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
epidemiology, diagnosis, disease control, immunity, immunization, vaccination,
vaccine development, New South Wales, Australia.
Lund, Barbara M.; Gould, Grahame W.; Rampling, Anita M. Pasteurization of milk and the heat resistance of
Mycobacterium avium
subsp. paratuberculosis: A critical review of the data.
International Journal of Food Microbiology. July 25, 2002; 77(1-2):
135-145. ISSN: 0168-1605.
URL:
http://www.elsevier.com/locate/ijfood,icro
NAL
Call No.:
QR115.I57
Descriptors: Mycobacterium avium
subsp. paratuberculosis, heat resistance, Johne’s disease,
Crohn’s disease, heat treatment parameters, performance criterian, human health
risks, post-pasteurization contamination control.
Luyven, G.; Vom Schloss, A.; Sasserath, M. Paratuberkulosesanierung in
Nordrhein-Westfalen.
[Paratuberculosis eradication programs in North Rhine, Westfalia.] DTW (Deutsche Tierarztliche
Wochenschrift). 2002; 109(12):
524-527. ISSN: 0341-6593. Note: In German with an English summary.
NAL Call
No.:
41.8
D482
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s control
programs, testing, herd management, North Rhine,
Mackintosh, C. G. Johne's disease in deer:
Prospects for control. Proceedings of the New Zealand Society
of Animal Production. 2002; 62: 303-306. ISSN: 0370-2731.
NAL Call No.: 49.9
N483
Descriptors: farmed deer, disease
prevention and control, Mycobacterium avium
subsp. paratuberculosis, clinical picture, detection of
subclinical infections, culling, depopulation, restocking, New Zealand.
Magnano, G.; Schneider, M.; Carranza, A.;
NAL
Call No.:
SF604.V463
Descriptors: beef cattle herds, 19 farms, serological
survey, ELISA, low percentages for Mycobacterium avium subsp. paratuberculosis,
Mahavir Singh; Siddiqui, M.Z.; Singh, R.P. Intra-species mice hybridomas against a
recombinant protein of Mycobacterium
avium paratuberculosis. Journal of Applied Animal Research.
2002; 22(1): 137-144. ISSN: 0971-2119. Note: In English with a Hindi summary.
NAL Call No.:
SF55.I4J68
Descriptors: mice, intra-species mice
hybridomas, 35kDa antibodies of Mycobacterium avium subsp. paratuberculosis primed splenocytes of
Swiss white mice with BALB/c derived myeloma cells, DNA cloning, hybridomas,
IgG, immune response, monoclonal antibodies, recombinant proteins, macrophages,
immunoblots.
Mahmoud, O. M.; Haroun, E. M.; Elfaki, M. G.; Abbas, B. Pigmented paratuberculosis granulomata in the liver of
sheep. Small Ruminant Research. March 2002; 43(3): 211-217. ISSN:
0921-4488.
URL: http://www.elsevier.com/locate/smallrumres
NAL
Call No.:
SF380.I52
Descriptors: Johne’s
disease, sheep, description of granulomata, epitheloid cells, basophilic
granules, fibrous capsule, intestinal lesions, ileum, rectum, mesenteric lymph
nodes, acid fast bacteria, Mycobacterium avium
subsp. paratuberculosis, yellowish orange
pigment.
Mainali, C.
URL: http://www.afns.ualberta.ca/wcds/%20Access%20method:%20http
NAL Call No.: SF223.W478
Descriptors: dairy cows, Mycobacterium avium subsp. paratuberculosis, Johnes’ disease
control program,
Manjurano, A.; Karimuribo, E.D.; Mdegela, R.H.; Kusiluka, L.I.M.; Kipanyula,
M.I.; Kambarage, D.M. Prevalence of Mycobacterium avium subspecies paratuberculosis infection in cattle in
the southern highlands of
Descriptors: dairy cattle, dairy
herds, Johne’s disease, disease prevalence, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
fecal sampling, age differences, disease surveys, epidemiology,
paratuberculosis,
Marco, Ignasi; Ruiz, Maria; Juste, Ramon; Garrido, Juan Manuel; Lavin,
URL: http://www.jwildlifedis.org/.
NAL Call
No.: 41.9
W64B
Descriptors: fallow deer, Dama dama, gross lesions, post mortem
examination and histopathology, PCR, indirect ELISA, immunodiffusion tests, sera
testing, Mycobacterium avium subsp.
paratuberculosis, Regional Hunting
Reserve of El Sueve, Asturias, Spain.
McClure, P.J. Microbiological hazard identification in
the meat industry. Kerry, J.;
Kerry, J.; Ledward, D. [Editors] Meat Processing: Improving Quality.
Woodhead Publishing Ltd.
Descriptors: microbial hazards of
meat and meat products, foodborne illnesses, zoonotic diseases, analytical
detecting methods, Salmonella, Escherichia coli, Campylobacter jejuni, Yersinia enterocolitica, Staphylococcus aureus, Listeria monocytogenes, Clostridium perfringens, Clostridium botulinum, Mycobacterium avium subsp. paratuberculosis, other bacteria,
parasites, prions, viruses.
Mehta, B.M.; Mehta, F.M.; Borkhatriya, V.N. Mycobacterium avium ssp. paratuberculosis: an overview. Indian Dairyman. 2002; 54(11): 63-68. ISSN: 0019-4603.
NAL Call No.: 44.8 IN282
Descriptors: cattle, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, diagnosis, disease
transmission, public health, zoonoses,
Menzies, F.D.; Reid, S.W.J. [Editors] Society for Veterinary Epidemiology and
Preventive Medicine. Twentieth Anniversary Proceedings of a Meeting Held at
Descriptors: sheep, horses, pigs,
cattle, epidemiology, preventative medicine, risk factors, mathematical models
for analysis, impact of housing systems, methods for assessing sensitivity and
specificity of diagnostic techniques, equine influenza, foot and mouth disease,
Johne's disease, salmonellosis, encephalomyocarditis, toxoplasmosis,
helminthoses, colic, lameness, fetal death, isoflurane and halothane
toxicity.
Mori, Yasuyuki; Kikuma, Reiko; Muneta, Yoshihiro; Yoshihara, Kazuhiro;
Hikono, Hirokazu; Momotani, Eiichi. Studies on the diagnostic methods for
bovine paratuberculosis. Bulletin of the National Institute of Animal
Health. 2002; (109):
33-42. ISSN: 1347-2542. Note: In
Japanese.
Descriptors: Mycobacterium avium subsp. paratuberculosis, diagnostic methods,
cytokines, diagnosis, interferon, monoclonal antibodies, monocytes,
paratuberculosis, pathogenesis, tuberculin, fecal testing, PCR test with
internal control DNA is accurate, sensitive and rapid, interferon gamma
(IFN-gamma) assay using johnin purified protein derivative (J-PPD), bovine
tuberculin PPD and concanavalin A (Con A), IFN-gamma responses against J-PPD
highest in affected animals.
Mullerad, J.; Hovav, A.; Fishman, Y.;
URL: http://www.blackwellsynergy.com/servlet/useragent?func=showIssues&code=fim
NAL
Call No.:
QR180.F46
Descriptors: mice, cattle disease, Mycobacterium avium subsp. paratuberculosis, effective control
needed, acellular vaccine, immunized mice with MPT superoxide dismutase alone or
adjuvanted by Ribi, purified antigen in E. coli, results indicate exploring
antigen for future acellular vaccine.
Mullerad, Jacob; Michal, Israel; Fishman, Yolanta; Hovav, Avi Hai; Barletta
Raul, G.; Bercovier, Herve. The immunogenicity
of Mycobacterium paratuberculosis 85B antigen. Medical
Microbiology and Immunology. March 2002; 190(4): 179-187. ISSN: 0300-8584.
Descriptors: Mycobacterium avium
subsp. paratuberculosis, mouse model, laboratory experiment,
immune response, recombinant MPT 85B in Ribi adjuvant, anti-85B antibody
production of all classes tested, IgG1/IgG2a ratio, cellular vaccine candidate.
Murray, Dupont C. Vaccination against Johne's
disease. Proceedings of the New Zealand Society of Animal
Production. 2002; 62: 288-289. ISSN: 0370-2731.
NAL Call No.: 49.9
N483
Descriptors: control, immunogenic
cell surface associated and secreted proteins, New Zealand field isolate, Mycobacterium avium
subsp. paratuberculosis, possible subunit vaccine, adverse
effects of vaccination, TB testing.
Muskens, J.; van Zijderveld, F.; Eger, A.; Bakker, D. Evaluation of the long-term immune response in cattle
after vaccination against paratuberculosis in two Dutch dairy herds.
Veterinary Microbiology. May 1, 2002; 86(3): 269-278. ISSN: 0378-1135.
URL:
http://www.elsevier.com/locate/vetmic
NAL
Call No.:
SF601.V44
Descriptors:
vaccination, paratuberculosis, tuberculosis, herd health, serological screening,
cattle 3 years old, vaccine testing, heat killed paratuberculosis vaccine, 12-14
year study, 2 herds, The Netherlands, effect of vaccination on both cellular and
humoral immune responses, paratuberculosis antigen, bovine tuberculosis antigen,
long lasting interference, Mycobacterium avium
subsp. paratuberculosis.
Mutwiri, George K.; Rosendal, Soren; Kosecka, Ula; Yager, Julie A.; Perdue,
Mary; Snider, Denis; Butler, Daniel G. Adoptive
transfer of BALB/c mouse splenocytes reduces lesion severity and induces
intestinal pathophysiologic changes in the Mycobacterium avium
subspecies paratuberculosis beige/scid mouse model.
Comparative Medicine. August 2002; 52(4): 332-341. ISSN:
1532-0820.
NAL Call No.: SF77.
C65
Descriptors: mouse model,
beige/scid strain, resistance, introperitoneal inoculation, immune
reconstruction.
Nettles, Victor F.; Quist, Charlotte F.; Lopez, Roel R.; Wilmers, Tom J.;
Frank, Phil; Roberts, Wayne; Chitwood, Sharon; Davidson, William R. Morbidity and mortality factors in Key deer
(Odocoileus virginianus clavium).
Journal of Wildlife Diseases. 2002; 38(4): 685-692. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: Key deer, Odocoileus virginianus clavium, wild
animals, endangered species, protected species, population levels, causes of
death, morbidity, mortality, nature reserves, postmortem examinations,
pathogens, salmonellosis, Arcanobacterium
pyogenes, Haemonchus contortus,
Mycobacterium avium subsp. paratuberculosis, Johne’s disease, Salmonella, Florida, United
States.
New South Wales Agriculture. Ovine Johne's Disease in
URL: http://www.dpi.nsw.gov.au/agriculture
Descriptors: sheep, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, disease surveys,
disease control, monitoring disease distribution and prevalence, epidemiology,
New Zealand Society of Animal
Production. 62nd Conference,
NAL Call No.: 49.9
N483
Descriptors: cattle, sheep,
production systems, wool, milk, meat, nutrition, forages, Johne’s disease,
reproduction, breeding, animal welfare,
Nielsen, Soren S.; Gronbaek, Carsten; Agger, Jens F.; Houe, Hans. Maximum-likelihood estimation of sensitivity and
specificity of ELISAs and faecal culture for diagnosis of
paratuberculosis. Preventive Veterinary Medicine. March 14, 2002;
53(3): 191-204. ISSN: 0167-5877.
NAL Call No.:
SF601.P7
Descriptors:
Mycobacterium bovis, Mycobacterium avium
subsp. paratuberculosis, 3 diagnostic tests, 2 ELISA’s, fecal
cultures, use of tests for screening and for confirmation, discussion of test
selection.
Nielsen, Soren S.; Enevoldsen, Carsten; Grohn, Yrjo T. The Mycobacterium avium
subsp. paratuberculosis ELISA response by parity and stage of
lactation. Preventive Veterinary Medicine. May 30, 2002; 54(1):
1-10. ISSN: 0167-5877.
URL:
http://www.elsevier.com/locate/prevetmed
NAL
Call No.:
SF601.P7
Descriptors: ELISA,
Johne’s disease, cows, milk samples, serum samples, antibody detection,
interpretation, detection, tentative diagnosis.
Nielsen, S. S.; Grohn Y. T.; Quaas, R.L; Agger, J. F. Paratuberculosis in dairy cattle: Variation of the
antibody response in offspring attributable to the dam. Journal of
Dairy Science. February 2002; 85(2): 406-412. ISSN: 0022-0302.
URL:
http://www.ADSA.org/jds
NAL
Call No.: 44.8
J822
Descriptors: transmission factors,
Mycobacterium avium
subsp. paratuberculosis, dairy cattle, ELISA antibody testing,
contribution from parents, heritability of susceptibility and vertical
transmission, control programs, etiology, epidemiology.
Nielsen, K.K.; Ahrens, P. Putative in vitro expressed gene fragments
unique to Mycobacterium avium
subspecies paratuberculosis. FEMS
Microbiology Letters.
2002; 214(2): 199-203. ISSN:
0378-1097.
URL: http://www.blackwell-synergy.com/servlet/useragent?func=showIssues&code=fml
NAL
Call No.:
QR1.F44
Abstract: By a suppression subtractive
hybridization based method, nine novel Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) fragments of
between 318 and 596 bp have been identified and characterized. Database search revealed little or no
similarity with other mycobacteria. The uniqueness and diagnostic potential
of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by
species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight
of the nine fragments originate from areas of the genome that are expressed in
vitro.
Descriptors: Mycobacterium
paratuberculosis, nucleotide sequences,
Mycobacterium avium subsp. paratuberculosis.
Nielsen, S.S. Variance components of an enzyme-linked
immunosorbent assay for detection of IgG antibodies in milk samples to Mycobacterium avium subspecies paratuberculosis in dairy cattle. Journal of Veterinary Medicine Series B.
2002; 49(8): 384-387. ISSN: 0931-1793.
URL: http://www.blackwellpublishing.com/journal.asp?ref=0931-1793&site=1
NAL
Call No.: 41.8
Z52
Descriptors: cattle, 120 cows, ELISA
anitibody testing, Johne’s diagnosis, variance components, mixed model theory,
milk sampling, Mycobacterium avium
subsp. paratuberculosis, IgG,
laboratory variability.
Nielsen, S.S.; Grohn, Y.T.; Enevoldsen, C. Variation of the milk antibody response to
paratuberculosis in naturally infected dairy cows. Journal of Dairy Science. 2002; 85(11): 2795-2802. ISSN: 0022-0302.
URL: http://www.adsa.org/jds/abs/2002/d02B2795.htm
NAL Call No.: 44.8
J822
Descriptors: 812 dairy cows, milk
antibody response, fecal culture, Mycobacterium avium subsp. paratuberculosis, asymptomatic
infection, antibody formation, diagnostic methods, ELISA, longitudinal study,
4289 observations, model controlled for effect of herd, breed, laboratory
effects, age of calving, effect over time of lactation.
Nsengwa, G.; Massele, R.M.; Udoba, C.N.A. Further confirmation of Johne's disease at
Kitulo Dairy Farm in southern highlands of
Descriptors: dairy cows, dairy farms,
Johne’s disease, case reports, Mycobacterium avium subsp. paratuberculosis, clinical aspects, post
mortem examination, lesions, histopathology, economics, epidemiology,
paratuberculosis,
Ocepek, M.; Krt, B.; Pate, M.; Pogacnik, M. Seroprevalence of paratuberculosis in
Descriptors: 38,469 cattle serum
samples, 12,578 sheep and goats serum samples Mycobacterium avium subsp. paratuberculosis, disease survey,
disease prevalence, diagnostic techniques, antibody testing kits, ELISA,
immunodiagnosis, movement of animals transmits disease,
Slovenia.
O'Doherty, A.; O' Grady, D.; Smith, T.; Egan, J. Mycobacterium avium
subsp. paratuberculosis in pasteurised and unpasteurised milk in
the Republic of Ireland. Irish Journal of Agricultural and Food
Research. June 2002; 41(1): 117-121. ISSN: 0791-6833.
NAL Call No.:
S539.5.I74
Descriptors: milk
samples, unpasteurized, bulk sampling, cattle, goats, retail pasteurized milk
sampling, decontamination with hexadecyl pyridinium chloride, cultured for Mycobacterium avium
subsp. paratuberculosis, Bactec B12B and Herrold's Egg Yolk
medium.
O'Doherty, A.; O'Grady, D.; O'Farrell, K.; Smith, T.; Egan, J. Survey of Johne's disease in imported
animals in the
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8
V641
Descriptors: 224 imported animals, 36
herd health, carriers of Mycobacterium
avium subsp. paratuberculosis,
serum testing, ELISA assay failed to detect animals in early stages of disease,
feces, disease prevalence, data from disease survey, Denmark, France, Irish
Republic, The Netherlands.
Olsen, I.; Siguroardottir, O. G.; Djonne, B. Paratuberculosis with special reference to cattle. A
review. Veterinary Quarterly. February 2002; 24(1): 12-28. ISSN:
0165-2176.
NAL Call No.: SF601
V46
Descriptors: cattle disease,
description, symptoms, world-wide economic effects, control, clinical
importance, pathology, immunology, properties of infectious agent,
identification of subclinical infections, diagnostic methods evaluated, Mycobacterium avium
subsp. paratuberculosis.
O'Mahony, J.; Hill, C. A real time PCR assay for the detection and
quantitation of Mycobacterium avium
subsp. paratuberculosis using SYBR
Green and the Light Cycler. Journal
of Microbiological Methods. 2002; 51(3): 283-293. ISSN: 0167-7012.
URL: http://www.elsevier.com/cdweb/views/article.htt?jnl=01677012&iss=3&vol=51&pii=S016770120200098%20
NAL Call No.:
QR65.J68
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
Crohn’s disease, rapid detection methods, rapid real time PCR assay to detect
and quantify, SYBR Gree and Lightcycler, P90, P91 primers, which amplify a
400-bp region of the IS900 element, can detect as few as 20
copies.
Pang, Victor Fei; Lee, Chia Hao; Chueh, Ling Ling; Liu, Chen Hsuan; Cheng,
Chiung Hsian; Chiou, Huey Ing; Chang, Chih Cheng; Fu, Yng Bin; Chang, Chih Hua;
Lee, Shu Hwae; Chen, Mei Ing; Shiau, Chung Jung; Chang, Chao Fu; Chi, Chau Haw;
Jeng, Chian-Ren. Diagnosis and differentiation
of mycobacterial infection in formalin-fixed and paraffin-embedded tissues of
zoo animals by polymerase chain reaction. Taiwan Veterinary
Journal. March 2002; 28(1): 80-87. ISSN: 1682-6485. Note: In Chinese.
NAL Call No.: SF604
C54
Descriptors: zoo animals,
Mycobacterium, diagnosis of species of Mycobacterium
tuberculosis, polymerase chain reaction (PCR) based method, non-radioactive
labeled Southern blot hybridization, DNA fragment, 65 kD mycobacterial surface
antigen of Mycobacterium tuberculosis, Mycobacterium bovis,
Mycobacterium avium subsp. avium, Mycobacterium avium
subsp. paratuberculosis, and Mycobacterium fortuitum,
38 kd protein antigen b of Mycobacterium tuberculosis and
Mycobacterium bovis, in formalin-fixed and paraffin-embedded
tissues.
Pillai, S.R.; Jayarao, B.M. Application of
IS900 PCR for detection of Mycobacterium avium
subsp. paratuberculosis directly from raw milk.
Journal of Dairy Science. May, 2002; 85(5): 1052-1057. ISSN:
0022-0302.
URL: http://www.ADSA.org/jds
NAL
Call No.: 44.8
J822
Descriptors: polymerase chain
reaction-based assay, sequence 900, raw bulk milk samples, experimental
inoculation, cattle milk sampling, Johne’s disease, sensitivity of assay.
Pitt, D.J.; Pinch, D.S.; Janmaat, A.; Condron, R.J.
An estimate of specificity for a Johne's disease absorbed ELISA in
northern Australian cattle. Australian Veterinary Journal. 2002; 80(1-2): 57-60. ISSN: 0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: mature, beef
cattle, dairy cattle, blood
sampling, Mycobacterium avium subsp.
paratuberculosis, Johne’s disease,
bacterial diseases, beef cattle, dairy cattle, absorbed ELISA kit, tissue and
fecal sampling, paratuberculosis, regional variations,
Quist, Charlotte F.; Nettles, Victor F.; Manning, Elizabeth J.B.; Hall,
D.Greg; Gaydos, Joseph K.; Wilmers, Tom J.; Lopez, Roel R. Paratuberculosis in Key deer (Odocoileus virginianus clavium). Journal of Wildlife Diseases. 2002; 38(4): 729-737. ISSN: 0090-3558.
URL: http://www.jwildlifedis.org/
NAL
Call No.: 41.9
W64B
Descriptors: Key deer, Odocoileus virginianus clavium, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
disease surveys, fecal culture, serology, epidemiology, paratuberculosis, low
prevalence,
Radunz, B. Johne's disease. Agnote Northern Territory of
Descriptors: cattle, goats, deer, Mycobacterium avium subsp. paratuberculosis, disease symptoms,
clinical aspects, epidemiology, diagnosis, pathogenesis, disease transmission,
Richter, Elvira; Wessling, Johannes; Luegering, Norbert; Domschke, Wolfram;
Ruesch, Gerdes Sabine. Mycobacterium avium
subsp. paratuberculosis infection in a patient with HIV,
Germany. Emerging Infectious Diseases. July 2002; 8(7): 729-731.
ISSN: 1080-6040.
NAL Call No.:
RA648.5.E46
Descriptors:
confirmed diagnosis, human, zoonotic disease, impared immune system, Germany.
Robbi, C.; Rossi, I.; Nardelli, S.; Rossi, E.; Toson, M.; Marangon, S.;
Cestaro, F.; Vicenzoni, G. Diagnosi della paratubercolosi bovina:
studio sull'utilizzo di test multipli.
[Serological diagnosis of paratuberculosis by means of multiple tests.]
Atti della Societa Italiana di Buiatria.
2002; 34: 277-282. Note: In Italian with an English summary.
Descriptors: cattle, serological
testing, Mycobacterium avium subsp.
paratuberculosis, disease control and
prevention, accuracy of diagnostic tests, 2 different ELISA’s in a series, 1 for
first screening, 1 to confirm positives from first test.
Robbi, C.; Rossi,
Descriptors: dairy cattle, dairy
farms, Johne’s disease survey, serological monitoring for Mycobacterium avium subsp. paratuberculosis, seroprevalence,
disease distribution, disease prevalence, disease surveys, ELISA, epidemiology,
paratuberculosis,
Samarineanu, M.; Medeanu, R.; Sarca, M.; Cismileanu, A. ELISA kit for bovine paratuberculosis
diagnosis. Buletinul Universitatii de Stiinte Agricole
si Medicina Veterinara Cluj Napoca, Seria Medicina Veterinara. 2002; 58: 426-434. ISSN: 1454-2382.
Descriptors: antigen based on
lipoarabinomannan from cultures of Mycobacterium avium subsp. paratuberculosis, used as a capture
antigen in ELISA kit, diagnostic test, sera testing, PARACHEK, CST Australia,
diagnostic value tested, Romania.
Secott, T.E.; Lin, T. L.; Wu, C. C. Fibronectin attachment protein is necessary for
efficient attachment and invasion of epithelial cells by Mycobacterium avium
subsp. paratuberculosis.
Infection and Immunity. May, 2002;
70(5): 2670-2675. ISSN: 0019-9567.
NAL Call
No.: QR1.I57
Descriptors:
Mycobacterium avium
subsp. paratuberculosis, attachment, ingestion, 2 epithelial
cells, effect of soluble fibromectin, disruption of FAP-P expression T-24 and
Caco-2 calls.
Sergeant, E.S.G.; Baldock, F.C. The estimated prevalence of Johne's disease
infected sheep flocks in
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: ovine Johne’s disease,
slaughter house surveillance, prevalence of infected flocks, Bayesian approach,
cluster distribution shown, 3 regions of
Sergeant, E. S. G.; Whittington, R. J.; More, S. J. Sensitivity and specificity of pooled faecal culture
and serology as flock-screening tests for detection of ovine paratuberculosis in
Australia. Preventive Veterinary Medicine. January 22, 2002;
52(3-4): 199-211. ISSN: 0167-5877.
NAL Call
No.: SF601.P7
Descriptors:
sheep, pooled fecal culture, serological testing AGID, Johnes’s infected flocks,
test sensitivity and reliability for flock health testing, surveillance and
assurance programs, Australia.
Shafran, I.; Kugler, L.; El Zaatari, F. A. K.; Naser, S. A.; Sandoval, J.
Open clinical trial of rifabutin and
clarithromycin therapy in Crohn's disease. Digestive and Liver
Disease. January 2002; 34(1): 22-28. ISSN: 1590-8658.
Descriptors: humans, Crohn's disease,
etiology of Mycobacterium avium
subsp. paratuberculosis, rifabutin and clarithromycin anti-Mycobacterium avium
subsp. paratuberculosis treatment, evaluation of patient
responses.
Simpson, V.R. Wild animals as reservoirs of infectious
diseases in the
URL: http://journals.harcourt-international.com/wbs/tvj
NAL Call No.: SF601.V484
Abstract: This review aims to illustrate the
extent to which wildlife act as reservoirs of infectious agents that cause
disease in domestic stock, pet and captive animals and humans. More than 40 agents are described. In the case of some of these, e.g. Cryptosporidium spp., Escherichia coli O157 and malignant
catarrhal fever, the current evidence is that wildlife either does not act as a
reservoir or is of limited importance. However, in the case of many important
diseases, including bovine tuberculosis, Weil's disease, Lyme disease, avian
influenza, duck virus enteritis and louping ill, wild animals are considered to
be the principal source of infection. Wildlife may be involved in the
epidemiology of other major diseases, such as neosporosis, Johne's disease,
mucosal disease and foot and mouth disease, but further studies are needed.
The
Descriptors: wild animals, disease
reservoir hosts, bacterial diseases, Johne’s disease, viral diseases,
parasitoses, livestock, epidemiology, disease transmission, pathogens,
literature reviews, United Kingdom.
Singh, Mahavir; Siddiqui, Mahtab Z.; Singh, R.P. Intra-species mice hybridomas against a
recombinant protein of Mycobacterium
avium paratuberculosis. Journal of Applied Animal Research.
2002; 22(1): 137-144. ISSN: 0971-2119.
NAL
Call No.:
SF55.I4J68
Descriptors: 35 kDa recombinant
protein, Mycobacterium avium subsp. paratuberculosis primed Swiss white
mice splenocytes with BALB/c derived myeloma cells, intra species mice
hybridomas, peritoneal macrophages as feeder layer, 5 monoclonal antibodies,
1AG2, 2BD2, 2BG2, 1DE8, IgG2b, immunoblots.
Skjerve, E. Emerging pathogenic bacteria of special
interest; epidemiological concerns. In:
Smulders, F.J.M.; Collins, J.D. [Editors]. Food Safety Assurance and Veterinary Public
Health. Vol.1. Food Safety Assurance in the Pre harvest Phase. Wageningen Academic Publishers.
Descriptors: animal health, food
production, food safety, foodborne illnesses, food contamination, drug
resistance, epidemiology, public health, risk assessment, zoonoses,
salmonellosis, Salmonella
enteritidis, tuberculosis, Bacillus
cereus, Escherichia coli, Mycobacterium avium subsp. paratuberculosis, Salmonella
typhimurium.
Smith, D.R. Epidemiologic tools for biosecurity and
biocontainment. Veterinary Clinics of
NAL Call No.:
SF601.V535
Descriptors: cattle, Johne’s disease,
biosecurity concerns, etiology, diagnosis, disease prevention and control,
epidemiology, probabilistic mathematical models.
Soons, R.; Heuer, C.; Jackson, R.; Groenendaal. Computer simulation of Johne's disease in New Zealand
dairy cattle. Proceedings of the New Zealand Society of Animal
Production. 2002; 62: 294-298. ISSN: 0370-2731.
NAL Call No.: 49.9
N483
Descriptors: disease control,
dairy herds, Mycobacterium avium
subsp. paratuberculosis, review, models, the model 'JohneSSim',
control measures, test and cull, contract heifer rearing, colostrum management,
seasonal calving, risk factors, possible application to New Zealand.
Soto, J.P.; Kruze, J.; Leiva, S. Aislamiento de Mycobacterium avium subsp.
paratuberculosis de fecas en rebanos lecheros infectados mediante el Metodo de
Cornell modificado. [Isolation of
Mycobacterium avium subsp. paratuberculosis from bovine feces of
infected dairy herds by the Cornell's method modified.] Archivos de Medicina Veterinaria. 2002; 34(2): 275-282. ISSN: 0301-732X. Note: In Spanish with an English
summary.
URL: http://www.scielo.cl/scielo.php?script=sci_issues&pid=0301-732X&lng=en&nrm=iso
NAL
Call No.:
SF604.A75
Descriptors: cattle, 14 dairy herds
infected with Mycobacterium avium
subsp. paratuberculosis,
asymptomatic infections, fecal culture procedure, decontamination solution of
hexadecylpiridinium chloride, antibiotic solution containing amphotericin B,
vancomycin, and nalidixic acid, HEYM and mycobactin J with antibiotics used
above as culture media, isolates testes with PCR with primer P90 and P91, low
rates of contamination with high specificity makes it a good diagnostic
techniques, Chile.
Soto, J.P.; Kruze, J.; Leiva, S. Comparacion de tres metodos de diagnostico
de Paratuberculosis bovina en rebanos lecheros infectados. [Comparison of three different methods
for the diagnosis of bovine paratuberculosis in infected dairy herds.] Archivos de Medicina Veterinaria. 2002; 34(2): 265-273. ISSN: 0301-732X. Note: In Spanish with an English summary.
URL: http://www.scielo.cl/scielo.php?script=sci_issues&pid=0301-732X&lng=en&nrm=iso
NAL
Call No.:
SF604.A75
Descriptors: 250 animals, 14 infected
dairy herds, cattle, Mycobacterium
avium subsp. paratuberculosis,
asymptomatic infections, diagnosis, diagnostic techniques, feces, direct
microscopic examination, fecal culture with Modified Herrold’s Medium, and
serological testing with ELISA, 2 bacteriological methods, isolated culture
identified with PCR, serological testing with ELISA IDEXX test kit, combination
of fecal and sera testing seems most effective for infected asymptomatic
animals.
Stabel, J. R.; Wells, S. J.; Wagner, B. A. Relationships between fecal culture, ELISA, and bulk
tank milk test results for Johne's disease in US dairy herds.
Journal of Dairy Science. March 2002; 85(3): 525-531. ISSN:
0022-0302.
URL:
http://www.ADSA.org/jds
NAL
Call No.: 44.8
J822
Descriptors: cows, estimate
percentages of seropositive herds, Mycobacterium paratuberculosis in
feces and milk, estimate of sensitivity, specificity, and predictive value,
ELISA compared to fecal culture.
Stabel, J.R.; Ackermann, M.R. Temporal Mycobacterium paratuberculosis infection
in T-cell receptor (TCR)-alpha and TCR-delta-deficient mice. Veterinary Immunology and
Immunopathology. 2002; 89(3-4):
127-132. ISSN: 0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.:
SF757.2.V38
Descriptors: Mycobacterium avium subsp. paratuberculosis, clinical aspects,
Johne’s disease, cell mediated immunity, mice, disease models, laboratory
animals, experimental infections, pathogenesis, strain differences, T
lymphocytes.
Steadham, E.M.; Martin, B.M.; Thoen, C.O. Production of a Mycobacterium avium ssp. paratuberculosis purified protein
derivative (PPD) and evaluation of potency in guinea pigs. Biologicals. 2002; 30(2): 93-95. ISSN: 1045-1056.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6718&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=2c72079aa9cb5ae63c632d6d5dfb5966
Descriptors: guinea pigs, laboratory
animal models, Mycobacterium avium
subsp. paratuberculosis, purified
protein derivative, bacterial antigens, delayed type hypersensitivity, T
lymphocytes.
Stephan, R.; Buhler, K.; Corti, S. Incidence of Mycobacterium avium subspecies paratuberculosis in bulk-tank milk
samples from different regions in
NAL
Call No.: 41.8
V641
Descriptors: 501 raw milk samples,
screened for Mycobacterium avium
subsp. paratuberculosis, pathogen
prevalence data shows variation in geographic regions, northeast, central and
northwest regions of
Stevenson, K.; Hughes, V,M. ; De Juan, L.; Inglis, N.F.; Wright, F.; Sharp,
J.M. Molecular characterisation of pigmented and
non-pigmented isolates of Mycobacterium avium
subsp. paratuberculosis. Research in Veterinary
Science. April 2002; 72(Suppl. A): 29. ISSN: 0034-5288. Note: 56th Annual
Conference of the Association of Veterinary Teachers and Research Workers on
Current Topics in Veterinary Science, Scarborough, England, UK, March 25-27,
2002.
NAL Call No.: 41.8
R312
Descriptors: epidemiology, Mycobacterium avium
subsp. paratuberculosis, non-pigmented isolates, pigmented
isolates, sheep.
Stratmann, J.; Strommenger, B.; Stevenson, K.; Gerlach, G.F.
Development of a peptide-mediated capture PCR for detection of Mycobacterium avium subsp. paratuberculosis in milk. Journal of Clinical Microbiology. 2002; 40(11): 4244-4250. ISSN: 0095-1137.
NAL
Call No.:
QR46.J6
Descriptors: dairy herds, naturally
infected with Mycobacterium avium
subsp. paratuberculosis, bulk
milk testing, diagnostic method, recombinant bacteriophages isolated, phage
peptides, one peptide sequence NYVIHDVPRHPA, designated aMP3, chemically
synthesized, put on paramagnetic beads captured MAP, potential value as a
screening tool.
Surujballi, Om P.; Romanowska, Anna; Sugden, Edward A.; Turcotte, Claude;
Jolley, Michael E. A fluorescence polarization
assay for the detection of antibodies to Mycobacterium bovis in cattle
sera. Veterinary Microbiology. [print] June 20, 2002; 87(2):
149-157. ISSN: 0378-1135.
URL:
http://www.elsevier.com/locate/vetmic
NAL
Call No.:
SF601.V44
Descriptors: cattle,
sera, fluorescence polarization assay, fluorescein-labelled MPB70 protein
antigen, Mycobacterium bovis, accuracy of indicator test, lack of cross
reaction.
Svastova, P.; Pavlik,
NAL
Call No.:
41.9
C333
Descriptors: Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, strain differences, Mycobacterium intracellulare, IS901,
amplicons, DNA sequencing, transposable elements.
Swalve, H.H.; von Lengerken, G. Beitrag der Tierzucht zur
Lebensmittelsicherheit. [Impact of
animal breeding on food safety.] Zuchtungskunde. 2002; 74(6): 403-412. ISSN: 0044-5401. Note: In German with an English summary.
NAL Call No.: 49
Z8
Descriptors: animal production,
animal health, breeding for disease resistance and reduction zoonotic diseases,
meat, milk, eggs, TSE, mastitis, E.
coli, Mycobacterium avium subsp.
paratuberculosis, stress
susceptibility, role of gene identification and selection.
Taragel, C. Johne's disease zoning for goats. Agnote NSW Agriculture. 2002; (DAI/100 (2nd edition)): 4 p. ISSN: 1034-6848.
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, disease control,
disease transmission, epidemiology, regulations, concerns regarding transport of
animals, zoning,
Thompson, K. G.; West, D. M.; Anderson, P.V.A.; Burnham, D.L. Subclinical Johne's disease in sheep.
Proceedings of the New Zealand Society of Animal Production. 2002; 62:
284-287. ISSN: 0370-2731.
NAL Call No.:
49.9 N483
Descriptors: sheep,
subclinical infection, 5 year study, disease impact on productivity, vaccines,
Mycobacterium avium
subsp. paratuberculosis, Neoparasec, Gudair, experimental
design.
Thornton, C.G.; MacLellan, K.M.; Stabel, J.R.; Carothers, C.; Whitlock, R.H.;
Passen, S. Application of the C18-carboxypropylbetaine
specimen processing method to recovery of Mycobacterium avium subsp. paratuberculosis from ruminant tissue
specimens. Journal of Clinical Microbiology. 2002; 40(5): 1783-1790. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=130914
NAL
Call No.:
QR46.J6
Descriptors: tissue specimen
processing method, bovine and bison tissues infected with Mycobacterium avium subsp. paratuberculosis,
C18-carboxypropylbetaine (CB-18) treatment, lytic enzyme decontamination,
ruminant tissues, BACTEC 12B liquid culture system supplemented with egg yolk
emulsion, mycobactin J, pyruvate (12B/EMP), vancomycin, amphotericin B,
nalidixic acid.
Tooker, B. C.; Burton, J. L.; Coussens, P. M. Survival tactics of M. paratuberculosis in
bovine macrophage cells. Veterinary Immunology and
Immunopathology. September 10, 2002; 87(3-4): 429-437. ISSN: 0165-2427.
URL:
http://www.elsevier.com/locate/vetimm
NAL
Call No.:
SF757.2.V38
Descriptors: Mycobacterium avium
subsp. paratuberculosis, vesicles of macrophage cells, 3
theories of survival, affects on host protein expression, interference with
macrophage activation, entry avoids, macrophage activation, DDRT-PCR, gene
expression comparison to E coli.
Tripathi, B.N.; Munjal, S.K.; Paliwal, O.P. An overview of paratuberculosis (Johne's
disease) in animals. Indian Journal of Veterinary Pathology.
2002; 26(1/2): 1-10. ISSN: 0250-4758. Note: A review.
Descriptors: animal bacterial
disease, disease surveys, Mycobacterium
avium subsp. paratuberculosis,
Johne’s disease, diagnosis, diagnostic techniques, disease control and
prevention, disease transmission, immunopathology, pathogenesis,
physiopathology.
Vagnozzi, A. Paratuberculosis: una revision
bibliografica. [Paratuberculosis: a
bibliographic revision.] Revista de Medicina Veterinaria
Descriptors: Mycobacterium avium subsp. paratuberculosis, diagnosis, disease
control, epidemiology, immune response.
Valentin-Weigand, P. Pathomechanismen
und Immunreaktionen bei der Paratuberkulose. [Pathogenesis and immunology of
paratuberculosis.] DTW (Deutsche Tieraerztliche Wochenschrift).
2002; 109(12): 507-509. ISSN: 0341-6593. Note: In German with an English summary.
NAL Call
No.: 41.8
D482
Descriptors: Mycobacterium avium subsp. paratuberculosis, factors regarding
understanding pathogenesis, slow growth, taxonomy, limited molecular techniques,
long incubation periods of natural infection, lack of laboratory model, role of
macrophage in immune response, immunology.
Valentin-Weigand, P. Tagung der Fachgruppe "Bakteriologie und
Mykologie" der DVG vom 22. bis 25. Mai 2002 in
NAL Call
No.: 41.8
B45
Descriptors: collection of 35 papers,
diagnosis, diagnostic techniques for domestic animal diseases, characteristics
of 3 important bacteria, Escherichia
coli, Mycobacterium avium subsp. paratuberculosis, Yersinia.
Valheim, M.; Storset, A.K.; Aleksandersen, M.; Brun-Hansen, H.; Press, C.M.
Lesions in subclinical paratuberculosis of
goats are associated with persistent gut-associated lymphoid tissue. Journal of Comparative Pathology. 2002; 127(2/3): 194-202. ISSN: 0021-9975.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=6861&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=6091bef4d15aae1adbceffba708c6eb8%20
Descriptors: ruminants, goat kids,
Peyer patches (PP) described, morphology, site of Mycobacterium avium subsp. paratuberculosis lesions, experimental
infection effects after 2 years, subclinical stage finding described, persistent
organized lymphoid tissue in jejunum PP (JPPs) and ileocaecal-valve PP (ICVPP),
but not involuted ileal PP (IPP), sustains the development of granulomatous
inflammation.
Valheim, M.; Hasvold, H.J.; Storset, A.K.; Larsen, H.J.S.; Press, C.McL. Localisation of CD25+ cells and MHCII+
cells in lymph nodes draining Mycobacterium avium subsp. paratuberculosis vaccination granuloma
and the presence of a systemic immune response. Research in Veterinary Science. 2002; 73(1): 77-85. ISSN:
0034-5288.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=7137&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=de976ce390543b0c4a1081aa5ff3686fauth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=de976ce390543b0c4a1081aa5ff3686f
NAL Call No.: 41.8
R312
Descriptors: goats, vaccination of
goat kids, Mycobacterium avium subsp.
paratuberculosis, systemic cellular
response, peripheral blood cells, interferon gamma production, expression of
interleukin 2 receptor, granuloma, immune-response, interferon, lymph nodes,
MHCII+ cells, CD4+T cells, major histocompatibility complex, paratuberculosis, T
lymphocytes, CD25+ lymphocytes.
Van Leeuwen, J. A.; Keefe, G. P.; Tiwari, A
Seroprevalence and productivity effects of infection with bovine leukemia virus,
Mycobacterium avium subspecies paratuberculosis, and
Neospora caninum in Maritime Canadian dairy cattle. Bovine
Practitioner. June 2002; 36(2): 86-91. ISSN: 0524-1685.
NAL Call No.:
SF779.5.A1B6
Descriptors: 90
dairy cattle herds, subclinical infection effects, milk production, serum
sampling, ELISA antibody testing, Canada.
Veerabadran Dheenadhayalan; Shin, K.S.; Chang, C.F.; Chang, C.D.; Wang, S.J.;
McDonough, S.; McDonough, P.; Stehman, S.; Shin, S.; Torres, A.; Chang, Y.F.
Cloning and characterization of the genes coding for antigen 85A, 85B and
85C of Mycobacterium avium subsp. paratuberculosis. DNA Sequence. 2002; 13(5): 287-294. ISSN: 1042-5179.
DNA Sequence: GenBank Accession no.: AF280067, AF280068,
AF219121
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, antigens, genes,
molecular genetics, genetic analysis, DNA cloning, binding proteins,
fibronectins.
Vialard, J. La paratubercolosi caprina. Caprine paratuberculosis. Summa. 2002; 19(4): 39-45. Note: In Italian with an English summary.
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, clinical aspects,
diagnosis.
Vihan, V.S. Evaluation of ELISA using wild type
species-specific sonicated antigen for diagnosis of Mycobacterium paratuberculosis in
goats. Indian Journal of Veterinary Medicine.
2002; 22(1): 21-24. ISSN: 0970-051X.
Descriptors: 121 goats, sera samples,
diagnosis of Johne’s disease, Mycobacterium avium subsp. paratuberculosis, wild purified
sonicated antigen from ileum mucosa of infected goats, antigen preparation,
ELISA, checked against fecal culture, sensitivity and specificity were high with
low false positives.
Waldner, C.L.; Cunningham, G.L.; Janzen, E.D.;
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: beef herds, commercial
cow-calf operations, community pastures, disease prevalence, disease control,
blood sampling of 1799 animals, sera testing, ELISA, Mycobacterium avium subsp. paratuberculosis, low prevalence found,
future research, identify risk factors and control points, target problem herds,
utilize a case-control study design, Saskatchewan, Canada.
Walravens, K.; Marche, S.; Rosseels, V.; Wellemans, V.; Boelaert, F.; Huygen,
K.; Godfroid, J. IFN-gamma diagnostic tests in
the context of bovine mycobacterial infections in Belgium.
Veterinary Immunology and Immunopathology. September
10, 2002; 87(3-4): 401-406. ISSN: 0165-2427.
URL:
http://www.elsevier.com/locate/vetimm
NAL
Call No.:
SF757.2.V38
Descriptors:
cattle tuberculosis, Mycobacterium bovis, Mycobacterium avium
subsp. paratuberculosis, testing strategies, differentiation
between species, IFN-gamma responses of animals, experimental infection.
Waters, W. R.; Sacco, R. E.; Fach, S. J.; Palmer, M. V.; Olsen, S. C.;
Kreeger, T. J. Analysis of mitogen-stimulated
lymphocyte subset proliferation and nitric oxide production by peripheral blood
mononuclear cells of captive elk (Cervus elaphus). Journal of
Wildlife Diseases. April 2002; 38(2): 344-351. ISSN: 0090-3558.
NAL Call No.: 41.9
W64B
Descriptors: elk, animal
reservoirs, Brucella abortus, Mycobacterium bovis, Mycobacterium avium
subsp. paratuberculosis, immune responses, peripheral blood
mononuclear cells, gammadelta TCR+ cells, pokeweed mitogen (PWM) stimulation,
nitric oxide production, sIgM+ cells co-expressed MHC class II and B-B4, a B
cell lineage marker.
Weber, M.F.; Groenendaal, H.; van Roermund, H.J.W.; Nielen, M. Simulation of alternative for the Dutch
Johne's disease certification programme. In: Menzies, F.D.; Reid, S.W.J. Society for Veterinary Epidemiology
and Preventive Medicine Twentieth Anniversary Proceedings of a Meeting Held at
University of Cambridge, UK, 3-5 April, 2002. Published by the Society.
NAL Call No.: SF780.9.S63
Descriptors: dairy cattle herds, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
animal health certification, disease surveys, disease control, disease
prevalence, economic impact, stochastic models, The
Netherlands.
Weersink, A.; Van Leeuwen, J.A.; Chi, J.; Keefe, G.P. Direct production losses and treatment
costs due to four dairy cattle diseases. Advances in Dairy Technology. 2002; 14: 55-75. ISSN: 1184-0684. Note: Paper presented at the Western Canadian
Dairy Seminar, March 5-8, 2002,
URL: http://www.afns.ualberta.ca/wcds/%20Access%20method:%20http
NAL Call No.: SF223.W478
Descriptors: dairy cows, bovine
diarrhea virus, bovine leucosis, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, yield losses,
Weiss, D.J.; Evanson, O.A.; Moritz, A.; Deng, M.Q.; Abrahamsen, M.S. Differential responses of bovine
macrophages to Mycobacterium avium
subsp. paratuberculosis and Mycobacterium avium subsp. avium. Infection and Immunology. 2002. 70(10): 5556-5561. ISSN:
0019-9567.
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=128321
NAL
Call No.:
QR1.I57
Abstract: Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium are antigenically and genetically
similar organisms; however, they differ in their virulence for cattle. M.
avium subsp. paratuberculosis
causes a chronic intestinal infection leading to a chronic wasting disease
termed paratuberculosis or Johne's disease, whereas M. avium subsp. avium causes only a transient
infection. We compared the response
of bovine monocyte-derived macrophages to ingestion of M. avium subsp. paratuberculosis and M. avium subsp. avium organisms by determining organism
survival, superoxide and nitric oxide production, and expression of the
cytokines tumor necrosis factor alpha (TNF-alpha), gamma interferon (IFN-gamma),
interleukin-8 (IL-8), IL-10, IL-12, and granulocyte-monocyte colony-stimulating
factor (GM-CSF). Unlike M. avium subsp. paratuberculosis, macrophages were able
to kill approximately half of the M.
avium subsp. avium organisms
after 96 h of incubation. This
difference in killing efficiency was not related to differences in nitric oxide
or superoxide production. Compared
to macrophages activated with IFN-gamma and lipopolysaccharide, macrophages
incubated with M. avium subsp. paratuberculosis showed greater
expression of IL-10 and GM-CSF (all time points) and IL-8 (72 h) and less
expression of IL-12 (72 h), IFN-gamma (6 h), and TNF-alpha (6 h). When cytokine expression by macrophages
incubated with M. avium subsp. paratuberculosis was compared to those
of macrophages incubated with M.
avium subsp. avium, M. avium subsp. paratuberculosis-infected cells showed
greater expression of IL-10 (6 and 24 h) and less expression of TNF-alpha (6 h).
Therefore, the combination of
inherent resistance to intracellular degradation and suppression of macrophage
activation through oversecretion of IL-10 may contribute to the virulence of M. avium subsp. paratuberculosis in
cattle.
Descriptors: cattle, virulence
differences, bovine macrophages, killing efficiency, cell survival Mycobacterium avium subsp. paratuberculosis, Johne’s disease, Mycobacterium avium subsp. avium, cytokines, immunopathology.
Wells, S.J.; Dee, S.; Godden, S. Biosecurity for gastrointestinal diseases
of adult dairy cattle. Veterinary Clinics of
NAL Call No.:
SF601.V535
Descriptors: dairy cattle, dairy
herds, adult animals, Mycobacterium
avium subsp. paratuberculosis, Salmonella, animal health, biosecurity
concerns, Johne’s disease, disease control, disease transmission,
gastrointestinal diseases, risk assessment.
Wells, Scott J.; Whitlock, Robert H.; Lindeman, Cynthia J. ; Fyock, Terry
Evaluation of bacteriologic culture of pooled
fecal samples for detection of Mycobacterium paratuberculosis.
American Journal of Veterinary Research. August 2002; 63(8): 1207-1211.
ISSN: 0002-9645.
NAL Call No.: 41.8
Am3A
Descriptors: cattle, concentration
of organisms, detection sensitivity, methods recommended to survey disease
levels of cattle herds, Mycobacterium avium
subsp. paratuberculosis.
Wells, Scott J.; Whitlock, Robert H.; Wagner, Bruce A.; Collins, James;
Garry, Franklyn; Hirst, Heather; Lawrence, John; Saville, William J. A.; Naugle,
Alecia L. Larew. Sensitivity of test strategies
used in the Voluntary Johne's Disease Herd Status Program for detection of
Mycobacterium paratuberculosis infection in dairy cattle herds.
Journal of the American Veterinary Medical Association. April 1, 2002;
220(7): 1053-1057. ISSN: 0003-1488.
URL: http://www.avma.org
NAL
Call No.: 41.8
Am3
Descriptors: dairy cattle herd
evaluation, reliability of the Voluntary Johne's Disease Herd Status Program
(VJDHSP), 64 dairy herds from Pennsylvania, Minnesota, Colorado, Ohio, and
Wisconsin, serum testing for antibodies to Mycobacterium avium
subsp. paratuberculosis, fecal testing.
West, D. M. Johne's disease: Why Johne's
disease is so difficult to control. Proceedings of the New Zealand
Society of Animal Production. 2002; 62: 282-283. ISSN:
0370-2731.
NAL Call No.: 49.9
N483
Descriptors: Mycobacterium avium
subsp. paratuberculosis, cattle, sheep, goats, deer, control
issues, incubation periods, pathogen survival, subclinical infection shedding,
unreliability of diagnostic tests, control comparisons between New Zealand and
Australia.
Wilson, P.R. Bacterial infections reported in
NAL Call No.:
SF604.63.N455S87
Descriptors: farmed deer, bacterial
diseases, disease prevalence, epidemiology, clinical aspects, Actinobacillus, Arcanobacterium pyogenes, Brucella ovis, Campylobacter fetus, Clostridium, Dermatophilus congolensis; Dichelobacter nodosus, Escherichia coli, Fusobacterium necrophorum, Leptospira, Listeria monocytogenes, Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, Pasteurella multocida, Salmonella typhimurium, Yersinia pseudotuberculosis, New
Zealand.
Winterhoff, C.; Beyerbach, M.; Homuth, M.; Strutzberg, K.; Gerlach, G. F.
Etablierung und Evaluation eines ELISA zum
Nachweis von Antikoerpern gegen Mycobacterium avium sub-species
paratuberculosis in Milch. [Evaluation of an ELISA for the detection of
Mycobacterium avium
subsp. paratuberculosis-specific antibodies in milk.]
Deutsche Tieraerztliche Wochenschrift. Mai 2002; 109(5): 230-234.
ISSN: 0341-6593. Note: In German.
NAL Call No.:
41.8 D482
Descriptors: dairy
farms, economically viable diagnostic method, antibody detection, Svanovir(R)
ELISA, milk testing.
Zwick, L.S.; Walsh, T.F.; Barbiers, R.; Collins, M.T.; Kinsel, M.J.; Murnane,
R.D. Paratuberculosis in a mandrill (Papio sphinx). Journal of Veterinary Diagnostic
Investigation. 2002; 14(4): 326-328. ISSN:
1040-6387.
NAL Call No.: SF774.J68
Descriptors: mandrill, Mandrillus sphinx, Papio sphinx, zoo animal, amyloidosis,
lymphadentis, enterocolitis, Mycobacterium avium subsp. paratuberculosis, histopathology,
clinical aspects, case report,
Allen, S.; Sotos, J.; Sylte, M. J.; Czuprynski, C. J. Use of hoechst 33342 staining to detect apoptotic
changes in bovine mononuclear phagocytes infected with Mycobacterium avium
subsp. paratuberculosis. Clinical and Diagnostic
Laboratory Immunology. March, 2001; 8(2): 460-464. ISSN: 1071-412X.
Descriptors: cattle white cells,
apoptosis in bovine monocytes, Hoechst 33342 staining, experimental infection
effects, viable bacilli, effects of preincubation of monocytes with bovine
growth hormone pre infection.
Atala, N.; Akcay, E. Turkiye genelinde sgr paratuberkulozu
prevalansnn ELISA ile arastrlmas.
[Prevalence of paratuberculosis in the Turkish cattle population by using
absorbed ELISA.] Etlik Veteriner Mikrobiyoloji Dergisi.
2001; 12(1/2): 39-48. ISSN: 1016-3573. Note: In Turkish with an English summary.
Descriptors: 8873 sera samples from
cattle, Mycobacterium avium subsp. paratuberculosis, epidemiology, disease
distribution, disease prevalence, seroprevalence, absorbed ELISA, 9 provinces,
Ayele, W.Y.; Machackova, M.; Pavlik,
URL: http://vetmed.vri.cz/
NAL
Call No.:
41.9
C333
Descriptors: dromedary camels, deer,
cattle, wild goats, wild sheep, Mycobacterium avium subsp. paratuberculosis, epidemiology, chronic
course, clinical aspects, feces, milk, disease prevention and control, disease
prevalence, disease transmission, productive organs, reviews, wild animals, wild
goats, wild sheep.
Banasure, K.D.; Basagoudanavar, S.H.; Chaudhury, P.; Tiwari, V.; Parihar,
N.S.; Goswami, P.P. Identification and characterization of a gene encoding a
35-kDa protein from Mycobacterium avium subspecies paratuberculosis.
FEMS Microbiology Letters. Mar 15, 2001; 196(2): 195-199. ISSN:
0378-1097.
NAL Call No.:
QR1.F44
Abstract: Mycobacterium
avium subspecies paratuberculosis is the causative agent in
Johne's disease, a chronic enteritis in ruminants. A gene homologous to that of
35-kDa antigen of Mycobacterium leprae was cloned and sequenced from
Mycobacterium paratuberculosis. The database searches revealed 82.79%
and 95.67% similarities of its nucleotide sequence, with those of immunodominant
35-kDa protein of M. leprae and M. avium, respectively.
Descriptors: Mycobacterium avium subsp.
paratuberculosis, Johne's disease, ruminant enteritis,
Mycobacterium leprae, nucleotide sequence comparison.
Bannantine, John P.; Stabel, Judith R. Identification of two Mycobacterium avium
subspecies paratuberculosis gene products differentially recognised by
sera from rabbits immunised with live mycobacteria but not heat-killed
mycobacteria. Journal of Medical Microbiology. September, 2001;
50(9): 795-804. ISSN: 0022-2615.
NAL Call No.:
QR1.J62
Descriptors: Csp1 was
present in infected macrophages, novel antigens, pathogenesis.
Bannantine, J. P.; Zang, Q.; Li, L.; Kapur, V. Identification of unique regions within two
genetically similar mycobacterial genomes. Abstracts of the General
Meeting of the American Society for Microbiology. 2001; 101: 703-704. ISSN:
1060-2011. Note: 101st General Meeting of the American Society for Microbiology,
Orlando, FL, USA, May 20-24, 2001.
NAL
Call No.: QR1.A5
Descriptors:
Mycobacterium avium subsp. avium, Mycobacterium
avium subsp. paratuberculosis, homology of genomes, non-aligned
sequences 7 and 481, mycobacteriophage, possible application for diagnostic
tests.
Beard, P. M.; Stevenson, K.; Pirie, A.; Rudge, K.; Buxton, D.; Rhind, S. M.;
Sinclair, M. C.; Wildblood, L. A.; Jones, D. G.; Sharp, J. M. Experimental paratuberculosis in calves following
inoculation with a rabbit isolate of Mycobacterium avium subsp.
paratuberculosis. Journal of Clinical Microbiology.
2001; 39(9): 3080-3084. ISSN: 0095-1137.
NAL Call No.:
QR46.J6
Descriptors: rabbits as reservoir of
Mycobacterium avium subsp. paratuberculosis, Scotland,
experimental infection of calves with rabbit strain, strain virulence, wildlife
reservoir potential of rabbits, factors for control measures.
Beard, P. M.; Rhind, S. M.; Buxton, D.; Daniels, M. J.; Henderson, D.; Pirie,
A.; Rudge, K.; Greig, A.; Hutchings, M. R.; Stevenson, K.; Sharp, J. M. Natural paratuberculosis infection in rabbits in
Scotland. Journal of Comparative Pathology. May 2001; 124(4):
290-299. ISSN: 0021-9975.
NAL Call No.: 41.8 J82
Descriptors: 110 rabbits tested, Oryctolagus
cuniculus, pathology, Mycobacterium avium subsp.
paratuberculosis, histopathological lesions, granulomata, giant cells,
formalin fixed, paraffin wax embedded tissues.
Beard, P.M.; Daniels, M.J.; Henderson, D.; Pirie, A.; Rudge, K.; Buxton, D.;
Rhind, S.; Greig, A.; Hutchings, M.R.; McKendrick, I.
Paratuberculosis infection of nonruminant wildlife in
URL: http://www.pubmedcentral.gov/articlerender.fcgi?artid=87963
NAL
Call No.:
QR46.J6
Descriptors: Mycobacterium avium subsp. paratuberculosis, epidemiology wild life
species, reservoir hosts,
Belloli, Angelo; Carli, Silvano; Pravettoni, Davide; Proverbio, Daniela;
Giangaspero, Massimo; Lauzi, Stefania; Bonizzi, Luigi. Case study: Attempted treatment of a cow with
Mycobacterium paratuberculosis enterocolitis. Bovine
Practitioner. January 2001; 35(1): 56-60. ISSN: 0524-1685. Note: In English
with French and English summaries.
NAL Call No.:
SF779.5.A1B6
Descriptors: Holstein-Friesian dairy
cow, naturally infection, Mycobacterium avium subsp.
paratuberculosis, enterocolitis, oral treatment rifampin, pyrazinamide
and streptomycin for 7 days, fecal sampling, effects in populations of
Mycobacterium avium subsp. paratuberculosis.
Boor, Kathryn J. Fluid dairy product quality
and safety: Looking to the future. Journal of Dairy Science.
January 2001; 84(1): 1-11. ISSN: 0022-0302.
URL: http://www.ADSA.org/jds
NAL
Call No.: 44.8
J822
Descriptors: milk based beverages,
food safety, shelf life, control of contamination, thermal resistance
characteristics, Mycobacterium avium
subsp. paratuberculosis.
Brugere-Picoux, J.; Maillard, R.; Douart, A. Pathologie digestive bovine
paratuberculose: quels tests de diagnostic utiliser? [Pathology of bovine paratuberculosis:
which diagnostic tests to use?]
Point Veterinaire. 2001; 32(220): 50-53. ISSN: 0335-4997. Note: In French with an English summary.
Descriptors: Mycobacterium avium subsp. paratuberculosis, diagnosis, discussion
of various diagnostic techniques.
Brugere-Picoux, J.; Maillard, R.; Douart, A. Pathologie digestive des ruminants: etude
clinique de la paratuberculose bovine.
[Digestive pathology of ruminants: clinical study of bovine
paratuberculosis.] Point Veterinaire. 2001; 32(220): 20-22. ISSN: 0335-4997. Note: In French with an English summary.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, lesions, clinical
aspects, laboratory diagnosis, paratuberculosis.
Burton, Michael S.; Olsen, John H.; Ball, Ray L.; Dumonceaux, Genevieve A.
Mycobacterium avium subsp.
paratuberculosis infection in an addax (Addax
nasomaculatus). Journal of Zoo and Wildlife Medicine. June
2001; 32(2): 242-244. ISSN: 1042-7260.
NAL Call No.: SF601
J6
Descriptors: Addax nasomaculatus, captive bred
male addax, Mycobacterium avium subsp. paratuberculosis, fecal
sample, serology, semen culture, tissue biopsy, ileum, jejunum, colon,
mesenteric lymph node.
Caracappa, S.; Calabro, A.; Cassata, G.; Ferrantelli, V.; Dara, S.; Cascone,
G.; Vullo, S.;
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, level of disease
incidence, zoonotic potential,
Chamberlin, W.; Graham, D. Y.; Hulten, K.; El Zimaity, H. M. T.; Schwartz, M.
R.; Naser, S.; Shafran, I.; El Zaatari, F. A. K. Review article: Mycobacterium avium subsp.
paratuberculosis as one cause of Crohn's disease. Alimentary
Pharmacology and Therapeutics. March 2001; 15(3): 337-346. ISSN:
0269-2813.
Descriptors: etiology, zoonotic disease
potential, possible cause of Crohn’s disease, review of the literature.
Cheville, N. F.; Hostetter, J.; Thomsen, B. V.; Simutis, F.; Vanloubbeeck,
Y.; Steadham, E. Intracellular trafficking of
Mycobacterium avium ss. paratuberculosis in
macrophages. DTW Deutsche Tieraerztliche Wochenschrift. June 2001;
108(6): 236-243. ISSN: 0341-6593. Note: In English with English and Germany
summaries.
NAL Call No.: 41.8 D482
Descriptors:
Johne’s disease, cattle, bacterial growth in macrophages,
immunocytochemical markers for light, confocal and electron microscopy,
bacterial attachment, phagosomal acidification, phagolysosomal degradation and
apoptosis, blockage of phagosomes, nude mouse model, bacteriophorous vacuole
formation.
Chi JunWook; Weersink, A.; Van Leeuwen, J.A.; Keefe, G.P.
The economics of controlling infectious diseases on dairy farms. Working Paper Department of Agricultural
Economics and Business,
Descriptors: dairy farms, cost
effective disease control, theoretical model on economics of livestock disease,
empirical model for optimal set of control strategies, 4 diseases, bovine viral
diarrhea, enzootic bovine leucosis, Johne's disease, and neosporosis, direct
production losses, control expenditures (based on Maritime provinces, new animal
check, adequate vaccinations, Canada.
Christensen, J.; Dantzer, V. Panel discussion. In: Elvander, M.; Lindberg, A.; Christensen,
B. Acta Veterinaria Scandinavica,
Supplementum. 2001; (supp. 94):
95. ISSN: 0065-1699.
NAL Call No.: 41.8 AC87
Suppl.
Descriptors: Johne’s disease, Mycobacterium avium subsp. paratuberculosis, animal diseases,
diagnostic techniques, disease prevalence, disease prevention, documentation,
monitoring, paratuberculosis, risk assessment, surveillance,
Collett, M.G.; West, D.M. A comparison of the injection site and
draining lymph node pathology induced by an attenuated live and a killed Johne's
disease vaccine in sheep. In:
Proceedings of the 5th
International Sheep Veterinary Conference,
Descriptors: ewes, sheep, lambs,
vaccinated with live-attenuated Mycobacterium avium subsp. paratuberculosis vaccine, injection
site, draining lymph node, histopathology.
Collins, Michael T.; Lisby, Gorm; Moser, Claus; Chicks, Debra; Christensen,
Steen; Reichelderfer, Mark; Hoiby, Niels; Harms, Bruce A.; Thomsen, Ole O.;
Skibsted, Ulrik; Binder, Vibeke. Results of
multiple diagnostic tests for Mycobacterium avium subsp.
paratuberculosis in patients with inflammatory bowel disease and in
controls. Journal of Clinical Microbiology. December 2001; 38(12):
4373-4381. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors: diagnostic tests compared, 5 methods routinely
used on animals, PCR for IS900, etiopathogenesis of IBD.
Corn, Joseph L.; Nettles, Victor F. Health
protocol for translocation of free-ranging elk. Journal of Wildlife
Diseases. July 2001; 37(3): 413-426. ISSN: 0090-3558.
NAL Call
No.: 41.9 W64B
Descriptors: elk, Cervus
elaphus, restoration programs, issues of translocation, disease concerns,
health status, classification of infectious agents and ectoparasites, ability to
establish disease in new area, potential damage to wildlife in new area, list of
many diseases and parasites, including Mycobacterium avium subsp.
paratuberculosis.
Council for Agricultural Science and Technology. Johne's disease in cattle.
Issue Paper Council for Agricultural Science and Technology. 2001; (17): 1-10.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, etiology, clinical
aspects, diagnosis, disease control, vaccination, disease transmission,
treatment.
Coussens, P. M.; Tooker, B.; Nobis, W.; Coussens, M. J. Genetics and genomics of susceptibility to
mycobacterial infection in cattle. Journal of Dairy Science. 2001;
84(Suppl. 1): 57. ISSN: 0022-0302. Note: Joint Meeting of the American Dairy
Science Association, American Meat Science Association, American Society of
Animal Science and the Poultry Science Association, Indianapolis, Indiana, USA,
July 24-28, 2001.
URL: http://www.ADSA.org/jds
NAL Call
No.: SF221 A4
Descriptors: cattle, susceptibility
to disease factors, breeding, genetics, genomics, Mycobacterium bovis,
Mycobacterium avium subsp. paratuberculosis.
Coussens, Paul M. Mycobacterium
paratuberculosis and the bovine immune system. Animal Health
Research Reviews. December 2001; 2(2): 141-161. ISSN: 1466-2523.
NAL Call No.:
SF601.A547
Descriptors:
cattle, immunity, pathology, Johne's disease, immune response.
Cuteri, V.; Morgante, M.; Ranucci, S.; Valente, C. Use of an indirect ELISA for the diagnosis
of paratuberculosis in alpaca (Lama
pacos). In: Gerken, M.; Renieri, C. [Editors]. Progress in South American Camelids
Research. Proceedings of the
3rd European Symposium
and SUPREME European Seminar,
NAL Call No.: 49.9 EU7 no. 105
Descriptors: alpacas, Mycobacterium avium subsp. paratuberculosis, Mycobacterium phlei, diagnosis, indirect
ELISA, paratuberculosis.
Daniels, M.J.; Ball, N.; Hutchings, M.R.; Greig, A. The grazing response
of cattle to pasture contaminated with rabbit faeces and the implications for
the transmission of paratuberculosis. Veterinary Journal. May 2001;
161(3): 306-313. ISSN: 1090-0233.
NAL Call No.: SF601.V484
Abstract: Transmission of Mycobacterium avium
subspecies paratuberculosis, the organism responsible for paratuberculosis
(or Johne's disease) in ruminants, occurs through the faecal-oral route. As
M. a. paratuberculosis has been isolated from rabbit faeces, cattle
grazing rabbit faecal contaminated pasture may thus be at risk. A herd of 57
beef cattle was monitored on a farm in Perthshire, throughout the 1999 'grazing
year', to investigate whether the cattle avoided rabbit faecal contaminated
pasture and thus the potential for disease transmission. Grazing was measured
every two days over eight rotations by sward heights on 40 marked treatment
plots (0.5 m X 0.5 m) to which 0, 10, 50 and 250 rabbit faecal pellets were
added. Cattle were also monitored by an active transponder system which enabled
individual animals contacting two plots per field rotation (one control and one
contaminated) to be recorded. During the monitored grazing year, grazing
pressure was low with a net mean sward offtake of 18% of sward height per
rotation. There were no significant differences between rabbit faecal treatments
(0, 10, 50 and 250 pellets) with respect to the height or proportion of sward
removed, or between the numbers of contacts made by cattle on contaminated and
uncontaminated plots. Over 90% of all the cattle contacted contaminated plots,
indicating that the potential for disease transmission was widespread among the
herd. To our knowledge, this is the first reported instance of a lack of
avoidance by grazing cattle towards swards contaminated with faeces, and implies
that the potential for transmission of paratuberculosis from rabbit contaminated
pasture is high.
Descriptors: beef cattle, Johne's disease,
grazing behavior, pastures, rabbit fecal droppings, microbial contamination,
disease transmission, paratuberculosis, Mycobacterium avium subsp.
paratuberculosis, disease transmission risk, Scotland.
Dargatz, David A.; Byrum, Beverly A.; Barber, Linda K.; Sweeney, Raymond W.;
Whitlock, Robert H.; Shulaw, William P.; Jacobson, Richard H.; Stabel, Judith R.
Evaluation of a commercial ELISA for diagnosis
of paratuberculosis in cattle. Journal of the American Veterinary
Medical Association. April 1, 2001; 218(7): 1163-1166. ISSN:
0003-1488.
NAL Call No.: 41.8 Am3
Descriptors:
evaluate sensitivity and specificity, new ELISA for antibodies,
Mycobacterium avium subsp. paratuberculosis, serum samples,
cattle, level of test sensitivity and reliability, interpretation of test
results.
Dargatz, David A.; Byrum, Beverly A.; Hennage,r Steven G.; Barber, Linda K.;
Kopral, Christine A.; Wagner, Bruce A.; Wells, Scott J. Prevalence of antibodies against Mycobacterium
avium subsp. paratuberculosis among beef cow-calf herds.
Journal of the American Veterinary Medical Association. August 15, 2001;
219(4): 497-501. ISSN: 0003-1488.
NAL Call No.: 41.8 Am3
Descriptors: beef cattle, levels of infection, 380 US herds
in 21 states, serum testing for antibodies, ELISA, herd management practices,
rather low rate of infection.
Diego, J.V.; Benito, V.F.; Garcia, R.S. Proyecto Caprino Entre Sierras. Goat project in the mountains. Medicina Veterinaria. 2001; 18(4): 382-393. ISSN: 0212-8292. Note: In Spanish with an English summary.
Descriptors: goats, sheep, mixed and
non-mixed herds, 494 serum samples, surveyed for antibodies to Mycobacterium avium subsp. paratuberculosis, Mycobacterium bovis, high prevalence for
both diseases found.
Dimareli, Malli Z.; Sarris, K. Comparison of
DNA probe test and cultivation methods for detection of Mycobacterium
avium subsp. paratuberculosis in caprine and ovine faeces.
Australian Veterinary Journal. January 2001; 79(1): 47-50. ISSN:
0005-0423.
NAL Call No.: 41.8 Au72
Descriptors:
3 detection methods compared, DNA probe, double incubation method,
conventional culture method, Herrold's medium, goats, sheep, fecal sampling,
levels of sensitivity, use in control measures.
Dominguez, M.C.; Chavez, G.; Trigo, F.J.; Rosales, M.L. Concurrent cholangiocarcinoma, peritonitis,
paratuberculosis, and aspergillosis in a goat. Canadian Veterinary Journal. 2001; 42(11): 884-885. ISSN: 0008-5286. Note: In English with a French summary.
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: 1 goat, case report,
diagnosis, concurrent infections, organ sampling, intestines, liver, lungs,
neoplasms, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, peritonitis,
aspergillosis, Aspergillus
fumigatus.
Douart, A.; Maillard, R. Etiologie et epidemiologie de la
paratuberculose bovine. [Etiology
and epidemiology of bovine paratuberculosis.] Point Veterinaire. 2001; 32(219): 38-42. ISSN: 0335-4997. Note: In French with an English summary.
Descriptors: cattle, etiology,
epidemiology, Mycobacterium avium
subsp. paratuberculosis.
Dundee, L.; Grant, I. R.; Ball, H. J.; Rowe, M. T. Comparative evaluation of four decontamination
protocols for the isolation of Mycobacterium avium subsp.
paratuberculosis from milk. Letters in Applied
Microbiology. September 2001; 33(3): 173-177. ISSN: 0266-8254.
NAL Call No.: QR1.L47
Descriptors:
spiked milk, 4 chemical decontamination protocols, (1)
hexadecylpyridinium chloride (HPC) for 5 h; (2) and (3) Cornell methods
employing brain heart infusion broth containing 0.75% (w/v) and 0.9% (w/v) HPC,
respectively; and (4) a C18-carboxypropylbetaine (CB-18TM) method, evaluation of
effectiveness and suitability.
Dupont, Chris; Murray, Alan. Identification,
cloning and expression of sodC from an alkaline phosphatase gene fusion library
of Mycobacterium avium subsp. paratuberculosis.
Microbios. 2001; 106(Suppl. 1): 7-19. ISSN: 0026-2633.
NAL
Call No.: QR1 M54
Descriptors: phoA gene
technology, sodC gene, copper and zinc cofactored superoxide dismutase,
recombinant protein, enzymatic activity.
Eamens, G.J.;
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: cattle, Mycobacterium paratuberculosis,
survival, amitraz dips, disease transmission,
El Zaatari, Fouad A. K.; Osato, Michael S.; Graham, David Y. Etiology of Crohn's disease: The role of
Mycobacterium avium paratuberculosis. Trends in Molecular
Medicine. June 2001; 7(6): 247-252. ISSN: 1471-4914.
Descriptors:
causal organism, Crohn’s disease, detection of IS900, PCR, situ
hybridization in tissues, serologic immune response to Mycobacterium
avium subsp. paratuberculosis antigens.
Ellingson, Jay L. E.; Stabel, Judith R. Species-specific genetic identification of
Mycobacterium paratuberculosis. Official Gazette of the
United States Patent and Trademark Office Patents. [e-file] Aug. 21, 2001; 1249(3): No
Pagination. ISSN: 0098-1133.
NAL Call No.: T223.A21
Abstract: An M. paratuberculosis gene referred to
as hspX provides a useful target region for the construction of suitable probes
and primers that are species-specific for distinguishing M.
paratuberculosis from related mycobacteria in a test sample. M.
paratuberculosis is the causative agent of Johne's disease and has been
isolated from human patients with Crohn's disease.
Descriptors:
hspX gene, possible target region for probes and primers, for possible
diagnostic method.
Elvander, M.; Lindberg, A.; Christensen, B. [Editors] Proceedings of the 13th Nordic Committee
for Veterinary Scientific Cooperation (NKVet) Symposium on National Disease
Control in Farmed Animals, Stockholm, Sweden, 1-2 October 1999. Acta Veterinaria Scandinavica,
Supplementum. 2001; (supp. 94):
102 p. ISSN: 0065-1699.
NAL Call No.: 41.8 AC87
Suppl
Descriptors: cattle, mink, fish,
pigs, poultry, a variety of topics on animal health and disease, disease
recording, effects of industrial infrastructure, species specific surveillance
strategies, diseases include Mycobacterium avium subsp. paratuberculosis, rabies, Salmonella, various viral diseases,
Iceland, Scandinavia.
Englund, S.; Bolske, G.; Ballagi, Pordany A.; Johansson, K. E. Detection of Mycobacterium avium subsp.
paratuberculosis in tissue samples by single, fluorescent and nested
PCR based on the IS900 gene. Veterinary Microbiology. August 8,
2001; 81(3): 257-271. ISSN: 0378-1135.
NAL Call No.:
SF601.V44
Descriptors: detection method,
comparison of PCR methods, pluses and minuses of methods discussed.
Eppleston, J.; Simpson, G. The impact of ovine Johne's disease (OJD)
in an endemic area. In: Proceedings of the 5th
International Sheep Veterinary Conference,
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis mortality, survival,
impact on flocks,
Eppleston, J.; Whittington, R.J. Isolation of Mycobacterium avium subsp paratuberculosis from the semen of rams
with clinical Johne's disease.
Australian Veterinary
Journal. 2001; 79 (11):
776-777. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: sheep, rams, Mycobacterium avium subsp. paratuberculosis, isolation, semen, disease transmission.
Fischer, O.; Matlova, L.; Dvorska, L.; Svastova, P.; Bartl, J.; Melicharek,
I.; Weston, R. T.; Pavlik, I. Diptera as vectors
of mycobacterial infections in cattle and pigs. Medical and Veterinary
Entomology. June 2001; 15(2): 208-211. ISSN: 0269-283X.
NAL Call
No.: RA639.M44
Descriptors: 7791 adult Diptera,
cattle herds and pig herds with mycobacterial infections, Mycobacterium
intracellulare, Mycobacterium avium ssp. avium (serotype
8), Mycobacterium avium ssp.avium (serotype 8),
Drosophila, Musca, Mycobacterium fortuitum, Mycobacterium scrofulaceum,
Mycobacterium phlei, Scatophaga Meigen, Calliphora vicina
Robineau-Desvoidy, Lucilia Caesar, Stomoxys calcitrans, infected flies
role in spreading disease.
Ghobrial, G.; Naser, S. A. In vitro
evaluation of nicotine effect on mycobacterial growth. Abstracts of
the General Meeting of the American Society for Microbiology. 2001; 101: 704. ISSN: 1060-2011.
Note: 101st General Meeting of the American Society for Microbiology, Orlando,
FL, USA, May 20-24, 2001.
NAL Call No.: QR1.A5
Descriptors: alkaloid treatment, various nicotine
concentrations, effect on Mycobacterium avium subsp. avium,
Mycobacterium avium subsp. paratuberculosis, Mycobacterium
intracellulare, Mycobacterium
smegamtis, and Mycobacterium
tuberculosis, strains H37Ra and ATCC 2577, potential therapeutic
application.
Goethe, R.; Jeckstadt, S.; Kuehnel, M.; zur Lage, S.; Weiss, S.; Valentin,
Welgand P. Modulation of macrophage functions by
Mycobacterium avium ssp. paratuberculosis.
Biology of the Cell. October 2001; 93(3-4): 211. ISSN: 0248-4900. Note:
First Joint French-German Congress on Cell Biology, Strasbourg, France, November
07-09, 2001.
NAL Call No.: QH201.J6
Descriptors: bacterial pathogen behavior, impacts on immune
system, white blood cells.
Gous, T.A.; Michel, A.L. Johne's disease in sheep in
Descriptors: sheep, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, disease prevalence,
epidemiology, incidence of disease,
Grant, I. R.; O' Riordan, L. M.; Ball, H. J.; Rowe, M. T. Incidence of Mycobacterium paratuberculosis
in raw sheep and goats' milk in England, Wales and Northern Ireland.
Veterinary Microbiology. March 20, 2001; 79(2): 123-131. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors:
sheep and goats, milk samples, assay, Johne’s disease status, risks,
Mycobacterium avium
subsp. paratuberculosis.
Grant, Irene R.; Rowe, Michael T.; Dundee, Louise; Hitchings, Edward. Mycobacterium avium ssp.
paratuberculosis: Its incidence, heat resistance and detection in milk
and dairy products. International Journal of Dairy Technology.
February 2001; 54(1): 2-13. ISSN: 1364-727X.
NAL Call No.:
SF221.I58
Descriptors: Johne’s disease, Crohn’s
disease, possible food borne disease, contaminated dairy products, pasteurized
milk, need for research on milk processing and on farm prevention.
Groenendaal, H.; Nielen, M.; Hesselink, J.W. Development of the Dutch
Johne's disease control programme supported by a simulation model.
Proceedings of a Meeting, Society for Veterinary Epidemiology and
Preventive Medicine. [Great Britain]: The Society, 1983. 2001; 141-152.
ISSN: 0956-7496. Note: Meeting held on March 28-30, 2001, Noordwijkerhout, The
Netherlands.
NAL Call No.:
SF780.9.S63
Descriptors: paratuberculosis,
control programs, simulation models, Johne's disease, Mycobacterium avium
subsp. paratuberculosis, The Netherlands.
Gwozdz, J. M.; Thompson, K. G.; Manktelow, B. W. Lymphocytic neuritis of the ileum in sheep with
naturally acquired and experimental paratuberculosis. Journal of
Comparative Pathology. May 2001; 124(4): 317-320. ISSN: 0021-9975.
NAL Call No.: 41.8 J82
Descriptors:
sheep, mononucleate inflammatory cells, ileal submucosa, lesions,
experimental infection, Mycobacterium avium
subsp. paratuberculosis.
Harris, Janet E.; Lammerding, Anna M. Crohn's
disease and Mycobacterium avium
subsp. paratuberculosis: Current issues. Journal of
Food Protection. December 2001; 64(12): 2103-2110. ISSN: 0362-028X.
NAL Call No.: 44.8 J824
Descriptors:
human health risks, exposure to contaminated milk, Johne’s disease,
etiology of Crohn’s disease, food risk communication.
Harris, N. Beth; Barletta, Raul G. Mycobacterium avium
subsp. paratuberculosis in veterinary medicine.
Clinical Microbiology Reviews. July 2001; 14(3): 489-512. ISSN:
0893-8512.
NAL Call No.: QR67.C54
Descriptors:
bacterial disease, clinical signs, diagnosis, treatment, necropsy.
Hermon-Taylor, J. Mycobacterium avium subspecies paratuberculosis: the nature of the
problem. Food Control. 2001; 12(6): 331-334. ISSN: 0956-7135.
NAL Call
No.:
TP372.7.F66
Descriptors: Mycobacterium avium, Mycobacterium avium subsp. paratuberculosis, cattle diseases,
chronic infections, bacterial diseases, excretion, disease transmission,
zoonotic diseases, human diseases, inflammation, intestinal diseases, Crohn's
disease, drug resistance.
Hughes, V. M.; Stevenson, K.; Sharp, J. M. Improved preparation of high molecular weight DNA for
pulsed-field gel electrophoresis from mycobacteria. Journal of
Microbiological Methods. April 2001; 44(3): 209-215. ISSN: 0167-7012.
NAL Call No.: QR65.J68
Descriptors:
epidemiology, clonal identity of bacterial, difficulty of getting
quality genomic DNA, various species in from stirred cultures tested,
standardized method, typing method, Mycobacterium avium, Mycobacterium avium
subsp. paratuberculosis, Mycobacterium bovis, Mycobacterium
malmoense, Mycobacterium phlei strain NCTC-8151 Mycobacterium
smegmatis strain NCTC-8159, Mycobacterium terrae strain NCTC-9259,
Mycobacterium tuberculosis strain NCTC-14323.
Huntley, J. F. J.; Stabel, J. R.; Bannantine, J. P. Expression library immunization of mice identified
five genomic DNA clone pools that are protective against colonization with
Mycobacterium
avium subsp. paratuberculosis. Abstracts of the General
Meeting of the American Society for Microbiology. 2001; 101: 710. ISSN:
1060-2011. Note: 101st General Meeting of the American Society for Microbiology,
Orlando, FL, USA, May 20-24, 2001.
NAL Call No.: QR1.A5
Descriptors: Johne's disease, Mycobacterium avium
subsp. paratuberculosis, 78 gene pools, PCR, C57BL/6J mice (6
week old, male, 20 grams), immunized, abdominal inoculation, each clone pool via
gene gun delivery, live bacteria challenge, effectiveness of vaccinations.
Inglis, Neil F.; Stevenson, Karen; Davies, Richard C.; Heaslip, Darragh G.;
Sharp, J. Michael. Unique expression of a highly
conserved mycobacterial gene in IS901+ Mycobacterium avium.
Microbiology. June 2001; 147(6): 1557-1564. ISSN: 1350-0872.
NAL Call No.: QR1.J64
Nucleotide
Sequence: AF247653 GenBank nucleotide sequence.
Descriptors:
novel protein antigen, p40 gene, strain differences, nucleotide
sequence analysis, Mycobacterium avium, Mycobacterium avium
subsp. paratuberculosis, Mycobacterium. bovis, Mycobacterium
leprae, Mycobacterium smegmatis, Mycobacterium tuberculosis, putative
promoter region, livestock and bird strains.
Johnson, Y. J.; Kaneene, J. B.; Gardiner, J. C.; Lloyd, J. W.; Sprecher, D.
J.; Coe, P. H. The effect of subclinical
Mycobacterium paratuberculosis infection on milk production in Michigan
dairy cows. Journal of Dairy Science. October 2001; 84(10):
2188-2194. ISSN: 0022-0302.
NAL Call No.: 44.8 J822
Descriptors: cattle, Mycobacterium avium
subsp. paratuberculosis, subclinical diagnosis, milk, protein,
fat production, fecal culture, effect of parity on milk production, Michigan,
United States.
Kaba, J. Epidemiology of caprine arthritis
encephalitis, paratuberculosis and caseous lymphadenitis in goats in
Descriptors: goats, epidemiological
surveys for diseases, caprine arthritis encephalitis virus, Lentivirus, Mycobacterium avium subsp. paratuberculosis, lymphatic diseases,
Johne’s diseases, disease transmission,
Kalis, Cees H. J.; Hesselink, Jan Willem; Barkema, Herman W.; Collins,
Michael T. Use of long-term vaccination with a
killed vaccine to prevent fecal shedding of Mycobacterium avium
subsp. paratuberculosis in dairy herds. American
Journal of Veterinary Research. February 2001; 62(2): 270-274. ISSN:
0002-9645.
NAL Call No.: 41.8 Am3A
Descriptors:
dairy cows, vaccination of calves with killed vaccine, level of fecal
shedding after vaccination, prevention and control method, compared to culture
and cull, 58 Dutch dairy herds, lack of efficacy, The Netherlands.
Katayama, Nobuya; Tanaka, Chigusa ; Fujita, Takumi; Suzuki, Takumi; Watanabe,
Shigeyuki; Suzuki, Shuka. Effects of silage
fermentation and ammonia treatment on activity of Mycobacterium avium
subsp. paratuberculosis. Grassland Science. August
2001; 47(3): 296-299. ISSN: 0447-5933. Note: In Japanese with English and
Japanese summaries.
NAL Call No.: 60.9 J27
Descriptors: silo moisture and acidity, storage and
survivability, moisture, ammonia treated silages, organic acid, high pH, pouched
silages, alfalfa hay, grass and forage crops, feed contamination control.
Kennedy, D. J.; Benedictus, G. Control of
Mycobacterium avium
subsp. paratuberculosis infection in agricultural
species. Revue Scientifique et Technique Office International des
Epizooties. April 2001; 20(1): 151-179. ISSN: 0253-1933. Note: In English
with English, French and Spanish summaries.
NAL Call No.:
SF781.R4
Descriptors: livestock, prevention and
control programs, surveillance, issues and concerns of designing and
implementing a program, costs of programs, epidemiology, diagnostic tools.
Kennedy, D. J.; Allworth, B. Ovine Johne's
disease: Progress and challenges. Australian Veterinary Journal.
July 2001; 79(7): 482-483. ISSN: 0005-0423.
NAL Call No.:
41.8 Au72
Descriptors: sheep, Mycobacterium avium
subsp. paratuberculosis, epidemiology, prevention and control
concerns.
Kim YongHwan; Al Haddawi, M.H.; Cho HoSeong; Kang SungKwi; Cho KyoungOh; Park
HyungSeon; Lee BongJoo; Park NamYong.
Multiplex PCR for differential
diagnosis of Mycobacterium species
from bovine clinical samples. Korean Journal of Veterinary Research.
2001; 41(4): 535-542. ISSN: 1225-0198. Note: In Korean with an English summary.
Descriptors: field cattle, multiplex
PCR, detection assay, Mycobacterium
bovis, Mycobacterium
tuberculosis, Mycobacterium
avium, Mybacterium avium subsp. paratuberculosis, blood sample,
positive and negative intradermal tuberculin test, may be a rapid, sensitive,
and specific tool for differential identification of mycobacterial strains,
1step assay.
Klawonn, W.; Draeger, K.; Guetler, S.; Zimmer, K.; Hess, R. G.; Baumgartner,
W. Zur Eignung verschiedener kommerziell
erhaeltlicher ELISA-Systeme fuer den Antikoerpernachweis bei Mycobacterium avium
subsp. paratuberculosis-ausscheidenden Tieren. [Evaluation of
various ELISA kits for the detection of antibodies to Mycobacterium avium
subsp. paratuberculosis in cattle. ] Tieraerztliche
Umschau. December 1, 2001; 56(12): 648-654. ISSN: 0049-3864. Note: In
German.
NAL Call No.: 41.8 T445
Descriptors:
cows, fecal secretors, Mycobacterium avium
subsp. paratuberculosis, IDEXX/CSL ELISA, HerdCheck ELISA,
Svanovir ELISA, ELISA from PourQuier Institute, antibody testing, test
sensitivity and reliability, results compared, control programs.
Klijn, N.; Herrewegh, A. A. P. M.; de Jong, P. Heat inactivation data for Mycobacterium avium
subsp. paratuberculosis: Implications for interpretation.
Journal of Applied Microbiology. October 2001; 91(4): 697-704. ISSN:
1364-5072.
NAL Call No.: QR1 J687
Descriptors:
factors for future research, calculated heat inactivation, modeling and
inactivation curve of Mycobacterium avium
subsp. paratuberculosis, cell clumping, food safety testing.
Koehler, H.; Gyra, H.; Zimmer, K.; Draeger, K. G.; Burkert, B.; Lemser, B.;
Hausleithner, D.; Cussler, K.; Klawonn, W.; Hess, R. G. Immune reactions in cattle after immunization with a
Mycobacterium paratuberculosis vaccine and implications for the
diagnosis of M. paratuberculosis and M. bovis
infections. Journal of Veterinary Medicine Series B. April 2001;
48(3): 185-195. ISSN: 0931-1793.
NAL Call No.: 41.8 Z52
Descriptors: calves, experimental immunization, live
modified Mycobacterium
avium subsp. paratuberculosis vaccine, shedding, tuberculin
skin test, diagnostic tests, antibody enzyme linked immunosorbent assay,
interferon-gamma test, polymerase chain reaction, interferon-gamma production,
check for infection.
Koets, Ad P.; Rutten, Victor P. M. G.; deBoer, Masja; Bakker, Douwe;
Valentin, Weigand, Peter; van Eden, Willem. Differential changes in heat shock protein-,
lipoarabinomannan-, and purified protein derivative-specific immunoglobulin G1
and G2 isotype responses during bovine Mycobacterium avium
subsp. paratuberculosis infection. Infection and
Immunity. March 2001; 69(3): 1492-1498. ISSN: 0019-9567.
NAL
Call No.: QR1.I57
Descriptors: cattle, changes
from asymptomatic to clinical stage, serological responses, immune
responsiveness, IgG1, IgG2, Hsp70, Hsp65.
Le Tallec, B.; Ponsart, C.; Marquant-Leguienne, B.; Guerin, B. Risks of transmissible diseases in relation
to embryo transfer. Reproduction, Nutrition, Development.
2001; 41(5): 439-450.
NAL Call No.: QL1.R35
Descriptors: risks of disease
transmission of Mycobacterium avium
subsp. paratuberculosis, embryos,
transfer of embryos process, sperm ova, preventive measures
recommended.
Lee, H.; Stabel, J. R.; Kehrli, M. E. Jr. Cytokine gene expression in ileal tissues of cattle
infected with Mycobacterium paratuberculosis. Veterinary
Immunology and Immunopathology. September 28, 2001; 82(1-2): 73-85. ISSN:
0165-2427.
NAL Call No.: SF757.2.V38
Descriptors: cows, cattle, Mycobacterium avium
subsp. paratuberculosis, immune regulation impacts,
interleukin-1alpha (IL-1alpha), IL-1beta, IL-6, and interferon-gamma
(IFN-gamma), comparison between infected and non-infected animals.
Leitch, E. Carol McWilliam; Duncan, Sylvia H.; Stanley, Karen N.; Stewart,
Colin S. Dietary effects on the microbiological
safety of food. Proceedings of the Nutrition Society. May 2001;
60(2): 247-255. ISSN: 0029-6651.
NAL Call No.: 389.9 N953
Descriptors: rumen simulating fermentors, studying survival
of food borne pathogens, E. coli 0157:H7, Salmonella, Helicobacter
pylori, Mycobacterium paratuberculosis, Campylobacter, Listeria.
Lin YuTing; Pan HanEn; Tsai HsiangJung. Serological survey on the antibodies
against paratuberculosis in cows and goats and bluetongue disease in goats in
NAL Call No.:
SF604.C54
Descriptors: dairy cattle testing,
goats, serum ELISA kit, AGID, Mycobacterium avium subsp. paratuberculosis, bluetongue virus,
antibody testing,
Linnabary, Robert D. Johne's disease in cattle. Issue Paper (Council for Agricultural Science and
Technology). [2001]; no. 17, 10
p.
URL: http://www.cast-science.org
NAL Call No.: S441.I87 no. 17
Descriptors: livestock, cattle, Mycobacterium avium subsp. paratuberculosis, issue paper,
diagnosis, disease control.
Liu, X.; Feng, Z.; Harris, N.B.; Cirillo, J.D.; Bercovier, H.; Barletta, R.G.
Identification of a secreted superoxide dismutase in Mycobacterium avium
subsp. paratuberculosis. FEMS Microbiology
Letters. Aug 21, 2001; 202(2): 233-238. ISSN: 0378-1097.
NAL Call No.: QR1.F44
Abstract: Mycobacterium avium
subsp. paratuberculosis (M. paratuberculosis), the
causative agent of Johne's disease, is an important animal pathogen that has
also been implicated in human disease. The major proteins expressed by M.
paratuberculosis were analyzed by two-dimensional gel electrophoresis, and
a superoxide dismutase (Sod) was identified from this protein profile. The
M. paratuberculosis Sod has a molecular mass of 23 kDa and an
isoelectric point of 6.1. Sequence analysis of the corresponding sodA gene from
M. paratuberculosis indicates that this protein is a
manganese-dependent enzyme. We show that the M. paratuberculosis Sod is
actively secreted, suggesting that it may elicit a protective cellular immune
response in the host during infection.
Descriptors: Mycobacterium avium
subsp. paratuberculosis, Johne's disease, zoonoses, protein
analysis, superoxide dismutase, host immune response.
Lloyd, J.B.; Whittington, R.J.; Fitzgibbon, C.; Dobson, R. Presence of Mycobacterium avium subspecies paratuberculosis in suspensions of ovine
trichostrongylid larvae produced in faecal cultures artificially contaminated
with the bacterium. Veterinary Record. 2001; 148 (9): 261-263. ISSN:
0042-4900.
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.:
41.8 V641
Descriptors: sheep dung, Mycobacterium avium subsp. paratuberculosis, Haemonchus contortus,
Teladorsagia circumcincta, Trichostrongylus colubriformis, nematode
larvae, irradiation, viability, cell cultures, microbial
contamination.
Mahavir Singh; Siddiqui, M.Z.; Goswami, P.P. Detection of hybridomas specific for
recombinant antigen of Mycobacterium
paratuberculosis by ELISA.
Indian Journal of Comparative
Microbiology, Immunology and Infectious Diseases. 2001; 22(2): 181-182. ISSN: 0970-9320.
Descriptors: mice, Mycobacterium avium subsp. paratuberculosis, antibodies, B
lymphocytes, clones, diagnosis, indirect ELISA to detect intraspecies mice
hybridomas for recombinant 35 kDa antigen, immunological techniques, myeloma,
recombinant proteins, assay standardization.
Manning, E. J. B.; Collins, M. T. Mycobacterium avium
subsp. paratuberculosis: Pathogen, pathogenesis and
diagnosis. Revue Scientifique et Technique Office International des
Epizooties. April 2001; 20(1): 133-150. ISSN: 0253-1933. Note: In English
with English, French, and Spanish summaries.
NAL Call No.:
SF781.R4
Descriptors: domestic ruminants,
primates, rabbits, stoats, foxes, free ranging and captive wildlife, prevalence
in Europe, United States, herd size effects, Australia infections rates,
economic effects.
Manning, E.J.B. Mycobacterium avium subspecies paratuberculosis: a review of current
knowledge. Journal of Zoo and Wildlife Medicine.
2001; 32(3): 293-304. ISSN: 1042-7260. Note: A review article.
URL: http://www.bioone.org/perlserv/?request=get-document&doi=10.1638%2F1042-7260%282001%29032%5B0293%3AMASPAR%5D2.0.CO%3B2
NAL
Call No.:
SF601.J6
Descriptors: wild animals, animal diseases,
susceptibility, characteristics of Mycobacterium avium subsp. paratuberculosis bacteria, virulence, heat tolerance, effects of
ultraviolet radiation, photosensitivity, survival, pathogenesis, Johne’s disease
transmission, bacterial antigens, immune responses, subclinical and clinical
diagnosis, zoonotic diseases.
Marsh, I. B.; Whittington, R. J. Progress
towards a rapid polymerase chain reaction diagnostic test for the identification
of Mycobacterium
avium subsp. paratuberculosis in faeces.
Molecular and Cellular Probes. April 2001; 15(2): 105-118. ISSN:
0890-8508.
NAL Call No.: RB43.7.M63
Descriptors:
sheep, pooled fecal samples, diagnostic test evaluation, simpler direct
PCR technique using primers from the 5' region of IS900, Mycobacterium avium
subsp. paratuberculosis, hybridization capture polymerase chain
reaction (HC-PCR), level of sensitivity, flock diagnosis for Johne’s.
Martinez-Magana, P.; Camacho-Vallejo, M.E.; Villalba-Montoro, E.;
Gomez-Torrico, M.S.; Alferez-Callejon, B.; Gasca-Arroyo, A. Programa sanitario caprino en el Norte de
Cordoba
URL: http://www.uco.es/organiza/servicios/publica/az/az.htm
Descriptors: Murciana Granadina
goats, implementation of an animal health program made up of 2 subprograms,
mastitis control and milk purity, protection from paratuberculosis,
pseudotuberculosis and tuberculosis, genetic erosion,
Mason, O.; Marsh, I. B.; Whittington, R. J. Comparison of immunomagnetic bead
separation-polymerase chain reaction and faecal culture for the detection of
Mycobacterium avium
subsp. paratuberculosis in sheep faeces. Australian
Veterinary Journal. July 2001; 79(7): 497-500. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors:
fecal culture, sheep, detection methods, comparison study.
Miao, Z.H.; Glatz, P.C.; English, A.; Ru, Y.J. Managing fallow deer (Dama dama) and
NAL Call
No.:
SF405.5.A3
Descriptors: farmed deer industry and
production, husbandry, venison, deer velvet, housing, nutrition, behavior, rutt,
transport, restraint, common diseases, ticks, lice, and helminthic parasites (Dictyocaulus viviparus, Muellerius capillaris and Fasciola hepatica), protozoal diseases,
Babesia, bacterial diseases, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis, salmonellosis,
tuberculosis, clostridiosis, foot and mouth disease, malignant catarrhal fever,
current research, Australia.
Miltner, E.; Cirillo, J.; Bermudez, L. E. Identification of Mycobacterium avium genes
associated with the ability to invade intestinal epithelial cells.
Abstracts of the General Meeting of the American Society for
Microbiology. 2001; 101: 708. ISSN: 1060-2011. Note: 101st General Meeting
of the American Society for Microbiology, Orlando, FL, USA, May 20-24, 2001.
NAL Call No.: QR1.A5
Descriptors:
genes upregulated during binding and invasion of mucosal epithelial
cells, L5 phage promoter, clone evaluation for increased expression, ability to
invade Hep-2 epithelial cells, infection process.
Morgan, J. Organic lamb. Agnote NSW Agriculture. 2001; (DAI-233 (1st Edition)): 1-7. ISSN: 1034-6848.
Descriptors: lamb, animal breeding,
animal nutrition, bacterial diseases, Clostridia, Mycobacterium avium subsp. paratuberculosis, disease control, farm
management, treatment for internal and external parasites, helminthoses,
helminthes, liver flukes, mite control, blowfly strike, ovine Johne’s disease,
organic farming, certification as organic lamb, record keeping,
reviews.
Mukhopadhyay, H.K.;
NAL Call No.:
SF1.I4
Descriptors: 41 cattle,
Muskens, J.; Bakker, D.; de Boer, J.; van Keulen, L. Paratuberculosis in sheep: Its possible role in the
epidemiology of paratuberculosis in cattle. Veterinary
Microbiology. January 26, 2001; 78(2): 101-109. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors:
sheep, diagnosis of flock infection, Mycobacterium avium
subsp. paratuberculosis, shared sheep and cattle grazing,
biochemistry, serology, and intradermal testing, necropsy results, epidemiology,
disease transmission.
Mutwiri, G.K.; Kosecka, U.; Benjamin, M.; Rosendal, S.; Perdue, M.;
NAL Call No.: SF77.C65
Abstract: We investigated whether infection of
beige/scid mice with Mycobacterium
avium subspecies paratuberculosis
can induce intestinal pathophysiologic changes. Six-week-old beige/scid mice were
inoculated intraperitoneally with M.
paratuberculosis, then were killed 32 weeks after inoculation when the small
intestine was evaluated for physiologic and morphologic abnormalities. All infected mice developed clinical
disease. The lamina propria of the
intestine from infected mice was mildly infiltrated with mononuclear cells
containing acid-fast bacteria, and had significantly increased villus width.
In vitro physiologic studies in
Using chambers indicated that M.
paratuberculosis infection caused significant abnormalities in intestinal
transport parameters. Baseline
short circuit current and potential difference were abnormally high in tissues
from infected, compared with control mice, indicative of increased ion
secretion. Baseline conductance was
significantly decreased in infected mice, suggesting that intestinal tissue from
infected mice was less permeable to ions. The change in short circuit current
following transmural electrical and glucose stimulation was significantly
reduced in intestines from infected mice, suggesting that inflamed intestine had
neural and/or epithelial cell damage. We conclude that infection of beige/scid
mice with M. paratuberculosis
triggers significant intestinal pathophysiologic changes consistent with chronic
inflammation. These functional
abnormalities may contribute to the pathogenesis of the wasting syndrome seen in
bovids with paratuberculosis. This
animal model provides evidence that T cell-independent mechanisms are sufficient
to cause mucosal pathophysiologic changes and inflammation in response to a
specific pathogen, and may be of relevance to inflammatory bowel disease in
humans.
Descriptors: mice, laboratory
mammals, animal model of disease, immunocompromised hosts, experimental
infections, Mycobacterium avium
paratuberculosis, small intestine, intestinal absorption, inflammation,
histopathology, electrical conductance, physiopathology, weight losses.
New South Wales Agriculture. Ovine Johne's Disease in
URL: http://www.agric.nsw.gov.au/
Descriptors: sheep flocks, seroprevalence, post mortem
examination, fecal sampling, seroprevalence, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, disease prevalence,
epidemiology, disease control programs, testing, diagnostic techniques,
histopathology, New South Wales, Australia.
Nielsen, S.S.; Houe, H.; Thamsborg, S.M.; Bitsch, V. Comparison of two
enzyme-linked immunosorbent assays for serologic diagnosis of paratuberculosis
(Johne's disease) in cattle using different subspecies strains of
Mycobacterium avium. Journal of Veterinary Diagnostic
Investigation. Mar 2001; 13(2): 164-166. ISSN:1040-6387.
NAL Call No.:
SF774.J68
Descriptors: cattle, Mycobacterium avium
subsp. paratuberculosis, paratuberculosis, bacterial antigens,
ELISA, immunodiagnosis, antibody testing accuracy.
Norstrom, M. Geographical Information System (GIS) as a
tool in surveillance and monitoring of animal diseases. In: Elvander, M.; Lindberg, A.; Christensen,
B. Acta Veterinaria Scandinavica,
Supplementum. 2001; (supp. 94):
79-85. ISSN: 0065-1699. Note: In English with a Swedish summary.
NAL Call No.: 41.8 AC87
Suppl.
Descriptors: cattle, goats, pigs,
animal diseases, epidemiology, disease control, disease prevention, geographical
information systems, mapping,
monitoring, outbreaks, Johne’s disease, paratuberculosis, simulation models,
bovine respiratory syncytial virus, Mycobacterium avium subsp. paratuberculosis, Mycoplasma hyopneumoniae,
Odumeru, Joseph; Gao, Anli; Chen, Shu; Raymond, Melinda; Mutharia, Lucy.
Use of the bead beater for preparation of
Mycobacterium paratuberculosis template DNA in milk. Canadian
Journal of Veterinary Research. October, 2001; 65(4): 201-205. ISSN:
0830-9000. Note: In English with a French summary.
NAL Call No.:
SF601.C24
Descriptors: Mycobacterium avium
subsp. paratuberculosis, detection in milk samples, PCR, lysing
bacteria, bead beater, freeze-thaw, InstaGene Matrix, QIAamp Tissue Kit,
sensitivity levels.
Olsen, Ingrid; Tryland, Morten; Wiker, Harald G.; Reitan, Liv J. AhpC, AhpD, and a secreted 14-kilodalton antigen from
Mycobacterium avium
subsp. paratuberculosis distinguish between paratuberculosis and
bovine tuberculosis in an enzyme-linked immunosorbent assay. Clinical
and Diagnostic Laboratory Immunology. July 2001; 8(4): 797-801. ISSN:
1071-412X.
Descriptors: cattle, sera, natural and
experimental infections, antibody testing, ELISA, experimental TB, responses
compared, AhpC and AhpD, purified antigens needed to differentiate species of
Mycobacterium.
Olsen, Ingrid; Reitan, Liv J.; Wiker, Harald G. Distinct differences in repertoires of
low-molecular-mass secreted antigens of Mycobacterium avium complex and
Mycobacterium tuberculosis. Journal of Clinical
Microbiology. December 2001; 38(12): 4453-4458. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors:
antigens, culture filtrate, sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, Western blot, homologous gene, differential expression.
Olsen, I.; Storset, A. K. Innate IFN-gamma
production in cattle in response to MPP14, a secreted protein from Mycobacterium avium
subsp. paratuberculosis. Scandinavian Journal of
Immunology. September 2001; 54(3): 306-313. ISSN: 0300-9475.
Descriptors: cattle, calves, experimental infection,
testing infected and non-infected for interferon (IFN)-gamma production, MPP14,
CD8+ cells, CD4+ cells, protein derivative, interference with diagnostic tests.
Paisley, L.G. Economic aspects of disease monitoring with
special reference to bovine paratuberculosis. In: Elvander, M.; Lindberg, A.; Christensen,
B. Acta Veterinaria Scandinavica,
Supplementum. 2001; (Suppl.
94): 17-25. ISSN: 0065-1699. Note: In English with a Swedish summary.
NAL Call No.: 41.8 AC87
Suppl.
Descriptors: dairy cattle, 6000 dairy
herds, Monte Carlo simulation models, evaluating feasibility and potential
results of a national survey for Johne’s disease, Mycobacterium avium subsp. paratuberculosis, classification of true
positive and false positive herds, low sensitivity of ELISA, low levels of herd
prevalence, low within herd prevalence were analytical problems, national survey
would not be feasible, Norway.
Paolicchi, F. A.; Vagnozzi, A; Morsella, C. G.; Verna, A. E.; Massone, A. R.;
Portiansky, E. L.; Gimeno, E. J. Paratuberculosis in red deer (Cervus
elaphus): An immunohistochemical study. Journal of Veterinary
Medicine Series B. May 2001; 48(4): 313-320. ISSN:
0931-1793.
NAL Call No.: 41.8 Z52
Descriptors:
deer, Mycobacterium avium
subsp. paratuberculosis, methods comparison study,
immunohistochemistry, serological results, histological results, tissue samples
from intestinge, mesemteric lymph nodes, bacterial isolation, Ziehl-Neelsen
stained bacteria, macrophages, Langhans type giant cells.
Parrish, Nikki M.; Houston, Todd; Jones, Paul B.; Townsend, Craig; Dick,
James D. In vitro activity of a novel
antimycobacterial compound, N-octanesulfonylacetamide, and its effects on lipid
and mycolic acid synthesis. Antimicrobial Agents and Chemotherapy.
April 2001; 45(4): 1143-1150. ISSN: 0066-4804.
NAL Call No.:
RM265.A5132
Descriptors: N-octanesulfonylacetamide
(OSA), possible inhibitor of fatty acid and mycolic acid biosynthesis,
Mycobacterium, comparative study of species and strains, slow and rapid
growing species effects compared, disruption of cell wall synthesis, incomplete
septum formation, OSA inhibition in growth in both isoniazid-resistant and
multidrug resistant strains of Mycobacterium tuberculosis,
Mycobacterium avium, Mycobacterium bovis, Mycobacterium kansasii,
Mycobacterium tuberculosis, in vitro activity, mycolic acid.
Pearce, Lindsay E.; Truong, H. Tuan; Crawford, Robert A.; Yates, Gary F.;
Cavaignac, Sonia; de Lisle, Geoffrey W. Effect
of turbulent-flow pasteurization on survival of Mycobacterium avium
subsp. paratuberculosis added to raw milk. Applied and
Environmental Microbiology. September 2001; 67(9): 3964-3969. ISSN:
0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors:
heat sensitivity, experimentally infected raw milk, ATCC 19698 and ATCC
43015 strains, 3 bovine isolates, contaminated fecal material, treatments of
65,66,69 and 72 degrees C, survival rates.
Petit, E. Enquete serologique sur la paratuberculose
bovine menee dans l'Yonne lors de la campagne 98-99. [Serological study of bovine
paratuberculosis in Yonne in 1998/1999.] Epidemiologie et Sante Animale. 2001; (40): 23-39. ISSN: 0754-2186. Note: In French with an English summary.
Descriptors: 155 herds of dairy and
lactating cows, cattle, Mycobacterium
avium subsp. paratuberculosis,
epidemiology, serum testing, sex differences, age differences, breed
differences, management, heredity location, prevalence of disease, test
reagents, Yonne region, France.
Pillai, Shreekumar R.; Jayarao, Bhushan M.; Gummo, Jennifer D.; Hue, Eric C.
Jr.; Tiwari, Deepanker; Stabel, Judith R.; Whitlock, Robert H. Identification and sub-typing of Mycobacterium avium
subsp. paratuberculosis and Mycobacterium avium subsp.
avium by randomly amplified polymorphic DNA. Veterinary
Microbiology. April 2, 2001; 79(3): 275-284. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors:
commercial kit, identification and sub-typing, selection of a suitable
primer that would permit identification and sub-typing of Mycobacterium avium
subsp. paratuberculosis and Mycobacterium avium ssp.
avium, primer OPE-20 (5'-AAC-GGT-GAC-C-3'), fingerprint patterns,
fragments, cattle, sheep and human isolates, ATCC strains.
Plant, J.W. Ovine Johne's disease in
Descriptors: sheep, goats, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis, disease incidence,
serological disease surveys, disease distribution, disease transmission, disease
prevention and control programs, diagnostic techniques, cost of disease,
regulations, vaccination, vaccines, New South Wales, Australia.
Rajeev Singh; Sinha, D. K.; Hari Shankar; Arora, B.M.;
Descriptors: crossbred cows, calves,
mortality data, calf sex differences, calf mortality higher in summer, calf
diseases enteritis, pneumonia, malnutrition, cows malnutrition, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, bloat, Trypanosoma evansi, heat stroke,
pneumonia, Allahabad, India.
Rajukumar, K.; Tripathi, B. N.; Kurade, N. P.; Parihar, N. S. An enzyme-linked immunosorbent assay using
immunoaffinity-purified antigen in the diagnosis of caprine paratuberculosis and
its comparison with conventional ELISAs. Veterinary Research
Communications. October 2001; 25(7): 539-553. ISSN: 0165-7380.
NAL Call No.: SF601.38
Descriptors:
APA ELISA, Mycobacterium avium
subsp. paratuberculosis, detection of antibodies in goat sera,
fecal cultures, histopathology for disease confirmation, test evaluation.
Rossiter, C. A.; Henning, W. R. Isolation of
Mycobacterium paratuberculosis (M. ptb) from thin market cows
at slaughter. Journal of Dairy Science. 2001; 84(Suppl. 1):
113-114. ISSN: 0022-0302. Note: Joint Meeting of the American Dairy Science
Association, American Meat Science Association, American Society of Animal
Science and the Poultry Science Association, Indianapolis, Indiana, USA, July
24-28, 2001.
URL: http://www.ADSA.org/jds
NAL Call
No.: SF221 A4
Descriptors: cattle, disease
testing, slaughter, incidence of disease, Johne’s disease, Mycobacterium avium
subsp. paratuberculosis.
Rowan, Neil J.; MacGregor, Scott J.; Anderson, John G.; Cameron, Douglas;
Farish, Owen. Inactivation of Mycobacterium
paratuberculosis by pulsed electric fields. Applied and
Environmental Microbiology. June 2001; 67(6): 2833-2836. ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors:
viability testing, Mycobacterium avium
subsp. paratuberculosis cells, peptone water and sterilized
cow’s milk, cellular damage.
Ryan, Paul; Bennett, Michael W.; Aarons, Simon; Lee, Gary; O' Connell, Joe;
Collins, John K.; O' Sullivan, Gerald C.; Shanahan, Fergus. A search for Mycobacterium paratuberculosis
by PCR in Crohn's granulomas isolated laser capture microdissection.
Gastroenterology. April 2001; 120(5 Suppl. 1): A.325. ISSN: 0016-5085.
Note: 102nd Annual Meeting of the American Gastroenterological Association and
Digestive Disease Week, Atlanta, Georgia, USA, May 20-23, 2001.
URL: http://www.gastrojournal.org/
NAL Call No.: RC799.G37
Descriptors:
diagnostic method, cattle, humans, Johne’s, Crohn’s disease, Mycobacterium avium
subsp. paratuberculosis.
Sasahara, K. C.; Boor, K. Detection of viable
Mycobacterium avium
subsp. paratuberculosis using luciferase reporter
systems. Abstracts of the General Meeting of the American Society for
Microbiology. 2001; 101: 576. ISSN: 1060-2011. Note: 101st General Meeting
of the American Society for Microbiology, Orlando, FL, USA, May 20-24, 2001.
NAL Call No.: QR1.A5
Descriptors:
Mycobacterium
avium subsp. paratuberculosis, rapid detection methods,
contamination of milk, mycobacterial luciferase reporter system, pathogen
survivability.
Schwartz, Brett D.; De Voss, James J. Structure and absolute configuration of mycobactin
J. Tetrahedron Letters. May 21, 2001; 42(21): 3653-3655. ISSN:
0040-4039.
NAL Call No.: 385 T29
Descriptors:
siderophore, Mycobacterium avium
subsp. paratuberculosis, stereochemistry, methods, applications
to other mycobactins.
Sechi, Leonardo A.; Manuela, Mura; Francesco, Tanda; Amelia, Lissia;
Antonello, Solinas; Giovanni, Fadda; Stefania, Zanetti. Identification of Mycobacterium avium
subsp. paratuberculosis in biopsy specimens from patients with
Crohn's disease identified by in situ hybridization. Journal of
Clinical Microbiology. December 2001; 39(12): 4514-4517. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors:
Crohn’s disease, cell wall deficient Mycobacterium avium
subsp. paratuberculosis, paraffin-embedded tissue specimens,
humans.
Secott, T.E.; Lin, T.L.; Wu, C.C. Fibronectin attachment protein homologue
mediates fibronectin binding by Mycobacterium avium
subsp. paratuberculosis. Infection and Immunity. Apr
2001; 69(4): 2075-2082. ISSN: 0019-9567.
NAL Call No.:
QR1.I57
Abstract: Attachment of Mycobacterium avium
subsp. paratuberculosis to host tissue and penetration of
mucosal surfaces are pivotal events in the pathogenesis of Johne's disease.
Fibronectin (FN) binding is required for attachment and internalization of
several mycobacteria by epithelial cells in vitro. The objective of this study
was to further characterize the FN binding activity of M. avium subsp.
paratuberculosis. Although the bacteria bound FN poorly at pH above 7,
brief acid pretreatment greatly enhanced FN binding within the pH range (3 to
10) studied. A 4.6-kbp fragment from an M. avium subsp.
paratuberculosis genomic library was found to contain a 1,107-bp open
reading frame that shows very high nucleotide sequence identity with that of the
FN attachment protein (FAP) gene of M. avium subsp. avium.
Pretreatment of FN with an FN-binding peptide from M. avium subsp.
avium FAP abolished FN binding, indicating that M. avium
subsp. paratuberculosis binds FN in a FAP-dependent manner.
Pretreatment of M. avium subsp. paratuberculosis with anti-FAP
immunoglobulin G did not abrogate FN binding; blocking occurred only when
anti-FAP was added together with FN. FAP was detected by immunofluorescence only
in lipid-extracted M. avium subsp. paratuberculosis. Western
blotting and immunoelectron microscopy revealed that FAP is located near the
interior of the cell envelope of M. avium subsp.
paratuberculosis. The results indicate that a FAP homologue mediates
the attachment of FN to M. avium subsp. paratuberculosis.
Further, given the subcellular location of FAP, it is considered that this
protein operates at the terminus of a coordinated FN binding system in the cell
envelope of M. avium subsp. paratuberculosis.
Descriptors: Mycobacterium avium
subsp. paratuberculosis binding proteins, bacterial proteins,
nucleotide sequences, genes, molecular sequence data.
Sergeant, E. S. G. Ovine Johne's disease in
Australia: The first 20 years. Australian Veterinary Journal. July
2001; 79(7): 484-491. ISSN: 0005-0423.
NAL Call No.: 41.8
Au72
Descriptors: sheep, historical review of the disease
in Australia, introduction information dates, movement of the disease, economic
impact, control, diagnostic techniques, surveillance strategies, distribution
and prevalence.
Singh, S.V.; Vihan, V.S. Diagnosis of Johne's disease. In:
Chauhan, R.S.; Singh, G.K.; Agrawal, D.K. Advances in Immunology and Immunopathology
Proceedings of a National Symposium on Immunomodulation in Health and
Disease. 2001; 140-154.
Descriptors: goats, Mycobacterium avium subsp. paratuberculosis, clinical aspects,
diagnosis, diagnostic techniques, histology, immunological techniques,
PCR.
Spahr, U.; Schafroth, K. Fate of Mycobacterium avium
subsp. paratuberculosis in Swiss hard and semihard cheese
manufactured from raw milk. Applied and Environmental
Microbiology. September 2001; 67(9): 4199-4205. ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors:
experimentally contaminated cheese, declumped cells, Swiss Emmentaler,
semi-hard Swiss Tisliter, bacterial cell survival, 7H10-PANTA agar plating
media, factors affecting ripening were temperature, low pH, and time of 90-120
days.
Stabel, J. R.; Whitlock, R. H. An evaluation
of a modified interferon-gamma assay for the detection of paratuberculosis in
dairy herds. Veterinary Immunology and Immunopathology. May 10,
2001; 79(1-2): 69-81. ISSN: 0165-2427.
NAL Call No.:
SF757.2.V38
Descriptors: dairy cattle, blood
sampling, Mycobacterium
avium subsp. paratuberculosis, Pennsylvania, Wisconsin,
infected herds, Johne’s disease, fecal culture, concanavalin A (ConA), IFN
gamma, commercial ELISA antibody test, test accuracy, subclinical infection,
useful for culling decisions.
Stabel, Judith R.; Harp, James A.; Pesch, Bruce. Infection with Mycobacterium avium
subsp. paratuberculosis on immune cell phenotype.
FASEB Journal. March 7, 2001; 15(4): A309. ISSN: 0892-6638. Note: Annual
Meeting of the Federation of American Societies for Experimental Biology on
Experimental Biology 2001, Orlando, Florida, USA, March 31-April 04, 2001.
NAL Call No.: QH301.F3
Descriptors:
paratuberculosis, Johne's disease, ruminant bacterial disease,
gammadelta-TCR subset of T cells, role in containing the infection,
subclinically infected cows, brogation of gammadelta-TCR T cell response may be
responsible for the shift between subclinical and clinical disease states for
paratuberculosis.
Stabel, Judith; Waldren, Charles; Garry, Frank. Ionizing radiation effectively destroys
Mycobacterium paratuberculosis in milk. Journal of Dairy
Science. 2001; 84(Suppl. 1): 27. ISSN: 0022-0302. Note: Joint Meeting of the
American Dairy Science Association, American Meat Science Association, American
Society of Animal Science and the Poultry Science Association, Indianapolis,
Indiana, USA, July 24-28, 2001.
URL: http://www.ADSA.org/jds
NAL Call
No.: SF221 A4
Descriptors: milk, sterilization
with ionizing radiation, Mycobacterium avium
subsp. paratuberculosis, public health, disease control.
Stabel, J.R. On-farm batch pasteurization destroys Mycobacterium
paratuberculosis in waste milk. Journal of Dairy Science. Feb
2001; 84(2): 524-527. ISSN: 0022-0302.
NAL Call No.:
44.8 J822
Abstract: A recent dairy survey
conducted in 1996 by the National Animal Health Monitoring System suggests
between 20 and 40% of dairy herds in the United States have some level of
Johne's disease. This figure will continue to increase unless producers
implement management regimes that will help control the spread of this disease
within their herds. The neonatal calf is the target for infection with
Mycobacterium paratuberculosis, the causative agent of Johne's disease.
Calves become infected via exposure to the bacterium through contaminated feces,
bedding, colostrum, and milk. Shedding of viable M. paratuberculosis
has been documented in the colostrum and milk of infected dams. This study
evaluated the efficacy of on-farm pasteurization to destroy M.
paratuberculosis in waste milk fed to calves to circumvent this mode of
transmission. In three replicate experiments, waste milk was experimentally
inoculated with M. paratuberculosis and heated at 65.5 degrees C for 30
min. No viable bacteria were recovered after 28 wk of incubation. These results
suggest that batch pasteurization of waste milk contaminated with M.
paratuberculosis was effective at generating a clean product to feed to
young calves.
Descriptors: calves, calf feeding, disease
survey, pasteurization, efficacy of on-farm pasteurization of waste milk, Mycobacterium avium
subsp. paratuberculosis, bacterial count, milk quality, disease
control, Johne's disease, United States.
Stabel, J. On-farm batch pasteurization
destroys Mycobacterium paratuberculosis in waste milk.
Journal of Dairy Science. 2001; 84(Suppl. 1): 187. ISSN: 0022-0302. Note:
Joint Meeting of the American Dairy Science Association, American Meat Science
Association, American Society of Animal Science and the Poultry Science
Association, Indianapolis, Indiana, USA, July 24-28, 2001.
URL: http://www.ADSA.org/jds
NAL Call
No.: SF221 A4
Descriptors: Johne’s disease, on the
farm disease prevention and control, sanitation, dairy cattle, Mycobacterium avium
subsp. paratuberculosis.
Stoltenow, Charles L.; Lardy, Greg; Schroeder, J.W. and NDSU Extension
Service. Johne's disease in beef and dairy
herds. NDSU Extension Service [publication].
[2001]; V-1209, 1 folded sheet (4 p.). Note: Caption title has June
2001.
NAL Call No.: S544.3.N9C46 no. 1209
Descriptors: paratuberculosis, Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
symptoms, control strategies, beef cattle, dairy cattle, North Dakota.
Storset, A. K.; Hasvold, H. J.; Valheim, M.; Brun, Hansen H.; Berntsen, G.;
Whist, S. K.; Djonne, B.; Press, C. McL.; Holstad, G.; Larsen, H. J. S. Subclinical paratuberculosis in goats following
experimental infection: An immunological and microbiological study.
Veterinary Immunology and Immunopathology. August 10, 2001; 80(3-4):
271-287. ISSN: 0165-2427.
NAL Call No.: SF757.2.V38
Descriptors: goats, experimental infection of kids, caprine
isolate, Mycobacterium
avium subsp. paratuberculosis, bacterial suspension in milk
replacement, cellular responses monitored, lesions, pathology.
Strommenger, Birgit; Stevenson, Karen; Gerlach, Gerald F. Isolation and diagnostic potential of ISMav2, a novel
insertion sequence-like element from Mycobacterium avium subspecies
paratuberculosis. FEMS Microbiology Letters. March 1,
2001; 196(1): 31-37. ISSN: 0378-1097.
NAL Call No.: QR1.F44
Descriptors: mycobacterial IS elements, ISMav2, 50%
identity to a non-composite transposon of Streptomyces coelicolor at
the DNA and protein level, potential diagnostic tool.
Tessema, M. Z.; Koets, A. P.; Rutten, V. P. M. G.; Gruys, E. How does Mycobacterium avium
subsp. paratuberculosis resist intracellular degradation?
Veterinary Quarterly. November 2001; 23(4): 153-162. ISSN: 0165-2176.
NAL Call No.: SF601 V46
Descriptors:
microbial resistance, thick, lipid-rich cell envelope, 3 level survival
strategies, safe entry, intracellular trafficking of mycobacteria containing
phagosomes, modulation of the immune process, implications, epidemiology,
diagnosis, control.
Thomsen, B. V.; Steadham, E. M.; Gallup, J. M.; Ackermann, M. R.; Brees, D.
J.; Cheville, N. F. T cell-dependent inducible
nitric oxide synthase production and ultrastructural morphology in BALB/c mice
infected with Mycobacterium avium subspecies
paratuberculosis. Journal of Comparative Pathology.
August-October 2001; 125(2-3): 137-144. ISSN: 0021-9975.
NAL Call
No.: 41.8 J82
Descriptors: euthymic BALB/c mice,
athymic nude BALB/c mice, intraperitoneal injection, Mycobacterium avium
subsp. paratuberculosis (ATCC strain 19698), hepatic granuloma
evaluation, morphometric analysis of digital images, light microscopy sections,
electron microscopy, immunohistochemical methods, responses compared.
Tripathi, B.N. Recent advances in pathogenesis and
diagnosis of paratuberculosis (Johne's disease) in animals. In: Chauhan R.S.; Singh, G.K.; Agrawal,
D.K. Advances in Immunology and Immunopathology
Proceedings of a National Symposium on Immunomodulation in Health and
Disease. 2001; 288-294.
Descriptors: animal disease, Johne’s
disease, Mycobacterium avium subsp.
paratuberculosis, bacteriology,
pathogenesis, diagnosis, diagnostic techniques, immunodiagnosis,
paratuberculosis.
Valsson, O.; Alenius, S.; Nielsen, T.K.; Nyberg, O.; Salmela, P. Surveillance of ruminant diseases in the
Nordic countries. In: Elvander, M.; Lindberg, A.; Christensen,
B. [Editors] Acta Veterinaria Scandinavica,
Supplementum. 2001; (supp. 94):
27-28. ISSN: 0065-1699.
NAL Call No.: 41.8 AC87
suppl
Descriptors: cattle, sheep, goats,
animal health, disease control programs, disease prevention, disease
surveillance, bovine leucosis. bovine spongiform encephalopathy, brucellosis,
paratuberculosis, salmonellosis, scrapie, tuberculosis, bovine diarrhea virus,
bovine herpesvirus 1, caprine arthritis encephalitis virus, Escherichia coli, Mycobacterium avium subsp. paratuberculosis, visna maedi virus,
Denmark, Finland, Norway, Sweden, Iceland.
Van Leeuwen, J.A.; Keefe, G.P.; Tremblay, R.; Power, C.; Wichtel, J.J.
Seroprevalence of infection with Mycobacterium avium subspecies paratuberculosis, bovine leukemia virus,
and bovine viral diarrhea virus in Maritime
URL: http://www.pubmedcentral.nih.gov/tocrender.fcgi?action=archive&journal=202
NAL
Call No.: 41.8
R3224
Descriptors: dairy cows, dairy herds,
Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
seroprevalence, bovine leukemia virus, bovine diarrhea virus, geographical
variation,
Veerabadran, D. Cloning and characterization
of the genes coding for antigen 85A, 85B and 85C of Mycobacterium avium
subsp. paratuberculosis. Abstracts of the General
Meeting of the American Society for Microbiology. 2001; 101: 740. ISSN:
1060-2011. Note: 101st General Meeting of the American Society for Microbiology,
Orlando, FL, USA, May 20-24, 2001.
NAL Call No.: QR1.A5
Descriptors: Mycobacterium avium
subsp. paratuberculosis, antigen 85-A, B, and C genes, homology
with other species.
Vidic, Branka; Grgic, Z.; Bjelajac, B.; Trkulja, R. Ispitivanje rasprostranjenosti paratuberkuloze kod
goveda i ovaca. [Investigations of spread of paratuberculosis in cattle and
sheep.] Veterinarski Glasnik. 2001; 55(1-2): 9-16. ISSN:
0350-2457. Note: In Serbian with English, Serbian and Russian summaries.
NAL Call No.: 41.8 J93
Descriptors:
cattle, sheep, epidemiology, serum sampling, AGID and CBR diagnostic
tests, antibody titers, Mycobacterium
paratuberculosis, survey, Backa.
Weber, M. F.; Verhoeff, J. Integrale
dierziektebestrijding op melkveebedrijven: Visie van rundveedierenartsen op een
casus. [Integrated disease control in dairy herds: A case study from the
veterinarians' viewpoint.] Tijdschrift voor Diergeneeskunde. Mei
15, 2001; 126(10): 340-345. ISSN: 0040-7453. Note: In Dutch with summaries in
English and Dutch.
NAL Call No.: 41.8 T431
Descriptors: control of intestinal diseases, dairy cattle,
bovine virus diarrhea virus, bovine herpesvirus-1, Leptospira interrogans
serovar hardjo subtype hardjobovis, Mycobacterium avium
subsp. paratuberculosis, Salmonella Dublin, sequential
ranking for disease control, voluntary culling infected cattle, The Netherlands.
Weiss, Douglas J.; Evanson, Oral A.; McClenahan, David J.; Abrahamsen,
Mitchell S.; Walcheck, Bruce K. Regulation of
expression of major histocompatibility antigens by bovine macrophages infected
with Mycobacterium
avium subsp. paratuberculosis or Mycobacterium
avium subsp. avium. Infection and Immunity. February
2001; 69(2): 1002-1008. ISSN: 0019-9567.
NAL Call No.:
QR1.I57
Descriptors: cattle, bovine macrophages,
histocompatibility complex (MHC) class I and class II antigens on their surface
and interaction with primed autologous lymphocytes, changes over 24 and 12
hours, differences in virulence, suppression of mycobacteria antigen
presentation to T lymphocytes.
Whan, L. B.; Grant, I. R.; Ball, H. J.; Scott, R.; Rowe, M. T. Bactericidal effect of chlorine on Mycobacterium
paratuberculosis in drinking water. Letters in Applied
Microbiology. September 2001; 33(3): 227-231. ISSN: 0266-8254.
NAL Call No.: QR1.L47
Descriptors:
transmission, contaminated drinking water, effects of standard water
treatment processes, strains MAP NCTC 8578, human strain Linda, ATCC 43015,
chlorine treatments, effects of level of populations and time of exposure.
Whittington, R. J.; Taragel, C. A.; Ottaway, S.; Marsh, I.; Seaman, J.;
Fridriksdottir, V. Molecular epidemiological
confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium
subsp. paratuberculosis in cases of paratuberculosis in cattle
in Australia and sheep and cattle in Iceland. Veterinary
Microbiology. April 19, 2001; 79(4): 311-322. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors:
polymorphism in IS1311, sheep and cattle strains of bacteria, history
of strain introductions, effects of different husbandry practices, Australia,
Iceland, imported animals, survey of imported animals.
Whittington, R. J.; Sergeant, E. S. G. Progress towards understanding the spread, detection
and control of Mycobacterium avium
subsp. paratuberculosis in animal populations.
Australian Veterinary Journal. April 2001; 79(4): 267-278. ISSN:
0005-0423.
NAL Call No.: 41.8 Au72
Descriptors:
pathogenesis, epidemiology, information review, aspects of the disease,
infection, transmission, incubation period, detection.
Whittington, R.J.; Lloyd, J.B.; Reddacliff, L.A. Recovery of Mycobacterium avium
subsp. paratuberculosis from nematode larvae cultured from the
faeces of sheep with Johne's disease. Veterinary Microbiology. Aug 8,
2001; 81(3): 273-279. ISSN: 0378-1135.
NAL Call No.:
SF601.V44
Abstract: A study was conducted
to determine whether trichostrongylid nematode larvae become contaminated with
Mycobacterium avium
subsp. paratuberculosis when they develop in the faeces of sheep
with Johne's disease. Nematode larvae were hatched from ova in the faecal
samples of affected sheep. Larval sheaths were removed and these as well as
exsheathed larvae were subjected to radiometric culture for M.
paratuberculosis. The organism was recovered from washing water used to
prepare the larvae, third stage larvae and larval sheaths, but not from
exsheathed larvae. The recovery of M. paratuberculosis from larvae was
associated with the severity of the histological lesions in affected sheep and
with the results of culture of the organism from intestinal tissues and faeces.
Nematode parasites of sheep might be able to act as mechanical vectors for
M. paratuberculosis as the organism associates with infective third
stage larvae when these develop in the faeces of sheep with Johne's disease.
Descriptors: sheep, Johne's disease, Mycobacterium avium
subsp. paratuberculosis, nematode larvae, intestinal tissue and
feces, Trichostrongylidae, contamination, ova, histology, disease vectors,
infectivity.
Worthington, R.W.; Bigalke, R.D.
A review of the infectious diseases of
African wild ruminants. Onderstepoort Journal of Veterinary
Research. 2001; 68(4): 291-323.
ISSN: 0030-2465.
NAL Call No.: 41.8
ON1
Descriptors: wild ruminants, many
infectious diseases, epidemiology, clinical aspects, disease transmission, many
bacterial, viral, and parasitic diseases reviewed including Mycobacterium avium subsp. paratuberculosis and Mycobacterium
bovis.
Zhang XiYue; Gao YunHang; He ZhaoYang. Comparison study of several agar diffusion
antigen of bovine paratuberculosis.
Chi lin nung yeh ta
hsüeh hsüeh pao.
[Journal of
NAL Call No.: S19.C55
Descriptors: Mycobacterium avium subsp. paratuberculosis, antigen prepared from
cytoplasm, cell wall, Sephadex G200 and through Mycobacterium phlei absorption methods,
diagnostic methods.
Allworth, M.B.; Kennedy, D.J. Progress in national control and assurance
programs for ovine Johne's disease in Australia. Veterinary
Microbiology. Dec 20, 2000; 77(3/4): 415-422. ISSN: 0378-1135. Note: In the
special issue: Paratuberculosis (Johne's Disease) edited by R. Chiodini.
Paper presented at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract:
Since the detection of ovine Johne's disease in Australia in 1980, 578 flocks
have been diagnosed as infected, with 442 of these still infected. The disease
was initially believed to be confined to the central tablelands area of NSW, but
has subsequently been shown to be more widely distributed. Sheep strains of
M. paratuberculosis are known to infect sheep and goats in
south-eastern Australia. Although sheep strains have recently been identified in
some cattle in Australia, epidemiological evidence to date supports the
distinction between ovine Johne's disease, caused by sheep strains in sheep and
goats, and bovine Johne's disease, caused by cattle strains in cattle, goats and
alpaca, as a basis for control and eradication strategies. Four national
initiatives to control and better understand OJD are outlined. The Australian
Johne's Disease Market Assurance Program for sheep was launched in May 1997. By
December 1998, 548 flocks had achieved an assessed negative status. Three flocks
assigned a flock status have subsequently been found to be infected. National
standards for State control of Johne's disease through zoning, movement controls
and procedures in infected and suspect flocks have also been developed. In
addition, a $40.1 m National Ovine Johne's Disease Control and Evaluation
Program was agreed to in August 1998, and is currently being implemented. It is
jointly funded by National and State industries, and Commonwealth and State
governments. Its objectives are to deliver, through research and surveillance, a
solid basis for a future decision on the most appropriate course for dealing
with OJD and to maintain control of OJD nationally.
Descriptors: sheep, Mycobacterium avium subsp.
paratuberculosis, Johne's disease control, detection, flock health,
disease strains, geographical distribution, epidemiology, goats, cattle, disease
prevalence, surveillance, Australia.
Bakker, D.; Willemsen, P. T. J.; van Zijderveld, F. G.
Paratuberculosis recognized as a problem at last: A review.
Veterinary Quarterly. October 2000; 22(4): 200-204. ISSN:
0165-2176.
NAL Call No.: SF601
V46
Descriptors: current opinions, Johne's disease,
Mycobacterium avium subsp. paratuberculosis, incidence of
disease, cattle and sheep, role in etiology of Crohn's, issue of diagnostic
tools, current status, control programs.
Bannantine, John P.; Stabel, Judith R. HspX
is present within Mycobacterium paratuberculosis-infected macrophages
and is recognized by sera from some infected cattle. Veterinary
Microbiology. October 20, 2000; 76(4): 343-358. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors:
cattle, rabbit antisera against recombinant protein of HspX fused to the
Escherichia coli maltose binding protein (MBP/HspX), infected murine
and bovine macrophages, sera testing, Mycobacterium avium subsp.
paratuberculosis.
Bannantine, J. P.; Stabel, J. R. Identification of two M. paratuberculosis
gene products differentially recognized by sera from rabbits immunized with live
mycobacteria but not sera raised against heat-killed mycobacteria.
Abstracts of the General Meeting of the American Society for
Microbiology. 2000; 100: 648. ISSN: 1060-2011. Note: 100th General Meeting
of the American Society for Microbiology, Los Angeles, California, USA, May
21-25, 2000.
NAL Call No.: QR1.A5
Descriptors:
bacterial molecular genetics, gene products, heat killed and live bacteria,
rabbits, Corynebacterium glutamicum protein, Mycobacterium
avium subsp. paratuberculosis, genomic expression library of
bacterial induced proteins, paratuberculosis antigens, polyketide synthase.
Beard, P.M.; Rhind, S.M.; Sinclair, M.C.; Wildblood, L.A.; Stevenson, K.;
Mckendrick, I.J.; Sharp, J.M.; Jones, D.G. Modulation of gammadelta T cells
and CD1 in Mycobacterium avium subsp. paratuberculosis
infection. Veterinary Immunology and Immunopathology. Dec 29, 2000;
77(3/4): 311-319. ISSN: 0165-2427.
NAL Call No.: SF757.2.V38
Abstract: M.a. paratuberculosis is the causal
agent of paratuberculosis (Johne's disease). Recent work has suggested that
gammadelta T cells may play an important role in the early immunological
response to mycobacterial diseases, and that CD1 may act as a non-classical MHC
molecule in antigen presentation to these gammadelta T cells. Experimental
infection of neonatal lambs with M.a. paratuberculosis was used to
investigate the changes in gammadelta T cells and CD1 molecules in the gut
associated lymphoid tissue 4 weeks after inoculation. Immunohistochemistry was
used to label the gammadelta lymphocytes and CD1 molecules. An increase in the
number of gammadelta T cells was noted in both the jejunal and ileal Peyer's
patches in the gut of infected lambs, but no statistically significant change
was found in the mesenteric lymph nodes. There were no obvious changes in the
CD1 molecules in any tissue. This work suggests that gammadelta T cells may play
a role in the initial immunological events of paratuberculosis infection.
Descriptors: Mycobacterium avium subsp.
paratuberculosis, gammadelta T lymphocytes, CD1 molecules, lambs,
experimental infections, jejunum, ileum, Peyer patches, lymph nodes.
Beard, P. M.; Henderson, D.; Daniels, M.; Pirie, A.; Buxton, D.; Greig, A.;
Hutchings, M. R.; McKendrick, I.; Rhind, S.; Stevenson, K.; Sharp, J. M. Wildlife reservoirs of paratuberculosis.
Research in Veterinary Science. June 2000; 68(Suppl. A): 2. ISSN:
0034-5288. Note: 54th Annual Conference of the Association of Veterinary
Teachers and Research Workers on Current Topics in Veterinary Science,
Scarborough, England, April 17-19, 2000.
NAL Call No.: 41.8
R312
Descriptors: Mycobacterium avium subsp.
paratuberculosis, pathogen vectors, ruminants, Johne’s disease.
Benedictus, G.; Verhoeff, J.; Schukken, Y.H.; Hesselink, J.W. Dutch
paratuberculosis programme history, principles and development.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 399-413. ISSN: 0378-1135.
Note: In the special issue: Paratuberculosis (Johne's Disease) edited by
R. Chiodini. Paper presented at a colloquium held February 14-18, 1999,
Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: Organised disease control started in the
Netherlands in the 18th century with governmental attempts to eradicate cattle
plague. At the beginning of the 20th century, the dairy industry and cattle
breeding organisations initiated a programme to control infectious diseases by
means of a complex system of rewards and penalties. This was also the reason for
establishing the Animal Health Service in Friesland in 1919. The history of
programmes to control paratuberculosis in sheep, goats, and cattle in various
countries is described. The vaccination of young animals seems to be an
effective measure in the prevention of clinical paratuberculosis, although
changes in management and hygiene practices are also important. A control
programme for infectious cattle diseases has a number of phases (a lifecycle)
and different components. Two components are essential for success, namely: open
and regular communication with farmers, veterinary practitioners, and other
people involved and a good registration and identification system for cattle,
herds, and veterinary practitioners. The Dutch paratuberculosis programme has 10
herd status levels: 5-10 for non-suspect herds and 1-4 for infected herds or
herds of unknown status. The higher the status, the greater the chance that a
herd is free of paratuberculosis. An outline is given of the Dutch
paratuberculosis programme including its objectives, basis principles for
eradication, communication plan, legal action, logistic considerations, and
complementary research programme.
Descriptors: dairy
cattle, Mycobacterium avium subsp. paratuberculosis, history,
disease control, government policy, vaccination, disease prevention, hygiene,
animal husbandry, life cycle, infections, The Netherlands.
Bergeron, N.; Pare, J.; Fecteau, G. Le
diagnostic de la paratuberculose chez les bovins. [Diagnosis of bovine
paratuberculosis.] Medecin Veterinaire du Quebec. 2000; 30(4):
215-219. ISSN: 0225-9591. Note: In French with English and French summaries.
NAL Call No.: SF602.M8
Descriptors:
Johne’s, brief review of the disease in cattle, diagnostic methods,
Mycobacterium avium subsp. paratuberculosis.
Boelaert, F.; Walravens, K.; Biront, P.; Vermeersch, J.P.; Berkvens, D.;
Godfroid, J. Prevalence of paratuberculosis (Johne's disease) in the Belgian
cattle population. Veterinary Microbiology. Dec 20, 2000: 77(3/4):
269-281. ISSN: 0378-1135. Note: In the special issue: Paratuberculosis
(Johne's Disease) edited by R. Chiodini. Paper presented at a colloquium
held February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: The national bovine
paratuberculosis (PTB) seroprevalence (apparent prevalence) in the Belgian
cattle population was determined by a serological survey that was conducted from
December 1997 to March 1998. In a random sample of herds (N = 556, 9.5%), all
adult cattle of 24 months of age or older (N = 13,317, 0.4%) were tested for the
presence of antibodies using a commercially available absorbed ELISA test kit.
The PTB median within-herd seroprevalence (proportion of detected animals within
the seropositive herds) and the PTB individual-animal seroprevalence (proportion
of detected animals) were, respectively, 2.9% (quartiles = 1.6-5.6) and 0.87%
(95% confidence interval (CI) = 0.71-1.03). The PTB herd seroprevalence
(proportion of detected herds) was 18% (95% CI = 14-21). Assuming a test
sensitivity and specificity of 45 and 99% [Sweeney et al., 1995. Journal of
Veterinary Diagnostic Investigation, 7(4): 488; Sockett et al., 1992.
Journal of Clinical Microbiology, 30(5): 1134], respectively, the
median true within-herd prevalence and the true individual-animal were estimated
to be 7 and 2%, respectively. The true herd prevalence of Mycobacterium
paratuberculosis infection was first estimated according to currently
accepted methodology. This calculation revealed that the specificity of the used
test has a dramatic effect on the estimation; assuming a test sensitivity of 45%
and a true within-herd prevalence of 7%, the true herd prevalence estimation
decreased from 36 to 0.8% if the test specificity decreased from 99.9 to 99%,
respectively. This sensitivity analysis showed that the practical limits of the
accuracy of the used screening test jeopardize the estimation of the true herd
prevalence within reasonable confidence limits, because the within-herd PTB true
prevalence was low. For this reason we augmented the herd specificity for herds
with larger adult herd size (>5). This was done by increasing the cut-off
number of positive cattle required (greater than or equal to 2) to classify a
herd truly positive and including herds with one positive test result if there
was historical evidence of PTB (previous diagnosis and/or clinical signs). This
approach resulted in an estimated true herd prevalence of M.
paratuberculosis infection of 6%. The true herd prevalence for dairy, mixed
and beef herds was, respectively, 10, 11 and 3%.
Descriptors: cattle, paratuberculosis, disease prevalence,
Mycobacterium avium subsp. paratuberculosis, seroprevalence,
serological surveys, herd health status, estimation, screening, livestock
numbers, statistical analysis, Belgium.
Brumbaugh, G. W.; Edwards, J. F.; Roussel, A. J. Jr.; Thomson, T. D. Effect of monensin sodium on histological lesions of
naturally occurring bovine paratuberculosis. Journal of Comparative
Pathology. July 2000; 123(1): 22-28. ISSN: 0021-9975.
NAL Call
No.: 41.8 J82
Descriptors: cattle, efficacy of
drug treatment, drug delivery in feed, pre- and post-lesion severity, 147.5
mg/kg, and each treated cow received 450 mg of monensin daily for 120 days, post
mortem examination, positive effects on ileum, liver, rectal mucosa, no effect
seen on mesenteric lymph node.
Buergelt, C.D.; Ginn, P.E. The histopathologic diagnosis of subclinical
Johne's disease in North American Bison (Bison bison).
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 325-331. ISSN: 0378-1135.
Note: In the special issue: Paratuberculosis (Johne's Disease) edited by
R. Chiodini. Paper presented at a colloquium held February 14-18, 1999,
Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: The morphologic changes of subclinical Johne's
disease in North American Bison (Bison bison) are characterized by
microgranulomas composed of epithelioid macrophages and individual multinucleate
giant cells of Langhans'-type occasionally containing individual cytoplasmic
acid-fast bacilli compatible with Mycobacterium avium paratuberculosis. The
microgranulomas are best visualized in the mesenteric lymph nodes of infected
subclinical animals. Macrophages that can be confused with infection-associated
epithelioid macrophages in the mesenteric lymph nodes are pigment-carrying cells
from the intestinal tract. Mesenteric lymph node biopsy may be a useful
diagnostic tool for detection of mild subclinical infection in individual
ruminants from herds of unknown infection status. The biopsy may also be useful
for Johne's disease surveillance during test-and-cull programs.
Descriptors: Bison bison, Mycobacterium
avium subsp. paratuberculosis, histopathology, diagnosis,
cytoplasm, giant cells, macrophages, lymph nodes, clinical aspects, biopsy,
diagnostic techniques, test and cull programs, North America.
Bull, Tim J.; Hermon, Taylor John; Pavlik, Ivo; El Zaatari, Fouad; Tizard,
Mark. Characterization of IS900 loci in
Mycobacterium avium subsp. paratuberculosis and development of
multiplex PCR typing. Microbiology. September 2000; 146(9):
2185-2197. ISSN: 1350-0872.
NAL Call No.: QR1.J64
Descriptors: genomic DNA flanking IS900 insertions
characterized, homologues identified, Mycobacterium tuberculosis and
Mycobacterium avium subsp. paratuberculosis genomes, sigma
factor (sigJ) at locus 3, a nitrate reductase (nirA) at locus 4, a transcription
regulator (tetR) and polyketide synthase at locus 6, and a 6-O-methylguanine
methyltransferase at locus 9, DesA1 protein, isolates comparison, possible
technique for identification.
Nucleotide Sequence
Information: AJ011838 GenBank nucleotide sequence, AJ250015 GenBank
nucleotide sequence, AJ250016 GenBank nucleotide sequence, AJ250017 GenBank
nucleotide sequence, AJ250018 GenBank nucleotide sequence, AJ250019 GenBank
nucleotide sequence, AJ250020 GenBank nucleotide sequence, AJ250021 GenBank-,
nucleotide sequence, AJ250022 GenBank nucleotide sequence, AJ250023 GenBank
nucleotide sequence, AJ251434 GenBank nucleotide sequence, AJ251435 GenBank
nucleotide sequence, AJ251436 GenBank nucleotide sequence, AJ251437 GenBank
nucleotide sequence.
Bull, T.J.; Sheridan, J.M.; Martin, H.; Sumar, N.; Tizard, M.; Hermon-Taylor,
J. Further studies on the GS element a novel mycobacterial insertion sequence
(IS1612), inserted into an acetylase gene (mpa) in Mycobacterium avium
subsp. silvaticum but not in Mycobacterium avium subsp.
paratuberculosis. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 453-463. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: We have recently
described the GS element, found in Mycobacterium avium subsp.
paratuberculosis (MAP), Mycobacterium avium subsp.
silvaticum (MAS) and some isolates of Mycobacterium avium
subsp. avium serotype 2 (MAAs2), which contains a set of genes of low
GC% content, putatively associated with the biosynthesis, modification and
transference of fucose to cell wall glycopeptidolipids. Here we describe a
further gene of low GC% content (mpa), within the GS element in MAP. mpa is a
putative acetyltransferase with homology to genes directly responsible for host
specificity and virulence in Salmonella typhimurium and Shigella
flexneri. Unlike other GS genes, strong homologues of mpa have not been
found in related species, including Mycobacterium tuberculosis (MTB).
In MAP, mpa encodes an ORF of 445aa, however, in MAS and MAAs2 mpa contains a
single inserted copy of a novel insertion sequence. This element (IS1612) has
two sets of inverted repeats at each terminus and encodes two ORFs with good
homologies to transposase and helper proteins of IS21 (E. coli) and
IS1415 (R. erythropolis). Sequence comparisons between mpa in MAP and
MAS indicate the target site for IS1612 is duplicated on insertion to give a
direct repeat at each end of the element. Immediately, downstream of the mpa
gene in both MAP and MAS are a group of three genes with good homology to the
daunorubicin resistance cluster. This cluster has a high GC% content which
suggests a 'border' for the GS element. A short motif present at the beginning
of this cluster matches with an inverted repeat of this motif at the beginning
of the first gene in the GS element. This encapsulates the whole of this group
of low GC% genes in MAP and further suggests its cassette-like nature.
Homologues of the GS element in MTB show a marked similarity of organisation,
suggesting a parallel role for these genes in both pathogens.
Descriptors: Mycobacterium avium subsp.
paratuberculosis serotype 2, Mycobacterium avium subsp.
silvaticum, nucleotide sequences, genes, transposable elements,
serotypes, cell wall components, fucose, host range, virulence, molecular
sequence data.
Cann, Paul Adrian; Bramble, Michael Graham. An open pilot study of antimicrobial agents in the
management of resistant Crohn's Disease. Gastroenterology. April
2000; 118(4, Suppl. 2, Pt. 2): AGA A1335. ISSN: 0016-5085. Note: 101st Annual
Meeting of the American Gastroenterological Association and the Digestive
Disease Week, San Diego, California, USA, May 21-24, 2000.
NAL Call
No.: RC799.G37
Descriptors: Mycobacterium
avium subsp. paratuberculosis, humans, antibiotic drug treatment,
clarithromycin, clofazamine, rifabutin, Crohn’s disease.
Cavaignac, Sonia M.; White, Stefan J.; de Lisle, Geoffrey W.; Collins,
Desmond M. Construction and screening of
Mycobacterium paratuberculosis insertional mutant libraries.
Archives of Microbiology. March 2000; 173(3): 229-231. ISSN:
0302-8933.
NAL Call No.: 442.8 AR26
Descriptors: Johne's disease, virulence mechanisms,
libraries of random mutants produced in two Mycobacterium
paratuberculosis strains, conditionally replicating shuttle phasmid phAE94
with transposon Tn5367, 2000 mutants screened, auxotrophy, carbon source
preference, altered cell wall, interrupted genes.
Cerf, O.; Griffiths, M. W.; Grant, I. Mycobacterium paratuberculosis heat
resistance and reply. Letters in Applied Microbiology. April 2000;
30(4): 341-344. ISSN: 0266-8254.
NAL Call No.: QR1.L47
Descriptors: letter regarding previously published
information, heat resistance of pathogen, bacterial characteristics,
Mycobacterium avium subsp. paratuberculosis.
Coetsier, Christophe; Vannuffel, Pascal; Blondeel, Nathalie; Denef, Jean
Francois; Cocito, Carlo; Gala, Jean Luc. Duplex
PCR for differential identification of Mycobacterium bovis, M.
avium, and Mycobacterium avium subsp. paratuberculosis in
formalin-fixed paraffin-embedded tissues from cattle. Journal of
Clinical Microbiology. August 2000; 38(8): 3048-3054. ISSN:
0095-1137.
NAL Call No.: QR46.J6
Descriptors: DNA based assay, cattle tissues, assessment of
molecular assay, conventional bacteriological and histological test,
Ziehl-Neelsen staining, p34 and f57 sequence amplification for differential
diagnosis of tuberculosis, duplex paratuberculosis, or infections caused by
other members of the Mycobacterium avium complex.
Corpa, J. M.; Garrido, J.; Marin, J. F. Garcia.; Perez, V. Classification of lesions observed in natural cases of
paratuberculosis in goats. Journal of Comparative Pathology. May
2000; 122(4): 255-265. ISSN: 0021-9975.
NAL Call No.: 41.8
J82
Descriptors: 68 goats, clinical or sub-clinical
Mycobacterium avium subsp. paratuberculosis, post mortem
pathological examination, intestinal lymphoid tissue, granulomata in the
ileocaecal Peyer's patches or related lamina propria, diffuse multibacillary
lesions, granulomatous enteritis of different intestinal sites, macroscopical
changes in the normal gut morphology, changes in lymphocyes and macrophages.
Corpa, J.M.; Perez, V.;
Sanchez, M.A.; Garcia-Marin, J.F. Control of paratuberculosis (Johne's disease)
in goats by vaccination of adult animals. Veterinary Record. 2000; 146(7): 195-196. ISSN:
0042-4900.
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.:
41.8 V641
Descriptors: goats, age groups,
vaccination, disease control, paratuberculosis, Mycobacterium avium subsp. paratuberculosis.
Corpa, J.M.; Perez, V.; Garcia-Marin, J.F. Differences in the immune
responses in lambs and kids vaccinated against paratuberculosis, according to
the age of vaccination. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 475-485. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented
at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: In order to evaluate
and compare the peripheral immune responses induced by the vaccination against
paratuberculosis in relation with the age of immunization, two groups of lambs
and goat kids were vaccinated at 15 days and 5 months old, respectively. A
heat-killed commercial vaccine was inoculated subcutaneously and humoral and
cellular immune responses were measured by an ELISA and IFN-gamma assay,
respectively, at 0, 30, 90, 180, 270 and 360 dpv in the lambs and 0, 30, 90 and
180 dpv in the caprine. IFN-gamma values did not show statistically significant
differences between both groups, but when compared to the unvaccinated controls,
this cytokine response tend to disappear earlier in animals vaccinated at 15
days old. The antibody response was always higher and more persistent in animals
vaccinated at 5 months. The possibility of the incomplete degree of maturation
of the immune system in 15 days old animals as the cause of the differences in
the immune response to vaccination is suggested.
Descriptors: lambs, goat kids, Mycobacterium avium
subsp. paratuberculosis, vaccination, age differences, species
differences, evaluation, vaccines, interferon, ELISA, cytokines, antibodies.
Cousins, D. V.; Williams, S. N.; Hope, A.; Eamens, G. J. DNA fingerprinting of Australian isolates of
Mycobacterium avium subsp. paratuberculosis using IS900
RFLP. Australian Veterinary Journal. March 2000; 78(3): 184-190.
ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: cattle, sheep, alpacas, a rhinoceros, evaluate
additional restriction enzymes, IS900 RFLP, examine the genetic diversity, 71
Australian isolates, epidemiology, Johne's disease, restrictions enzymes, Bst
EII, Pvu II and Pst I, Bam Hl, Alu I, Xho I and Dra I, detection of
polymorphisms, cattle and sheep strains distribution, Australia.
Cousins, D. V.; Whittington, R.; Marsh, I.; Masters, A.; Evans, R. J.;
Kluver, P. Mycobacteria distinct from
Mycobacterium avium subsp. paratuberculosis isolated from the
faeces of ruminants possess IS900-like sequences detectable by IS900 polymerase
chain reaction: Implications for diagnosis. Molecular and Cellular
Probes. Dec. 2000; 13(6): 431-442. ISSN: 0890-8508.
NAL Call No.:
RB43.7.M63
Descriptors: feces, diagnosis of
Johne’s disease, IS900 PCR, 16 S rRNA, recommend the adoption of restriction
endonuclease analysis of IS900 PCR product false positives.
Daniels, M. J.; Hutchings, M. R.; Henderson, D. Quantifying rabbit faecal contamination on livestock
grazing pasture and the input of M. a. paratuberculosis.
Research in Veterinary Science. June 2000; 68(Suppl. A): 2. ISSN:
0034-5288. Note: 54th Annual Conference of the Association of Veterinary
Teachers and Research Workers on Current Topics in Veterinary Science,
Scarborough, England, April 17-19, 2000.
NAL Call No.: 41.8
R312
Descriptors: fecal contamination, pastures,
Mycobacterium avium subsp. paratuberculosis, rabbit pellets,
Oryctolagus cuniculus, possible disease, vector, Scotland.
Dimech, W. Automation of an absorbed enzyme immunoassay for the detection
of Mycobacterium paratuberculosis antibodies for an eradication
program. Veterinary Microbiology. Dec 20, 2000; 77(3/4): 351-355.
ISSN: 0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: As part of an ongoing Johne's
disease eradication program by the state of Victoria, Australia, the Victorian
Veterinary Pathology Services (VVPS) has been involved in testing over 150000
cattle samples per year for the presence of Johne's-specific antibodies. The
Parachek kit (CSL, Victoria, Australia) has been used throughout the project.
This method was automated using a Rosys 3300 and a Plato 7 (Dade/Behring
Diagnostics) to pipette samples and the Behring ELISA Processor 3 (Dade/Behring
Diagnostics) to wash EIA plates, add reagents, reads absorbances and perform
data reduction of the results. Automation saved about 15 h of labour per day,
allowing one staff member to analyse up to 2000 samples per 8 h shift compared
to 800 samples using a manual protocol. Problems that were encountered include
pipetting issues, the reading of the Paracheck endpoint, and excessive packaging
of the kit. Maintenance, calibration and control of the analysers were an
integral part of the process. VVPS, working in conjunction with CSL, suggested
modification to the Parachek kit to make automation of the product more
convenient. The approach resulted in a change in reagent volume and a reduction
in packaging that reduced the cost of the test by 25%.
Descriptors: cattle, Mycobacterium avium subsp.
paratuberculosis, enzyme immunoassay, antibody testing, disease
control, automation, labor, evaluation, calibration, maintenance, Victoria,
Australia.
Dinsmore, R. Page. Updates on Johne's
Disease. Large Animal Practice. March-April 2000; 21(2): 20,
24-25. ISSN: 1092-7603.
NAL Call No.: SF601 B6
Descriptors: Mycobacterium avium subsp.
paratuberculosis, pathogenicity, etiology, paratuberculosis, cattle
disease, Crohn’s disease in humans, status of diagnosis and control, disease
prevalence, milkborne diseases, dairy cows, beef cattle.
Eamens, G.J.; Whittington, R.J.; Marsh, I.B.; Turner, M.J.; Saunders, V.;
Kemsley, P.D.; Rayward, D. Comparative sensitivity of various faecal culture
methods and ELISA in dairy cattle herds with endemic Johne's disease.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 357-367. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's Disease)
edited by R. Chiodini. Paper presented at a colloquium held February 14-18,
1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: In three New South Wales dairy cattle herds with
endemic Johne's disease, prevalence rates by faecal culture were determined to
be 12, 18 and 22%, respectively. Whole herd faecal culture was shown to detect
markedly more infected cattle than whole herd testing by the EMAI absorbed
ELISA, particularly in the two herds with greatest prevalence. In the three
study herds, five methods for whole herd faecal culture were compared in each.
These included two methods based on primary culture on Herrold's egg yolk medium
with mycobactin J (HEYM): (1) conventional decontamination with sedimentation
and primary culture on HEYM; (2) Whitlock decontamination and culture on HEYM.
The remaining three methods were based on radiometric (BACTEC) culture: (3)
decontamination and filtration to BACTEC medium; (4) modified Whitlock
decontamination to BACTEC medium and (5) Whitlock decontamination to BACTEC
medium. For BACTEC cultures, two methods were compared as confirmatory tests for
Mycobacterium paratuberculosis: mycobactin dependence on conventional
subculture to HEYM and IS900 PCR analysis of radiometric media. Among 179 cattle
tested simultaneously by all five culture methods, 38 cattle were confirmed to
be shedding M. paratuberculosis. In identifying shedder cattle, method
5 was the most sensitive, followed by methods 2, 4, 1, and 3 was the least
sensitive. The number of BACTEC cultures confirmed by mycobactin dependence or
PCR was similar.
Descriptors: dairy cattle herds, endemic
Johne's disease, paratuberculosis, fecal cell cultures, ELISA, diagnostic
techniques, evaluation, disease prevalence, infections organism shedding,
detection methods, New South Wales, Mycobacterium avium subsp.
paratuberculosis, Australia
Ellingson, J. L. E.; Stabel, J. R.; Bishai, W. R.; Frothingham, R.; Miller,
J. M. Evaluation of the accuracy and
reproducibility of a practical PCR panel assay for rapid detection and
differentiation of Mycobacterium avium subspecies. Molecular
and Cellular Probes. June 2000; 14(3): 153-161. ISSN: 0890-8508.
NAL Call No.: RB43.7.M63
Descriptors:
possible diagnostic tool, specific oligonucleotides primers, 16 S rRNA (MAs)
sequence, insertion elements IS901 (MAs avium), IS 1245 Mycobacterium
avium complex (MAC), IS900 (MAs paratuberculosis), and the hspX (MAs
paratuberculosis) gene sequences were synthesized and used in preassembled PCR
reaction mixtures, easy to use method.
Eppleston, J.; Simpson, G.; O'Neill, S.; Thornberry, K.; Lugton, I.; Taylor,
P.; Hall, D.G. Reported levels of sheep mortalities in flocks infected with
ovine Johne's disease in New South Wales. Asian-Australasian Journal of
Animal Science. July 2000; 13(suppl.): 247. ISSN: 1011-2367. Note: In the
supplement: Animal Production for a Consuming World, vol. C edited by
G.M. Stone. Proceedings of the 9th Congress of the Asian-Australasian
Association of Animal Production Societies and 23rd Biennial Conference of the
Australian Society of Animal Production held July 3-7, 2000, Sydney, Australia.
NAL Call No.: SF55.A78A7
Descriptors:
sheep disease, Johne's disease, mortality statistics, Mycobacterium
avium subsp. paratuberculosis, Australia.
Feola, R. P.; Czuprynski, C. J. Binding of
bovine growth hormone to Mycobacterium avium ss
paratuberculosis. Comparative Immunology Microbiology and
Infectious Diseases. July 2000; 23(3): 153-162. ISSN: 0147-9571. Note: In
English with English and French summaries.
NAL Call No.:
QR180.C62
Descriptors: cultured bacterial
cultures, addition of bGH (5 mug/ml) had inhibitory effect on growth of
Mycobacterium avium subsp. paratuberculosisin Middlebrook 7H9
broth, first report of a mammalian hormone binding to MAP.
Ferroglio, E.; Nebbia, P.; Robino, P.; Rossi, L.; Rosati, S. Mycobacterium paratuberculosis infection in
two free-ranging Alpine ibex. Revue Scientifique et Technique Office
International des Epizooties. December, 2000; 19 (3): 859-862. ISSN:
0253-1933 Note: In English with English, French, and Spanish summaries.
NAL Call No.: SF781.R4
Descriptors:
Alpine ibex (Capra ibex), free ranging, disease incidence, PCR for
insertion sequence IS900, post mortem examination, tested positive to
Zielh-Nielsen stain.
Fridriksdottir, V.; Gunnarsson, E.; Sigurdarson, S.; Gudmundsdottir, K.B.
Paratuberculosis in Iceland: epidemiology and control measures, past and
present. Veterinary Microbiology. Dec 20, 2000; 77(3/4): 263-267.
ISSN: 0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: Paratuberculosis as well as the slow
virus infections maedi/visna and jaagsiekte came to Iceland in 1933 when 20
sheep of the Karakul breed were imported from Halle, Germany. At least five of
these sheep were subclinical carriers of paratuberculosis. Within 16 years
paratuberculosis together with the other Karakul diseases (maedi/visna and
jaagsiekte) almost ruined sheep farming, the main agricultural industry in
Iceland. The first clinical case of paratuberculosis in sheep was confirmed in
1938, and in cattle in 1944. The first cattle cases of paratuberculosis appeared
on farms where the disease had been prevalent in sheep for years. The virulence
in cattle appeared to be considerably lower than in sheep. Extensive measures
were used to control the spread of paratuberculosis in sheep. Hundreds of
kilometres of fences were put up and used together with natural geographic
borders to restrict the movement of sheep from infected areas. Serological and
other immunological tests were also used to detect and dispose of infected
individuals. These measures proved inadequate and the disease could not be
eradicated. Culling and restocking of uninfected sheep in endemic areas
eradicated maedi/visna and jaagsiekte but not paratuberculosis. Experiments
showed that vaccination against paratuberculosis could reduce mortality in sheep
by 94%. Vaccination of sheep in endemic areas has been compulsory in Iceland
since 1966 and as a result losses have been reduced considerably. Today,
serology is used to detect and control infection in cattle herds. Furthermore,
serology is used to control vaccination of sheep and screen for infection in
non-endemic areas. The complement fixation (CF) test for paratuberculosis has
been used until now, but recently we have started comparing the CF test with the
CSL absorbed ELISA test.
Descriptors: sheep, cattle,
Mycobacterium avium subsp. paratuberculosis, disease control,
epidemiology, history of introduction, diagnosis, virulence, disease
transmission, fences, culling, vaccination, mortality, screening, economic
impact, complement fixation tests, Iceland.
Garrido, J.M.; Cortabarria, N.; Oguiza, J.A.; Aduriz, G.; Juste, R.A. Use
of a PCR method on fecal samples for diagnosis of sheep paratuberculosis.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 379-386. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's Disease)
edited by R. Chiodini. Paper presented at a colloquium held February 14-18,
1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: The high sensitivity of PCR compared to the
difficulties of fecal culture in sheep prompted the development of PCR protocols
for detection of Mycobacterium avium subsp. paratuberculosis
DNA in sheep feces. Although the PCR itself is well developed, and does not pose
large technical problems, concentrating the bacteria from samples that may
contain low numbers of bacilli using practical methods is still the main
difficulty for the use of this technique. In this study, we describe an
extraction protocol for the concentration and purification of M. avium
subsp. paratuberculosis DNA from fecal samples and we compare it with
other methods. The diagnostic performance of the freeze-boiling method was
evaluated using a reference method [Veterinary Record, 134 (1994) 95]
on fecal samples from a group of selected sheep from different flocks of known
individual serological, pathological, and cultural paratuberculosis status.
Using, as a reference, a combination of results in those conventional methods,
the freeze-boiling PCR protocol showed a sensitivity of 94.1%, and a specificity
of 92.3%.
Descriptors: sheep, Mycobacterium avium
subsp. paratuberculosis, polymerase chain reaction, fecal culture, DNA,
concentration and purification diagnostic technique, comparison study, reference
data from known animals, sample processing.
Gasteiner, J.; Awad-Masalmeh, M.; Baumgartner, W. Mycobacterium
avium subsp. paratuberculosis infection in cattle in Austria,
diagnosis with culture, PCR and ELISA. Veterinary Microbiology. Dec
20, 2000; 77(3/4): 339-349. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: Serum samples from
healthy, infected (n = 11) and diseased (n = 2) cattle as well as positive (n =
17) and negative (n = 41) reference sera were tested for antibodies to
Mycobacterium avium subsp. paratuberculosis with two
ELISA-methods (A-ELISA, Allied Monitors, Fayette, USA; H-ELISA, Institute of
Microbiology and Animal Diseases, Veterinary University Hannover). Fecal samples
of these animals were examined by PCR and culture. Also field serum samples
found to be positive (n = 664) or inconclusive (n = 1589) by A-ELISA during a
survey done on 11028 cattle of 2757 farms at different districts in Austria were
retested with H-ELISA (Gasteiner et al., 1999). In both ELISA-methods total
agreement between antibody detection and shedding of M. avium subsp.
paratuberculosis (PCR, culture) in cases of diseased animals during the
testing period was found. In subclinically infected animals H-ELISA showed a
better correlation with the results of PCR and fecal culture. Reference serum
samples of culturally negative cattle were negative in 98% by H-ELISA and in 82%
by A-ELISA, and those of positive animals were positive in 59% by H-ELISA and in
82% by A-ELISA. The 664 A-ELISA positive field serum samples were positive in
20.5%, inconclusive in 32.5% and negative in 47% by H-ELISA. A-ELISA
inconclusive sera gave positive reactions by H-ELISA in 5.2%, negative in 74.8%
and inconclusive results in 20%. The highest prevalence of antibodies (7.9% by
A- and 2.2% by H-ELISA) against M. avium subsp.
paratuberculosis were found in cattle at the age of six and seven
years. Seropositive animals were found at all tested ages. The A-ELISA gave two
to three times more positive reactors than the H-ELISA. Also both, tests showed
the highest prevalence of reagents among Holstein Friesian (6.2% by A-ELISA,
2.5% by H-ELISA) followed by other cattle breeds. Seropositive cattle were
observed in all districts of Austria in 3.3-7.1% and in 0.5-1.8% of herds
according to A- and H-ELISA, respectively.
Descriptors:
cattle, Mycobacterium avium subsp. paratuberculosis,
diagnostic techniques, ELISA, cell cultures, polymerase chain reaction, disease
diagnosis evaluation, blood serum, antibodies, infectious organism shedding,
asymptomatic infections, cattle breed differences, disease prevalence, Austria.
Giese, S.B.; Ahrens, P. Detection of Mycobacterium avium subsp.
paratuberculosis in milk from clinically affected cows by PCR and
culture. Veterinary Microbiology. Dec 20, 2000; 77(3/4): 291-297.
ISSN: 0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: Milk and faeces samples from cows with
clinical symptoms of paratuberculosis were examined for the presence of
Mycobacterium avium subsp. paratuberculosis (M.
paratuberculosis) by culture and PCR. M. paratuberculosis was
cultivated in variable numbers from faeces or intestinal mucosa in eight of 11
animals. In milk from five cows (all faeces culture positive), we cultivated a
few colonies of M. paratuberculosis (<100 CFU per ml). Milk samples
from two cows were PCR positive (both animals were faeces culture positive, and
one cow was milk culture positive). One cow was culture negative on intestinal
mucosa, but culture positive in milk, and two cows were negative in culture and
PCR from both faeces and milk. In conclusion, the presence of M.
paratuberculosis could be detected in raw milk by PCR, but cultivation of
milk was more sensitive.
Descriptors: cows, polymerase
chain reaction, detection, milk, cell culture, feces, diagnostic techniques,
symptoms, clinical aspects, intestinal mucosa, evaluation, Mycobacterium
avium subsp. paratuberculosis.
Godfroid, J.; Boelaert, F.; Heier, A.; Clavareau, C.; Wellemans, V.;
Desmecht, M.; Roels, S.; Walravens, K. First evidence of Johne's disease in
farmed red deer (Cervus elaphus) in Belgium. Veterinary
Microbiology. Dec 20, 2000; 77(3/4): 283-290. ISSN: 0378-1135. Note: In the
special issue: Paratuberculosis (Johne's Disease) edited by R. Chiodini.
Paper presented at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: In a
deer farm, chronic diarrhoea was seen in a 4-year-old hind. This animal died in
poor condition on the farm and Johne's disease was suspected. Ziehl-Neelsen
staining of the faeces of this hind were positive for the presence of clumps of
small acid-fast bacilli, but faecal cultures remained negative. Direct and
indirect tests were performed on 24 hinds and stags (yearlings, 2- and
4-year-old animals). The indirect tests performed were serology
(Mycobacterium paratuberculosis antibody ELISA, HerdChek, Idexx),
comparative cervical skin test (CCT) and lymphoproliferation test (LT) using
Mycobacterium bovis purified protein derivative (PPD) and
Mycobacterium avium PPD as antigens. Three positive serological
results, three positive CCT and eight positive LT were observed in hinds and
stags older than 2 years. No positive serological results were observed in the
yearling group, whereas some sensitisation was observed in the CCT as well as in
the LT for the same group of animals. The degree of concordance between these
indirect tests was poor. The three seropositive animals were slaughtered and
subjected to post-mortem examination. Histopathology was performed on mesenteric
lymph nodes and on the terminal ileum. Visual changes in some mesenteric lymph
nodes were observed, no gross lesion was seen in the intestine. Although
Ziehl-Neelsen staining yielded no positive results, a catarrhal focal necrotic
enteritis associated with a granulomatous lymphadenitis compatible with Johne's
disease was evidenced. The mycobacterial cultures on organ samples from
slaughtered animals were positive after 2 months for M. avium
subspecies paratuberculosis and negative for M. bovis and
M. avium. This is the first description of Johne's disease in a deer
farm in Belgium.
Descriptors: Cervus elaphus,
farmed red deer, paratuberculosis, incidence, diarrhea, mortality, diagnosis,
feces, diagnostic techniques, Mycobacterium bovis, Mycobacterium
avium subsp. paratuberculosis, Mycobacterium avium,
antigens, symptoms, histopathology, lymph nodes, intestines, necrosis, Belgium.
Goswami, T. K.; Joardar, S. N.; Ram, G. C. Antigenic analysis of M. paratuberculosis
strain TEPS by SDS-PAGE and two-dimensional immunoelectrophoresis.
Indian Journal of Animal Sciences. August 2000; 70(8): 789-791. ISSN:
0367-8318.
NAL Call No.: 41.8 IN22
Descriptors: 40 polypeptide fractions, SDS-PAGE, Coommassie
brillian blue staining, Schiff staining, Mycobacterium avium subsp.
paratuberculosis.
Goswami, Tapas Kumar; Joardar, Siddhartha Narayan; Ram, Gulab Chandra;
Banerjee, Rabin; Singh, Dhirendra Kumar. Association of Mycobacterium paratuberculosis
in Crohn's disease and Johne's disease: A possible zoonotic threat.
Current Science. October 25, 2000; 79(8): 1076-1081. ISSN: 0011-3891.
NAL Call No.: 475 SCI23
Descriptors:
review, possible association between Johne’s and Crohn’s, isolation studies,
experimental disease production, histopathological and immunological evidences,
DNA sequence analysis, possible food borne disease, Mycobacterium avium
subsp. paratuberculosis.
Goswami, T. K.; Swamy, N.; Suchitra, S.; Joardar, S. N.; Ram, G. C. Electrophoretic behaviour of Mycobacterium
paratuberculosis soluble protein antigens in rocket
immuno-electrophoresis. Indian Veterinary Medical Journal.
December, 2000; 24(4): 285-287. ISSN: 0250-5266.
Descriptors: immuno-electrophoretic behaviour, native
antigens, Mycobacterium avium subsp. paratuberculosis (strain
TEPS), hyperimmune goat sera, rocket immuno-electrophoretic technique, 8 native
precipitin peaks, qualitative and quantitative test, detection of antigenic
proteins.
Goswami, T. K.; Joardar, S. N.; Ram, G. C. In-vitro and in-vivo detection of cross-reacting
antigens of M. paratuberculosis and M. bovis.
Journal of Applied Animal Research. June 2000; 17(2): 285-290. ISSN:
0971-2119. Note: In English with English and Sanskrit summaries.
NAL
Call No.: SF55. I4J68
Descriptors:
Mycobacterium avium subsp. paratuberculosis, delayed type of
hypersensitivity, ELISA, crossed immunoelectrophoretic (CIE) technique.
Grant, I.R.; Pope, C.M.; O'Riordan, L.M.; Ball, H.J.; Rowe, M.T. Improved
detection of Mycobacterium avium subsp. paratuberculosis in
milk by immunomagnetic PCR. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 69-378. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: The potential use of
a novel immunomagnetic PCR (IMS-PCR) technique as a rapid method to screen milk
samples for the presence of Mycobacterium avium subsp.
paratuberculosis (M. ptb) was assessed. Immunomagnetic separation (IMS)
for M. ptb, developed at Queen's University, Belfast, was applied to milk
samples prior to IS900 PCR in order to selectively concentrate any M. ptb cells
present and, at the same time, separate the cells from constituents of milk
likely to inhibit subsequent PCR. This increased the sensitivity of IS900 PCR.
IMS-PCR sensitivity could be further increased by initial centrifugation (2500 g
for 20 min) of larger volumes of milk (10 and 50 ml), and resuspension of the
sediment into a 1 ml volume appropriate for IMS treatment. Following IMS,
template DNA for IS900 PCR was obtained by heating the bead-cell suspension in a
thermal cycler at 100 degrees C for 15 min. It was estimated that the IMS-PCR
assay could detect approximately 10(3) CFU of M. ptb per 50 ml of milk
(equivalent to 20 CFU/ml), whereas the minimum detection limit of direct IS900
PCR was estimated at 10(5) CFU of M. ptb per 50 ml (equivalent to 2000 CFU/ml).
A blind trial was carried out in which a total of 40 spiked (10(6) CFU M. ptb)
and unspiked, raw and laboratory-pasteurised milk samples were independently
tested by IMS-PCR and conventional IS900 PCR. IMS-PCR correctly identified 97.5%
of milk samples (sensitivity 100%, specificity 95%), including spiked milk
samples before and after laboratory-pasteurisation. One false positive result
was obtained which may have resulted from carryover between samples during the
IMS procedure. Conventional IS900 PCR correctly identified only 72.5% of the
same 40 milk samples (sensitivity 23%, specificity 100%). IMS-PCR was also shown
to be capable of detecting natural M. ptb infection in raw sheep's milk, and raw
and commercially pasteurised cows' milk.
Descriptors:
cattle, Mycobacterium avium subsp. paratuberculosis, detection
in milk, immunomagnetic polymerase chain reaction assay, diagnostic techniques,
evaluation, screening method, inhibition, raw sheep milk, pasteurized cow's
milk.
Greig, A. Johne's disease in sheep and goats. In Practice. Mar
2000; 22(3): 146-151. ISSN: 0263841X.
NAL Call No.: SF601.
I4
Descriptors: sheep, goats, paratuberculosis,
Mycobacterium avium subsp. paratuberculosis, epidemiology,
pathogenesis, chronic course, histopathology, differential diagnosis, species
differences, disease control.
Gwozdz, J. M.; Thompson, K. G.; Murray, A.; Reichel, M. P.; Manktelow, B. W.;
West, D. M. Comparison of three serological
tests and an interferon-gamma assay for the diagnosis of paratuberculosis in
experimentally infected sheep. Australian Veterinary Journal.
November 2000; 78(11): 779-783. ISSN: 0005-0423.
NAL Call No.:
41.8 Au72
Descriptors: 14 sheep, experimental
infection, Mycobacterium avium subsp. paratuberculosis,
comparison study, complement fixation test, an agar gel immunodiffusion test, an
enzyme-linked immunosorbent assay, whole blood interferon-gamma assay for
paratuberculosis.
Gwozdz, J. M.; Thompson, K. G.; Murray, A.; West, D. M.; Manktelow, B. W.
Use of the polymerase chain reaction assay for
the detection of Mycobacterium avium subspecies
paratuberculosis in blood and liver biopsies from experimentally
infected sheep. Australian Veterinary Journal. September 2000;
78(9): 622-624. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: sheep diagnostic evaluation, Mycobacterium
avium subsp. paratuberculosis, PCR assay, 14 animals, experimental
infection, sampled over 53 weeks, not a useful and reliable method.
Gwozdz, J. M.; Thompson, K. G.; Manktelow, B. W.; Murray, A.; West, D. M.
Vaccination against paratuberculosis of lambs
already infected experimentally with Mycobacterium avium subspecies
paratuberculosis. Australian Veterinary Journal. August
2000; 78(8): 560-566. ISSN: 0005-0423.
NAL Call No.: 41.8
Au72
Descriptors: sheep, protective value, live-attenuated
vaccine effects, sheep, exposed, Mycobacterium avium subsp.
paratuberculosis, investigation, progression, systemic immune response,
experimental infection, 28-1 month old lambs, vaccine effectiveness, IFN-gamma
in blood, antibody concentration of sera, sequential monitoring, IS900-baced
PCR, ileum, ileocaecal lymph nodes, histological examination.
Hope, A. F.; Kluver, P. F.; Jones, S. L.; Condron, R. J. Sensitivity and specificity of two serological tests
for the detection of ovine paratuberculosis. Australian Veterinary
Journal. December 2000; 78(12): 850-856. ISSN: 0005-0423.
NAL
Call No.: 41.8 Au72
Descriptors: 1257 sheep, serum
samples, testing sensitivity and specificity, absorbed ELISA and an AGID test,
detection of clinical and subclinical paratuberculosis, Mycobacterium
avium subsp. paratuberculosis, disease detection tests considered
useful, test differences.
Hulten, K.; El Zimaity, H. M.; Collins, M. T.; Graham, D. Y.; El Zaatari, F.
A. K. Cell wall deficient forms of M. avium
subsp. paratuberculosis found in tissues from animals with Johne's
disease by in situ hybridization. Abstracts of the General Meeting of
the American Society for Microbiology. 2000; 100: 656. ISSN: 1060-2011.
Note: 100th General Meeting of the American Society for Microbiology, Los
Angeles, California, USA, May 21-25, 2000.
NAL Call No.:
QR1.A5
Descriptors: cattle, digoxigenin stain,
Johne’s disease, bacterial forms isolation.
Hulten, K.; Karttunen, T. J.; El Zimaity, H. M. T.; Naser, S. A.; Collins, M.
T.; Graham, D. Y.; El Zaatari, F. A. K. Identification of cell wall deficient forms of
Mycobacterium avium subsp. paratuberculosis in paraffin
embedded tissues from animals with Johne's disease by in situ
hybridization. Journal of Microbiological Methods. October 2000;
42(2): 185-195. ISSN: 0167-7012.
NAL Call No.: QR65.J68
Descriptors: subclinical stage, Johne’s disease, possible
zoonotic disease, sarcoidosis, Crohn’s, spiked beef cubes, formalin fixed and
paraffin embedded, IS900 Mycobacterium avium subsp.
paratuberculosis specific probe labeled with digoxigenin, distinguish
between the acid-fast and CWD forms of Mycobacterium paratuberculosis,
localized in tissue sections.
Hulten, K.; Karttunen, T.J.; El Zimaity, H.M.T.; Naser, S.A.; Almashhrawi,
A.; Graham, D.Y.; El Zaatari, F.A.K. In situ hybridization method for studies
of cell wall deficient M. paratuberculosis in tissue samples.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 513-518. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: Cell wall deficient forms of
mycobacteria may be important in the pathogenesis of Crohn's disease and
sarcoidosis. However, no method has been available to localize this type of
organisms in tissue sections. We developed an in situ hybridization method for
the demonstration of Mycobacterium paratuberculosis spheroplasts (cell
wall deficient forms) in paraffin embedded tissue sections. M.
paratuberculosis spheroplasts were prepared by treatment with glycine and
lysozyme. Pieces of beef were injected with the prepared spheroplasts. The
samples were fixed in buffered formalin and paraffin embedded. A M.
paratuberculosis-specific probe derived from the IS900 gene was used.
Specificity was controlled by using an irrelevant probe and by hybridizing
sections with spheroplasts from other bacteria. Beef samples injected with
M. paratuberculosis spheroplasts were the only samples that hybridized
with the probe. Beef samples containing acid-fast or spheroplast forms of M.
smegmatis and M. tuberculosis as well as the acid-fast forms of
M. paratuberculosis did not hybridize with the probe. Unrelated
bacterial controls, i.e. Helicobacter pylori and Escherichia
coli were also negative in the assay. In situ hybridization with the IS900
probe provides a specific way to localize M. paratuberculosis
spheroplasts in tissue sections and may be useful for studies of the connection
between M. paratuberculosis and Crohn's disease and sarcoidosis. The
assay may also be valuable for studies on Johne's diseased animals.
Descriptors: Mycobacterium avium subsp.
paratuberculosis, cell walls deficient forms, spheroplasts,
pathogenesis, DNA hybridization, tissues, genes, identification, beef,
Helicobacter pylori, Escherichia coli, diagnostic techniques, Crohn's
disease, paratuberculosis, sarcoidosis, assay, Johne's disease.
Ikonomopoulos, John A.; Gorgoulis, Vassilis G.; Kastrinakis, Nikos G.;
Zacharatos, Panayotis V.; Kokotas, Stavros N.; Evangelou, Kostas; Kotsinas,
Athanassios G.; Tsakris, Athanassios G.; Manolis, Evangelos N.; Kittas, Christos
N. Sensitive differential detection of
genetically related mycobacterial pathogens in archival material.
American Journal of Clinical Pathology. December 2000; 114(6): 940-950.
ISSN: 0002-9173.
NAL Call No.: 448.8 Am34
Descriptors: humans, PCR assay, immunogenic protein MPB64
gene, outward-primed PCR (OPPCR), IS6110 element, amplification of IS1110 and
16S ribosomal RNA sequences, dot blotting assay, formalin-fixed
paraffin-embedded samples from patients with tuberculosis, sarcoidosis, or
Crohn’s disease, Mycobacterium avium, Mycobacterium intracellulare,
Mycobacterium paratuberculosis.
Jadhav, K.M.; Dave, M.R. Haematological and biochemical
changes in Johnes disease in sheep. Intas Polivet. 2000; 1(2): 193-194. ISSN: 0972-1738.
Descriptors: sheep, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, calcium, erythrocyte count, packed
cell volume, hemoglobin levels, hematology, biochemicals, magnesium, Mg, phosphates salts, potassium, P,
sodium, Na.
Jakobsen, M. B.; Alban, L.; Nielsen, S. S. A
cross-sectional study of paratuberculosis in 1155 Danish dairy cows.
Preventive Veterinary Medicine. July 3, 2000; 46(1): 15-27. ISSN:
0167-5877.
NAL Call No.: SF601.P7
Descriptors: milk samples, Mycobacterium avium
subsp. paratuberculosis, 1155 cows, 22 dairy farms, risk factors,
ELISA, multiple logistic regression analysis, Jersey vs. large breeds, high
parity vs. low parity, the first month after calving vs. other months of
lactation, large herd size vs. small herd size, Denmark.
Johnson, Ifearulundu Y. J.; Kaneene, J. B.; Sprecher, D. J.; Gardiner, J. C.;
Lloyd, J. W. The effect of subclinical
Mycobacterium paratuberculosis infection on days open in Michigan, USA,
dairy cows. Preventive Veterinary Medicine. August 10, 2000;
46(3): 171-181. ISSN: 0167-5877.
NAL Call No.: SF601.P7
Descriptors: Mycobacterium avium subsp.
paratuberculosis, prospective cohort study design, dairy cattle,
usefulness of ELISA and fecal culture as diagnostic tools, reproduction records,
18 month monitoring period, increase in days open, suggested impact of negative
energy balance in subclinical infected cows, Michigan.
Jubb, T.; Galvin, J. Herd testing to control bovine Johne's disease.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 423-428. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's Disease)
edited by R. Chiodini. Paper presented at a colloquium held February 14-18,
1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: In 1996, the cattle industries and government in
the Australian state of Victoria established a Johne's disease (JD) test and
control program under which participating farmers are provided with an annual
ELISA test of their adult herd and advice on disease control that is tailored to
their farm. The program is delivered through private veterinarians under
contract with the government. There are over 600 herds enrolled in the program
and about one third of these have had three or more whole herd tests. This paper
provides a review of the program to date. It describes changes in ELISA reactor
rates and numbers of clinical cases, and provides evidence for progress in the
program.
Descriptors: cattle herds, Mycobacterium
avium subsp. paratuberculosis disease control, Australian
government policy, diagnostic text, ELISA, veterinarians role, disease
incidence, surveillance, program review, Victoria, Australia.
Juste, R.A.; Garrido, J.M.; Aduriz,
G.
Un siglo de progreso y controversia sobre la paratuberculosis. I. La
situacion actual
Descriptors: Mycobacterium avium subsp. paratuberculosis, Johne's
disease is a well known disease entity since the end of the 19th century, review
of etiology and pathogenesis of the disease.
Kennedy, D.J.; Allworth, M.B. Progress in national control and assurance
programs for bovine Johne's disease in Australia. Veterinary
Microbiology. Dec 20, 2000; 77(3/4): 443-451. ISSN: 03789-1135. Note: In the
special issue: Paratuberculosis (Johne's Disease) edited by R. Chiodini.
Paper presented at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract:
Cattle strains of Mycobacterium paratuberculosis are known to infect
cattle, goats and alpaca in southeastern Australia, where there are also
significant numbers of farmed deer. Although sheep strains have recently been
identified in some cattle in Australia, epidemiological evidence to date
supports the distinction (between bovine Johne's disease (JD), caused by cattle
strains in cattle, goats and alpaca, and ovine JD, caused by sheep strains in
sheep and goats) for the purposes of control and assurance programs. The
National Johne's Disease Control Program is coordinated by the Australian Animal
Health Council, working with the livestock industries and with the Commonwealth,
state and territory governments. The council also brokers industry and
government funding for the program. The National Johne's Disease Market
Assurance Program for Cattle was launched in 1996 as the first of a suite of
voluntary national market assurance programs (MAPs) to assess and certify herds
as negative for JD. By December 1998, over 550 herds had achieved an assessed
negative status. A MAP was also launched for alpaca in 1998 and a program for
goats should be finalised in early 1999. National standards for state control of
JD through zoning, movement controls and procedures in infected and suspect
herds have also been developed. The paper covers factors affecting development
and implementation, uptake of and improvements to national control and assurance
programs for bovine JD in Australia.
Descriptors: Johne's
disease, cattle, paratuberculosis, disease control, government policy,
Mycobacterium avium subsp. paratuberculosis, goats, alpacas,
deer, sheep, epidemiology, certification, disease incidence, Australia.
Koets, A. P.; Adugna, G.; Janss, L. L. G.; van Weering, H. J.; Kalis, C. H.
J.; Wentink, G. H.; Rutten, V. P. M. G.; Schukken, Y. H. Genetic variation of susceptibility to
Mycobacterium avium subsp. paratuberculosis infection in dairy
cattle. Journal of Dairy Science. November 2000; 83(11):
2702-2708. ISSN: 0022-0302.
NAL Call No.: 44.8 J822
Descriptors: Dutch dairy cattle, 3020 cows, infection
status at slaughter, standard polygenic statistical probit model was used to
estimate heritabilities, vaccination trial data, variable susceptibilities,
genetic selection as a control measure.
Koets, A.P.; Rutten, V.P.M.G.; Bakker, D.; van der. Hage, M.H.; van Eden, W.
Lewis rats are not susceptible to oral infection with Mycobacterium
avium subsp. paratuberculosis. Veterinary Microbiology.
Dec 20, 2000; 77(3/4): 487-495. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented
at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: Pathogenesis studies
of Mycobacterium avium subsp. paratuberculosis infection in
ruminants are hampered by the long incubation time of the disease. A laboratory
animal model with a shorter incubation time would facilitate research in this
field. Although small rodents are usually considered to be resistant to M.a.
paratuberculosis infection, several susceptible murine strains have been
found. To our knowledge, there are no detailed reports with regard to
susceptibility in rats. The Lewis rat is a valuable model for inflammatory bowel
disease studies as well as autoimmune diseases involving mycobacteria as
inducing agents. In this study Lewis rats were used to investigate their
potential as a small laboratory animal model for paratuberculosis. In total 28
female Lewis rats were orally inoculated with M.a. paratuberculosis.
The rats were first inoculated at 3 weeks of age, and 12 more inoculations
followed in increasing intervals during the 3 months to follow. Eight control
rats received a sham inoculation. Over 9 months, two rats from each group were
sacrificed at regular intervals and immunological and histopathological
examinations were performed on the gastrointestinal tract, the liver and the
spleen. None of the rats developed lesions which were indicative of
mycobacterial infection as determined by histology with HE and Ziehl-Neelsen
staining. The bacteria could not be recultured from samples taken from the gut,
the liver or the spleen. The immunological tests however, showed that bacteria
had entered via the intestinal tract. From this study it appears that Lewis rats
are resistant to oral inoculation with M.a. paratuberculosis, and not
suitable as a model to study the immunopathogenesis of paratuberculosis as it
occurs in ruminants.
Descriptors: rats, Mycobacterium
avium subsp. paratuberculosis, oral administration, infection,
susceptibility, pathogenesis, animal models, experimental infections,
histopathology, digestive tract, liver, spleen, postmortem examinations,
lesions.
Kramsky, J.A.; Miller, D.S.; Hope, A.; Collins, M.T. Modification of a
bovine ELISA to detect camelid antibodies to Mycobacterium paratuberculosis.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 333-337. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's Disease)
edited by R. Chiodini. Paper presented at a colloquium held February 14-18,
1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: Mycobacterium avium subsp.
paratuberculosis infection, or Johne's disease, reportedly has a low
prevalence in South American camelid populations. Recently, however, single
cases in the United States as well as an outbreak of the disease in Australian
alpacas (Lama pacos) have been described. To provide a rapid and
cost-effective method of diagnosing Johne's disease in this species, the bovine
Parachek Johne's Absorbed EIA (CSL, Vic., Australia) was modified to create a
camelid-specific serum antibody assay. An anti-llama IgG conjugated to
horseradish peroxidase replaced the anti-bovine immunoglobulin. Checkerboard
titration of principal reagents was performed using serum from nine tissue
and/or fecal culture-positive camelids. Optimal dilutions of key components were
determined in order to provide clear discrimination between positive and
negative controls. Completion of a kinetic assay determined the optical density
at which the enzyme-substrate reaction should be stopped. A herd of 100 camelids
with no history of disease or exposure to M. a. paratuberculosis, a
subset of which were tissue and/or fecal culture-negative, was tested to
establish a cut-off value. Sample results were expressed as a percentage of the
results for control sera by transforming optical density values to ELISA values
(EV%). A preliminary EV% cut-off of 20 was established. Using this prototype
assay, culture-positive animals showed significantly different antibody
responses from culture-negative animals. These results indicate that this
camelid-specific ELISA, once refined, may be a useful tool for screening camelid
herds for M. a. paratuberculosis infection.
Descriptors: alpacas, llamas, Mycobacterium avium
subsp. paratuberculosis, detection methods, ELISA, diagnosis disease
outbreaks, IgG, herds, assays.
Lawlor, H. A.; Mutharia, L. M. Characterization of the thioredoxin system of
Mycobacterium paratuberculosis. Abstracts of the General
Meeting of the American Society for Microbiology. 2000; 100: 649. ISSN:
1060-2011. Note: 100th General Meeting of the American Society for Microbiology,
Los Angeles, California, USA, May 21-25, 2000.
NAL Call No.:
QR1.A5
Descriptors: pET expression system,
Mycobacterium intracellulare, Mycobacterium avium subsp.
paratuberculosis, thioredoxin system; Mycobacterium
tuberculosis, genome, gentamycin, recombinant his tagged proteins,
thioredoxin system characterization, antibodies, reductase, redox-cycling
system, thioredoxin reductase gene.
Lund, B. M.; Donnelly, C. W.; Rampling, A. Heat resistance of Mycobacterium
paratuberculosis. Letters in Applied Microbiology. August
2000; 31(2): 184-185. ISSN: 0266-8254.
NAL Call No.:
QR1.L47
Descriptors: bacterial characteristics,
temperature tolerance, viability testing, Crohn’s disease, Johne's disease,
Mycobacterium avium subsp. paratuberculosis.
Marsh, I.; Whittington, R.; Millar, D. Quality control and optimized procedure of
hybridization capture-PCR for the identification of Mycobacterium avium
subsp. paratuberculosis in faeces. Molecular and Cellular
Probes. August 2000; 14(4): 219-232. ISSN: 0890-8508.
NAL Call
No.: RB43.7.M63
Descriptors: fecal samples,
cattle, Johne’s disease, sheep, capture and washing of magnetic beads, low cost
method, diagnostic method, pooled samples.
Michel, A.L.; Bastianello, S.S. Paratuberculosis in sheep: an emerging
disease in South Africa. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 299-307. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: During a serological
survey for ovine paratuberculosis a total of 145934 ovine serum samples from
2019 farms throughout South Africa were tested by means of the AGID assay.
Fifty-two infected farms were identified in the Western Cape and Eastern Cape
provinces. Links between infected farms in the two provinces were established.
Examination of the distribution of infected farms in the Western Cape indicated
a positive correlation between acid soils and occurrence of infection. In an
attempt to increase the sensitivity and facilitate screening of large numbers of
sera two commercial ELISA systems were evaluated for their potential use in a
future monitoring program. Sera from histologically positive sheep and known
negative sheep flocks were used. The highest sensitivity (50.9%) was found if
both ELISA systems were run concurrently and the results of both systems
combined.
Descriptors: sheep, Mycobacterium avium
subsp. paratuberculosis, serological surveys, bioassays, farms,
geographical distribution, acid soils, screening for disease, ELISA, monitoring,
South Africa.
Miller, D.S.; Collins, M.T.; Smith, B.B.; Anderson, P.R.; Kramsky, J.; Wilder, G.; Hope, A. Specificity of four serologic assays for Mycobacterium avium ss paratuberculosis in llamas and
alpacas: a single herd study.
Journal of
Veterinary Diagnostic Investigation. 2000; 12 (4): 345-353. ISSN:
1040-6387.
NAL Call No.: SF774.J68
Descriptors: llamas, alpacas, Mycobacterium avium subsp. paratuberculosis, serology, ELISA, immunodiffusion tests, antibody testing, diagnostic value,
accuracy.
Momotani, E.; Miyama, M.; To, T. L.; Yoshihara, K.; Gotoh, H. Adhesion molecules and chemokines in granulomas by
Mycobacterium avium subsp. paratuberculosis in TNF alpha
deficient mice. Immunology Letters. September 2000; 73(2-3): 194.
ISSN: 0165-2478. Note: 24th European Immunology Meeting of the European
Federation of Immunological Societies (EFIS), Poznan, Poland, September 23-26,
2000.
NAL Call No.: QR180. I53
Descriptors: C57BL/6 mouse model, tumor necrosis factor
alpha deficiency, wild type, Mycobacterium avium subsp.
paratuberculosis, fibronectin, RANTES, epithelioid granuloma cell
border expression, intercellular adhesion molecule 1, macrophage chemoattractant
protein 1, macrophage chemoattractant protein 3, granuloma expression.
Muskens, J.; Barkema, H.W.; Russchen, E.; van Maanen, K.; Schukken, Y.H.;
Bakker, D. Prevalence and regional distribution of paratuberculosis in dairy
herds in the Netherlands. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 253-261. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: In the Netherlands a
survey was conducted to estimate the prevalence of paratuberculosis in dairy
herds. In total 15822 cows of at least 3 years of age, belonging to 378 herds
were tested using an absorbed ELISA. Of these herds, 55% (n = 207) had one or
more serologically positive cows. Of the positive non-vaccinated herds, most had
one (n = 98) or two (n = 49) positive cows. The percentage positive cows per
herd was 2.5 +/- 3.2%. The true prevalences on cow and herd levels, based on a
test sensitivity that ranged from 0.3 to 0.4 and a specificity that ranged from
0.985 and 0.995, were estimated at 2.7-6.9% and 31-71%. Seven herds had been
vaccinated against paratuberculosis and these herds had a significantly higher
percentage of serologically positive cows (23%) than the non-vaccinated herds
(2.5%). In conclusion, a small percentage of the dairy cows and a high
percentage of the dairy herds in the Netherlands is serologically positive. The
percentages true infected cows and herds are difficult to estimate precisely due
to uncertainties in test sensitivity and specificity.
Descriptors: dairy cattle herds, Mycobacterium
avium subsp. paratuberculosis, disease prevalence, geographical
distribution, surveys, ELISA, vaccination, seroprevalence.
Naser, S.A.; Hulten, K.; Shafran, I.; Graham, D.Y.; El Zaatari, F.A.K.
Specific seroreactivity of Crohn's disease patients against p35 and p36
antigens of M. avium subsp. paratuberculosis.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 497-504. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: Crohn's disease (CD) is a
chronic inflammatory bowel disease that is similar to Johne's disease in
ruminants. Recent data have strengthened the association of Mycobacterium
avium subsp. paratuberculosis (M. paratuberculosis) with
CD. To provide more evidence of an etiological association, antibody
reactivities from CD patients were tested by immunoblotting against recombinant
antigens that were identified previously from our M. paratuberculosis
genomic library. Two clones (designated pMptb#40 (3.2-kb insert) and #48 (1.4-kb
insert) expressing a 35K (p35)- and 36K (p36)-antigens showed specific
reactivities with serum samples from CD patients. Serum samples from 75% of 53
CD patients, 14% of 35 normal individuals and 10% of 10 ulcerative colitis
patients reacted to p35 antigen. Reactivities were also observed with serum
samples from 89% of 89 CD patients, 14% of 50 normal controls and 15% of 29
ulcerative colitis patients reacted with p36 antigen. When the reactivity
results from p35 and p36 were combined, the background from the controls was
eliminated, i.e. only the CD patients reacted to both p35 and p36. The positive
predictive value was 98% with specificity of 98% and the negative predictive
value was 76% with sensitivity of 74% (39 positive out of 53). A statistical
significance (p < 0.0001) was observed when the results from CD serum samples
reacting with either or both antigens were compared to the controls. The
reactivity of anti-M. paratuberculosis (specifically against p35 and
p36 antigens) antibodies in a significant proportion of CD patients would
suggest a causal role for the organism in CD.
Descriptors:
humans, Crohn's disease Mycobacterium avium, immune response, antigens,
infections, etiology, immunoblotting, recombinant antigens, Mycobacterium
paratuberculosis, blood serum.
Nebbia, P.; Robino, P.; Ferroglio, E.; Rossi, L.; Meneguz, G.; Rosati, S.
Paratuberculosis in red deer (Cervus elaphus
hippelaphus) in the western Alps. Veterinary Research
Communications. November 2000; 24(7): 435-443. ISSN: 0165-7380.
NAL Call No.: SF601.38
Descriptors: 19
red deer, Cottain Alps, DNA amplification on mesenteric lymph nodes,
Mycobacterium avium subsp. paratuberculosis, Johne’s disease,
detected, strain similar to bovine strains, in ability of serological tests for
monitoring, serum antibodies by the AGID and ELISA tests.
Nielsen, S. S.; Thamsborg, S. M.; Houe, H.; Bitsch, V. Bulk-tank milk ELISA antibodies for estimating the
prevalence of paratuberculosis in Danish dairy herds. Preventive
Veterinary Medicine. March 29, 2000; 44(1-2): 1-7. ISSN: 0167-5877.
NAL Call No.: SF601.P7
Descriptors:
Johne’s disease prevalence, Mycobacterium avium subsp.
paratuberculosis, regional differences, ELISA to test antibodies in
bulk milk testing, 6 milk collection centers, 900 herds examined, Denmark.
O'Doherty, A.; O' Grady, D.; Smith, T.; O' Farrell, K. J.; Egan, J. A survey of Johne's disease in imported animals in the
Republic of Ireland. Irish Journal of Agricultural and Food
Research. December 2000; 39(3): 486. ISSN: 0791-6833. Note: 6th Annual
Agricultural Research Forum, March 14-15, 2000.
NAL Call No.:
S539.5.I74
Descriptors: infection rates,
surveillance, cattle, Mycobacterium avium subsp.
paratuberculosis, disease incidence, imported cattle.
Oikawa, Shin; Katoh, Norio; Watanabe, Atsushi; Nishi, Hideki; Kurosawa,
Takashi; Satoh, Hiroshi. Serum apolipoprotein
A-I evaluated as a possible marker in cows with Johne's disease.
Journal of Rakuno Gakuen University Natural Science. October 2000; 25(1):
37-42. Note: In Japanese with English summary.
Descriptors:
Mycobacterium avium subsp. paratuberculosis, cattle, serum
levels of apolipoprotein A-I as a disease indicator, protein levels, cholesterol
serum concentration, phospholipids levels, albumin serum concentrations,
symptomatic and asymptomatic cattle, reliable marker in evaluating the
pathogenesis, intestinal dysfunction, Johne's disease.
Olsen, Ingrid; Reitan, Liv J.; Holstad, Gudmund; Wiker, Harald G. Alkyl hydroperoxide reductases C and D are major
antigens constitutively expressed by Mycobacterium avium subsp.
paratuberculosis. Infection and Immunity. Feb. 2000;
68(2): 801-808. ISSN: 0019-9567.
NAL Call No.: QR1.I57
Descriptors: alkyl hydroperoxide reductase C and D
antigens, gamma-interferon, polyclonal and polyvalent antiserum,
Mycobacterium avium subsp. avium, species differentiation.
Paisley, Larry G.; Tharaldsen, Jorun; Jarp, Jorun. A simulated surveillance program for bovine
paratuberculosis in dairy herds in Norway. Preventive Veterinary
Medicine. April 28, 2000; 44(3-4): 141-151. ISSN: 0167-5877.
NAL
Call No.: SF601.P7
Descriptors: Monte Carlo
simulation models, prevalence of Mycobacterium avium subsp.
paratuberculosis, feasibility and potential results of a proposed
national survey, low probability of detection, study not recommended,
epidemiology.
Parrish, N. M.; Townsend, C. A.; Dick, J. D. N-octanesulphonylacetamide (OSA), an inhibitor of
mycolic acid synthesis, inhibits the growth of Mycobacterium
paratuberculosis and is potentiated by the addition of short chain
alcohols. Abstracts of the General Meeting of the American Society for
Microbiology. 2000; 100: 655. ISSN: 1060-2011. Note: 100th General Meeting
of the American Society for Microbiology, Los Angeles, California, USA, May
21-25, 2000.
NAL Call No.: QR1.A5
Descriptors: bacterial infection, humans, antibacterial
drug effects, butanol, ciproflozacin, ethanol, isoprppanol, mycobactin J,
streptomycin.
Pavlik, I.; Bartl, J.; Dvorska, L.; Svastova, P.; Du Maine, R.; Machackova,
M.; Ayle, W.Y.; Horvathova, A. Epidemiology of paratuberculosis in wild
ruminants studied by restriction fragment length polymorphism in the Czech
Republic during the period 1995-1998. Veterinary Microbiology. Dec
20, 2000; 77(3/4): 231-251. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented at
a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: In two studies
carried out during the period 1995-1998, paratuberculosis was diagnosed in
domestic and wild ruminants in the Czech Republic. The isolated
Mycobacterium avium subspecies paratuberculosis strains were
analysed by standardised restriction fragment length polymorphism (RFLP)
[Pavlik, I., Horvathova, A., Dvorska, L., Bartl, J., Svastova, P., du Maine, R.,
Rychlik, I., 1999. Journal of Microbiological Methods 38, 155-167]. In
December 1992, 19 late pregnant Charolais heifers were imported to the Czech
Republic from Hungary (original import from France to Hungary). One 11-month-old
heifer roamed in the wild in a range of approximately 15-20 km for 7 months from
November 1993 to May 1994. Upon capture, the animal showed clinical signs of
paratuberculosis (emaciation and diarrhoea). Seven other animals from the same
herd were infected with the identical RFLP type B-C1 of M.
paratuberculosis. During the period 1995-1996, samples were taken and
examined from the small intestine and corresponding lymph nodes of 84 wild
ruminants: 19 red deers (Cervus elaphus) and 65 roe-deers
(Capreolus capreolus). These wild ruminants originated from 44
different locations within the same district from as the infected escaped
heifer. Five M. paratuberculosis strains were isolated: one strain of
RFLP type B-C1 from a stag and three strains of RFLP type B-C1 and one strain of
RFLP type B-C9 from roe-deer. The three wild ruminants (one stag and two
roe-deer) infected with the same RFLP type B-C1 were detected in the same area
as the heifer, suggesting that this was the likely infection source. However,
the infection source of the roe-deer infected with strain of RFLP type B-C9 was
obviously different, and the stags that escaped from the farm were purchased
from an area infected with this RFLP type. In the second study carried out
during 1997-1998 in the whole Czech Republic (divided into 76 districts), 718
wild ruminants were examined from 90% of the districts. M.
paratuberculosis was isolated from 25 (3.5%) animals from the wild, from
farms and from game parks: 7.1% of 132 red deers, 1.5% of 336 roe-deers, 3.9% of
178 fallow deers (Dama dama), and 4.2% of 48 moufflons (Ovis
musimon). This study discovered three RFLP types (B-C1, D-C12 and M-C16). A
surprising finding was that of M. paratuberculosis (RFLP type B-C1)
infection in roe-deer and a fallow deer in their natural habitat. The infection
source was determined to have originated from two imported Holstein and
Limousine cattle herds infected with the same strain. In the case of a mother
and daughter roe-deer infected with RFLP type M-C16 and a fallow deer infected
with RFLP type D-C12, all roaming in their natural habitat, the infection source
was not discovered. The highest incidence of clinically ill wild ruminants was
found in farmed red deer, and no relationship was found between the RFLP type or
ruminant species and clinical status of animal.
Descriptors: heifers, Cervus elaphus, red deer,
Mycobacterium avium subsp. paratuberculosis, epidemiology,
restriction fragment length polymorphism, diagnosis, Mycobacterium
avium, disease symptoms, diarrhea, disease transmission, herds, lymph
nodes, small intestine, fallow deer, mouflon, habitats, Czech Republic.
Pavlik, I.; Matlova, L.; Bartl, J.; Svastova, P.; Dvorska, L.; Whitlock, R.
Parallel faecal and organ Mycobacterium avium subsp.
paratuberculosis culture of different productivity types of cattle.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 309-342. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's Disease)
edited by R. Chiodini. Paper presented at a colloquium held February 14-18,
1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract: Faecal (at least 3 months before slaughtering)
and organ examinations were carried out in 611 animals (497 dairy, 69
dual-purpose and 44 beef cattle) originating from eight paratuberculosis
infected cattle herds. The diagnosis in cattle was established by routine
intestinal culture (ileum and the adjacent lymph nodes) after slaughter. In
selected 132 animals, post-mortem intensive culture was performed on tissue
samples collected from the gastrointestinal tract (duodenum, jejunum, ileum,
ileocecal valve, caecum, rectum) and the corresponding lymph nodes,
submandibular, retropharyngeal, tracheobronchial, liver and supramammary lymph
nodes, kidney, liver and spleen. In 251 (41.1%) of all 611 animals,
Mycobacterium avium subspecies paratuberculosis could be
isolated from the faeces; in 164 (65.7%) out of 251 shedding animals the
infection was detected in the ileum and adjacent lymph nodes. The detection of
M. paratuberculosis by routine intestinal culture of faecal culture
positive animals varied from 46.0% in animals shedding 1 CFU (colony forming
unit), to 94.7% in massive shedders. On the contrary, M.
paratuberculosis was detected by routine intestinal culture in 92 (25.5%)
of the 360 faecal culture negative animals. Shedding animals had significantly
higher (P < 0.01) number of organisms in their organs than non-shedding
animals. During the intensive tissue cultivation from selected 132 animals, 72
(54.5%) of them were positive. For the negative animals, no significant
difference was found between the detection rate in organs examined after
slaughter with routine and intensive method. However, in the subgroup of tissue
culture positive animals a highly significant difference (P < 0.01) was found
by intensive examination (83.0%) compared with the routine examination (60.4%).
Out of 72 tissue culture positive animals 73.6% of them harboured M.
paratuberculosis in the gastrointestinal tract, 16.7% in the
gastrointestinal tract and the parenchymatous organs, tracheobronchial and
mandibular lymph nodes. The rest of the 9.7% of the infection was detected in
the lymph nodes of head and lungs. Our study concerning the distribution of
M. paratuberculosis by intensive examinations revealed a minimum effect
of breed and production type on localisation of the agent. Thus, the results
suggest that in case of an active infection, M. paratuberculosis can be
localised in different organs of animals irrespective of their breed or
production type.
Descriptors: dairy and beef cattle, dual
purpose cattle, Mycobacterium avium subsp. paratuberculosis,
feces and various organs examinations, organ distribution, pre-slaughter
diagnosis, post slaughter, intestines, fecal culture, lymph nodes, postmortem
examinations, digestive tract, kidneys, liver, spleen, shedding, in vitro
culture.
Pym, Alexander S.; Brosch, Roland. Tools for
the population genomics of the tubercle bacilli. Genome
Research. December 2000; 10(12): 1837-1839. ISSN: 1088-9051.
Descriptors: molecular genetics, methods and techniques,
genomics, Mycobacterium avium, Mycobacterium bovis, Mycobacterium leprae,
Mycobacterium microti, Mycobacterium paratuberculosis, Mycobacterium
tuberculosis, Mycobacterium ulcerans, Mycobacteriaceae, DNA, amplification,
sequencing.
Rastogi, Nalin; Goh, Khye Seng; Berchel, Mylene; Bryskier, Andre. In vitro activities of the ketolides telithromycin
(HMR 3647) and HMR 3004 compared to those of clarithromycin against slowly
growing mycobacteria at pHs 6.8 and 7.4. Antimicrobial Agents and
Chemotherapy. October 2000; 44(10): 2848-2852. ISSN: 0066-4804.
NAL Call No.: RM265.A5132
Descriptors:
34 strains tested, Mycobacterium bovis BCG, Mycobacterium ulcerans,
Mycobacterium avium, Mycobacterium paratuberculosis, Mycobacterium
africanum, Mycobacterium bovis, Mycobacterium simiae, semisynthetic
ketolides, in vitro testing, anti-bacterial agents.
Reviriego, Francisco J.; Moreno, Miguel A.; Dominguez, Lucas. Soil type as a putative risk factor of ovine and
caprine paratuberculosis seropositivity in Spain. Preventive
Veterinary Medicine. Jan. 5, 2000; 43(1): 43-51. ISSN: 0167-5877.
NAL Call No.: SF601.P7
Descriptors:
bacterial pathogen distribution, cross-sectional study, questionnaire date, 61
herds, goats, sheep, serum testing, agar-gel immunodiffusion, effects of soil
types and herd size, Spain.
Rowe, M. T.; Grant, I. R.; Dundee, L.; Ball, H. J. Heat resistance of Mycobacterium avium subsp.
paratuberculosis in milk. Irish Journal of Agricultural and
Food Research. June 2000; 39(2): 203-208. ISSN: 0791-6833.
NAL
Call No.: S539.5.I74
Descriptors: milk, Johne’s
disease, Crohn’s disease, heat resistance investigated, (1) combined acid
fast/viability stain to visualise viable Mycobacterium avium subsp.
paratuberculosis in milk at different stages during pasteurisation; (2)
comparison of thermal resistance of clumped and declumped Mycobacterium
avium subsp. paratuberculosis cells, (3) assessing the lethality
of a range of time/temperature heat treatments, effect of clumping.
Sanderson, Michael W.; Dargatz, David A.; Garry, Franklyn B. Biosecurity practices of beef cow-calf
producers. Journal of the American Veterinary Medical Association.
July 15, 2000; 217(2): 185-189. ISSN: 0003-1488.
NAL Call No.:
41.8 Am3
Descriptors: biosecurity practices, beef
cattle, 2 phase study, cross-sectional survey, 2,713 cow/calf operations (phase
1), 1,190 cow/calf operations (phase 2), interview study, management practices,
level of risky management practices, vaccines given, quarantine time, proportion
of imported animals quarantined, testing for various diseases in imported
animals, need for development of rational and cost effective biosafety plans.
Sanna, E.; Woodall, C. J.; Watt, N. J.; Clarke, C. J.; Pittau, M.; Leoni, A.;
Nieddu, A. M. In situ-PCR for the detection of
Mycobacterium paratuberculosis DNA in paraffin-embedded tissues.
European Journal of Histochemistry. 2000; 44(2): 179-184. ISSN:
1121-760X.
Descriptors: sheep gut tissues, classical
lesions of paratuberculosis, Mycobacterium avium subsp.
paratuberculosis, negative control samples, 413 bp fragment of the
IS900 sequence was amplified in-situ, hybridised to an internal PCR synthesised
digoxygenin labelled probe, diagnostic and path of genesis potential.
Selby, W.Pathogenesis and therapeutic aspects of Crohn's disease.
Veterinary Microbiology. Dec 20, 2000; 77(3/4): 505-511. ISSN:
0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: Crohn's disease is a chronic, relapsing
inflammatory condition affecting any part of the human gastrointestinal tract.
It is characterized by transmural inflammation with deep ulceration, thickening
of the bowel wall and fistula formation. The hallmark is the non-caseating
granuloma. Clinical presentation depends upon the site of the inflammation. Pain
and diarrhoea are frequent. Extraintestinal manifestations develop in up to 25%
of patients and perianal disease is also frequent. The aetiology of Crohn's
disease remains unknown. On the host side, genetic factors are important and the
immune system is central to the development of the inflammation. Several
environmental factors also play a role, in particular smoking. The presence of
intestinal luminal contents appears to be essential for the development of
Crohn's disease. A number of specific infectious causes have also been proposed,
most recently measles virus and M. avium subsp.
paratuberculosis. The latter has been considered because of the
similarity between BJD and Crohn's disease, although there are also important
differences. Evidence suggesting that this agent plays a role includes isolation
of the organism from some patients, clustering, and identification by PCR of
M.a. paratuberculosis DNA in tissue. However, many other workers have
been unable to reproduce these findings. Treatment of Crohn's disease is
generally with 5-aminosalicylic acid (5-ASA) compounds, corticosteroids,
immunosuppressive agents and antibiotics. The majority of patients with active
disease will respond to one or a combination of the therapies. Recently,
broad-spectrum antibiotics have been shown to be as effective as oral
corticosteroids. The challenge in Crohn's disease remains the prevention of
relapse once remission has been achieved. Oral 5-ASA preparations can be
beneficial, particularly after surgery. Immunosuppression, particularly with
azathioprine or 6-mercaptopurine, is helpful in patients with resistant
inflammation. Antibiotics may delay the time to relapse when used for active
disease. The use of antimycobacterial therapy directed against M.a.
paratuberculosis shows promising results but needs further evaluation. Up
to 80% of patients with Crohn's disease will require surgery at some stage in
the course of their illness. The challenge remains to try and prevent resection
of inflamed intestine and to improve the quality of life of those affected by
this disorder.
Descriptors: humans, Crohn's disease,
pathogenesis, treatment, digestive tract inflammation, clinical aspects,
etiology, hosts, Mycobacterium avium, measles virus, paratuberculosis,
polymerase chain reaction, aminosalicylic acid, corticoids, immunosuppressive
agents, antibiotics.
Sheridan, Joe M.; Bull, Tim; Sumar, Nazira; Cheng, Jun; Stellakis, Michael;
Hermon, Taylor John. Prediction of the
structure, function and cellular location of proteins encoded by the GS element,
a 'pathogenicity island' in MAP Mycobacterium avium subsp.
paratuberculosis. Biochemical Society Transactions. 2000;
28(3): A76. ISSN: 0300-5127. Note: 671st Meeting of the Biochemical Society,
England, UK, April 11-13, 2000.
NAL Call No.: QD415.A1B58
Descriptors: bacterial genetics, proteins, cellular
locations, functions, vaccines.
Sheridan, Joe M.; Bull, Tim; Sumar, Nazira; Cheng, Jun; Stellakis, Michael;
Ford, Jon; Hermon, Taylor John. Prediction of
the structure, function and cellular location of proteins encoded by the GS
element, a 'pathogenicity island' in Mycobacterium avium subsp.
paratuberculosis (MAP). Biochemical Society Transactions.
October 2000; 28(5): A234. ISSN: 0300-5127. Note: 18th International Congress of
Biochemistry and Molecular Biology, Birmingham, UK, July 16-20, 2000.
NAL Call No.: QD415.A1B58
Descriptors:
protein genetics, GS encoded protein, systhesis, immune process, infection,
bacterial pathogen.
Singh, N.; Singh, S.V.; Vihan, V.S.; Sood, S.B. Management practices
and Johne's disease incidence in goat herds.
Indian Journal of Animal
Sciences. 2000; 70(3): 263-264. ISSN:
0367-8318.
NAL Call No.: 41.8
IN22
Descriptors: village goats, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, Barbary breed more susceptible, Jamunapari breed more resistant, prevalence factors, age
differences, sex differences, size of herd, culling weak and unthrifty animals
as a control measure,
Singh, S. V.; Singh, P. P.; Singh, N.; Gupta, V. K. Characterization of lipid pattern of Mycobacterium
paratuberculosis isolates from goats and sheep. Indian Journal of
Animal Sciences. September 2000; 70(9): 899-903. ISSN: 0367-8318.
NAL Call No.: 41.8 IN22
Descriptors:
sheep, goats, Mycobacterium avium subsp. paratuberculosis,
strain comparison study, patterns, alpha and ketomycolates, methoxy mycolate.
Singh, S.V.; Singh, N. Mycobacterium paratuberculosis in goats and its diagnosis in
Descriptors: goats, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, characterization, DNA sequences,
strain identification, diagnosis, diagnostic techniques,
Sockett, D.C. Johne's disease diagnosis and control. Advances in
Dairy Technology. 2000; 12: 73-84. ISSN: 1184-0684. Note: Paper presented at
the 18th Annual Western Canadian Dairy Seminar held March 7-10, 2000, Red Deer,
Alberta.
URL: http://www.afns.ualberta.ca/
NAL
Call No.: SF223.W478
Descriptors: dairy cows,
Mycobacterium avium subsp. paratuberculosis, Johnes' disease,
diagnosis and control.
Stabel, J. R.; Lee, Haa Yung; Kehrli, M. E. Jr. Cytokine secretion and expression in cows infected
with Mycobacterium paratuberculosis. FASEB Journal. April
20, 2000; 14(6): A1111. ISSN: 0892-6638. Note: Joint Annual Meeting of the
American Association of Immunologists and the Clinical Immunology Society,
Seattle, Washington, USA, May 12-16, 2000.
NAL Call No.:
QH301.F3
Descriptors: cattle, Mycobacterium
avium subsp. paratuberculosis, IL-1 [interleukin-1], IL-2
[interleukin-2], concanavalin A, cytokine expression and secretion, interferon
gamma, tumor necrosis factor.
Stabel, Judith R. Cytokine secretion by
peripheral blood mononuclear cells from cows infected with Mycobacterium
paratuberculosis. American Journal of Veterinary Research.
July 2000; 61(7): 754-760. ISSN: 0002-9645.
NAL Call No.:
41.8 Am3A
Descriptors: cattle, Johne’s disease,
Mycobacterium avium subsp. paratuberculosis, cytokine levels,
comparison between healthy, subclinical infected and clinically infected cattle,
interleukin (IL) IL-1, IL-2, IL-6, tumor necrosis factor (TNF), interferon-gamma
(IFN-gamma), post in vitro stimulation of cells with concanavalin A (ConA),
lipopolysaccharide (LPS), or a whole cell sonicate of M paratuberculosis
(MpS), proliferative responses of PBMC post ConA, phytohemagglutinin,
pokeweed mitogen (PWM), or MpS, activated T cells may delay the progression of
paratuberculosis.
Stabel, J.R. Johne's disease and milk: do consumers need to worry.
Journal of Dairy Science. July 2000; 83(7): 1659-1663. ISSN:
0022-0302.
NAL Call No.: 44.8 J822
Abstract: Mycobacterium paratuberculosis, an
acid-fast bacillus that causes enteritis in ruminants, has been suggested as an
etiological agent of Crohn's disease in humans. The mode of transmission is
unclear; however, some evidence suggests that humans may become infected via
contaminated milk. Currently, it is not known whether commercial pasteurization
effectively kills M. paratuberculosis in contaminated raw milk. Using a
laboratory-scale pasteurizer unit designed to simulate the high-temperature,
short-time method (72 degrees C, 15 sec) currently used by commercial dairies,
we previously demonstrated that treatment of raw milk inoculated with 10(4) to
10(6) cfu of M. paratuberculosis/ml reduced numbers to an undetectable level.
However, M. paratuberculosis is an intracellular pathogen that resides
within the macrophages of the host and evades destruction. We subsequently
performed further experiments examining heat treatment of milk inoculated with
mammary gland macrophages containing ingested M. paratuberculosis. Heat
treatment of these samples under high-temperature, short-time conditions
demonstrated that the macrophage does not protect the organism because we were
unable to recover any viable M. paratuberculosis from the samples.
Conversely, other researchers have demonstrated that a residual population of
M. paratuberculosis may survive heat treatment of milk. In addition, a
recent news report stated that viable M. paratuberculosis organisms
have been cultured from retail-ready milk in Ireland. A summary of past and
current studies concerning this issue along with a discussion of methodologies
used to recover M. paratuberculosis from experimentally inoculated milk
will be presented in this paper.
Descriptors:
Mycobacterium avium subsp. paratuberculosis, dairy cows,
paratuberculosis, contaminated milk, bacterial count, pasteurization processing
temperature and duration, milkborne diseases, Crohn's disease, culture media and
techniques, disease control, food safety concerns.
Stabel, J.R. Transitions in immune responses to Mycobacterium
paratuberculosis. Veterinary Microbiology. Dec 20, 2000;
77(3/4): 465-473. ISSN: 0378-1135. Note: In the special issue:
Paratuberculosis (Johne's Disease) edited by R. Chiodini. Paper presented
at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL
Call No.: SF601.V44
Abstract: The host immune
response to infection with Mycobacterium paratuberculosis is
paradoxical, with strong cell-mediated immune responses during the early,
subclinical stages of infection and strong humoral responses during the late
clinical stages of the disease. Cell-mediated immune responses modulated by
various T cell subsets are essential to provide protective immunity and prevent
progression of the disease. Secretion of cytokines by T cell populations serves
to activate macrophages to kill ingested M. paratuberculosis as well as
activate other T cell subsets to contain the infection. This paper reviews the
current knowledge of T cell immune responses in M. paratuberculosis
infection based upon clinical studies and research using mouse models.
Descriptors: Mycobacterium avium subsp.
paratuberculosis, host immune response, latent infections, disease
course, clinical aspects, T lymphocytes, cytokines, secretion, macrophages,
Johne's disease.
Step, D. L.; Streeter, Robert N.; Kirkpatrick, John G. Johne's disease update. Bovine
Practitioner. January 2000; 34(1): 6-12. ISSN: 0524-1685.
NAL
Call No.: SF779.5.A1B6
Descriptors: cattle,
description of the disease, availability of diagnostic tests, control,
eradication, reduction of exposure, pathogenesis.
Storset, A. K.; Berntsen, G.; Larsen, H. J. S. Kinetics of IL-2 receptor expression on lymphocyte
subsets from goats infected with Mycobacterium avium subsp.
paratuberculosis after specific in vitro stimulation.
Veterinary Immunology and Immunopathology. November 23, 2000; 77(1-2):
43-54. ISSN: 0165-2427.
NAL Call No.: SF757.2.V38
Descriptors: goats, quantification of surface IL-2R
expression on activated lymphocytes, flow cytometry, cellular immunity,
stimulation with purified protein derivate from Mycobacterium avium
subsp. paratuberculosis, gammadelta T cells, CD4+ cells, CD8+ T cells,
immune responses.
Stringfellow, D. A.; Givens, M. D. Infectious
agents in bovine embryo production: Hazards and solutions.
Theriogenology. January 1, 2000; 53(1): 85-94. ISSN: 0093-691X. Note:
Proceedings of the Annual Conference of the International Embryo Transfer
Society, Maastricht, The Netherlands, January 09-11, 2000.
NAL Call
No.: QP251.A1T5
Descriptors: infectious organisms,
Haemophilus somnus, Mycobacterium avium subsp.
paratuberculosis, Mycoplasma bovigenitalium, Mycoplasma bovis,
Ureaplasma diversum, bovine embryos, bovine herpesvirus 1 and 4, rinderpest
virus.
Sung, Nackmoon; Collins, Michael T. Effect of
three factors in cheese production (pH, salt, and heat) on Mycobacterium
avium subsp. paratuberculosis viability. Applied and
Environmental Microbiology. April 2000; 66(4): 1334-1339. ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors:
kinetics of bacterial pathogen inactivation, 60 day cheese curing process, ATCC
strain 19698, Dominic, low pH and NaCl are two factors contributing to the
inactivation, the radiometric culture method, heat treatment of raw milk, 60 day
curing period will inactivate about 103 cells/ml.
Thorne, S. H.; Norman, E.; McFadden, J. Approaches to genetic manipulation of
Mycobacterium paratuberculosis. Abstracts of the General
Meeting of the American Society for Microbiology. 2000; 100: 96. ISSN:
1060-2011 Note: 100th General Meeting of the American Society for Microbiology,
Los Angeles, California, USA, May 21-25, 2000.
NAL Call No.:
QR1.A5
Descriptors: molecular genetics,
biotechnology, Mycobacterium avium subsp. paratuberculosis.
Vasavada, P.C. Mycobacterium paratuberculosis: a potential milkborne pathogen of concern. Food Testing & Analysis. 2000; 6(2): 20-22. ISSN:
1084-5984.
NAL Call No.: TX541.F665
Descriptors: cattle diseases, Johne’s disease, milkborne
diseases, food safety, food contamination, microbial contamination, Crohn's disease, enteritis, disease transmission,
pasteurization.
Victoria. Environment and Natural Resources Committee.
Inquiry into the Control of Ovine
Johne's Disease in
NAL
Call No.: SF809.P375 I57 2000
Descriptors: paratuberculosis, prevention, treatment,
sheep diseases, Mycobacterium avium subsp. paratuberculosis,
Vitale, F.; Reale, S.; Oliveri, F.; Caracappa,
S.
Mutagenesi sito specifica per la generazione di un frammento deleto di IS900 mediante "SOEing-PCR".
[SOEing-PCR, application to
generate a delete IS900 fragment.] Selezione Veterinaria.
2000; (Supp): 1347-1353. ISSN: 0037-1521. Note: In Italian with an English summary.
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, bovine fecal samples, amplification of
413 bp ifragment inner to
IS900 insertion element, PCR techniques, enzyme
inhibitors.
Wards, Barry J.; Collins, Desmond M. Slow-growing mycobacteria. Eynard,
Natalie; Teissie, Justin [Editors]. Springer Lab Manuals. Electroformation
of Bacteria. Springer-Verlag. 2000; 168-174. ISBN:
354066680X.
Descriptors: bacterial pathogen, infection;
methods, techniques, molecular genetics, Mycobacterium avium,
Mycobacterium bovis, Mycobacterium paratuberculosis,
Mycobacterium tuberculosis, microbiology of the listed species.
Weber, A.; Shaefer, Schmidt R.; Fuchs, D.; Weigl, U. Occurrence of Mycobacterium paratuberculosis
in faecal samples of cattle in Bavaria. Tieraerztliche Umschau.
Feb. 1, 2000; 55(2): 97-99. ISSN: 0049-3864. Note: In German with English and
German summaries.
NAL Call No.: 41.8 T445
Descriptors: fecal samples, 1116 cattle, Mycobacterium
avium subsp. paratuberculosis, incidence of disease in Austria.
Webster, S.R. The financial consequences of ovine Johne's disease for New
South Wales sheep producers. Asian-Australasian Journal of Animal
Science. July 2000; 13(Suppl.): 465-468. ISSN: 1011-2367. Note: In the
supplement: Animal Production for a Consuming World, vol. C edited by
G.M. Stone. Proceedings of the 9th Congress of the Asian-Australasian
Association of Animal Production Societies and 23rd Biennial Conference of the
Australian Society of Animal Production held July 3-7, 2000, Sydney, Australia.
NAL Call No.: SF55.A78A7
Descriptors:
paratuberculosis, Mycobacterium avium subsp. paratuberculosis,
sheep disease, economic impact, Johne's disease, Australia.
Wells, S.J. Biosecurity on dairy operations: hazards and risks.
Journal of Dairy Science. Oct 2000; 83(10); 2380-2386. ISSN:
0022-0302.
NAL Call No.: 44.8 J822
Descriptors: dairy herds, biosafety, Mycobacterium
avium subsp. paratuberculosis, paratuberculosis, risk assessment,
disease transmission, disease control, maternal transmission, calves, hygiene,
cattle manure, waste disposal, bovine diarrhea virus, disease prevalence,
Johne's disease, hazard analysis and critical control point, human heath risks.
Wells, Scott J.; Wagner, Bruce A. Herd-level
risk factors for infection with Mycobacterium paratuberculosis in US
dairies and association between familiarity of the herd manager with the disease
or prior diagnosis of the disease in that herd and use of preventive
measures. Journal of the American Veterinary Medical Association.
May 1, 2000; 216(9): 1450-1457. ISSN: 0003-1488.
NAL Call No.:
41.8 Am3
Descriptors: herd infection status,
Mycobacterium avium subsp. paratuberculosis, management
practices, knowledge of herd manager, Johne’s disease, population bases
cross-sectional study, 1,004 US dairy operations, questionnaires, blood samples,
antibody status, commercial ELISA for testing, multivariable logistic regression
analyses, factors associated with infection, some recommendations.
Wentink, G. H.; Frankena, K.; Bosch, J. C.; Vandehoek, J. E. D.; van den
Berg, Th. Prevention of disease transmission by
semen in cattle. Livestock Production Science. Feb. 2000; 62(3):
207-220. ISSN: 0301-6226.
NAL Call No.: SF1.L5
Descriptors: semen production, bulls, disease surveillance,
EU Directive 88/407 prescribes monitoring of bulls in AI stations, screening for
many diseases including Mycobacterium avium subsp.
paratuberculosis, Johne’s disease, programs.
Whist, S. K.; Storset, A. K.; Larsen, H. J. S. The use of interleukin-2 receptor expression as a
marker of cell-mediated immunity in goats experimentally infected with
Mycobacterium avium ssp. paratuberculosis.
Veterinary Immunology and Immunopathology. March 15, 2000; 73(3-4):
207-218. ISSN: 0165-2427.
NAL Call No.: SF757.2.V38
Descriptors: whole blood, method and technique refinement,
cell-mediated immune response to paratuberculosis, experimentally infected
animals, quantification of interleukin-2 receptor (IL-2R) expression, activated
lymphocytes, in vitro stimulation with Mycobacterium avium subsp.
paratuberculosis derived purified protein derivative (PPDp).
Whitlock, R.H.; Wells, S.J.; Sweeney, R.W.; Van Tiem, J. ELISA and fecal
culture for paratuberculosis (Johne's disease): sensitivity and specificity of
each method. Veterinary Microbiology. Dec 20, 2000; 77(3/4): 387-398.
ISSN: 0378-1135. Note: In the special issue: Paratuberculosis (Johne's
Disease) edited by R. Chiodini. Paper presented at a colloquium held
February 14-18, 1999, Melbourne, Australia.
NAL Call No.:
SF601.V44
Abstract: The sensitivity and
specificity of the ELISA and fecal culture tests for paratuberculosis in dairy
cattle are examined. ELISA and fecal culture data from seven dairy herds where
both fecal cultures and ELISA testing was done concurrently are included. A
cohort of 954 cattle including 697 parturient adults, cultured every 6 months
from 10 herds followed over 4 years served as the basis to determine fecal
culture sensitivity. The fecal culture technique utilized a 2 g sample with
centrifugation and double incubation. Of the 954 cattle cohort of all ages (calf
to adult) that were fecal sampled on the first herd visit, 79 were culture
positive. An additional 131 animals were detected as culture positive over the
next seven tests at 6-month intervals. The sensitivity of fecal culture to
detect infected cattle on the first sampling was 38%. Of the 697 parturient
cattle cohort, 67 were positive on the first fecal culture, while an additional
91 adult cattle were culture positive over the next seven tests, resulting in a
sensitivity of 42% on the first culture of the total animals identified as
culture positive. Animals culled from the herds prior to being detected as
infected and animals always fecal culture negative with culture positive tissues
at slaughter are not included in the calculations. Both groups of infected
cattle will lower the apparent sensitivity of fecal culture. Infected dairy
herds tested concurrently with both fecal culture and ELISA usually resulted in
more than twofold positive animals by culture compared to ELISA. The
classification of infected cattle by the extent of shedding of Mycobacterium
paratuberculosis in the feces helps define the relative proportion of
cattle in each group and therefore the likelihood of detection by the ELISA
test. ELISA has a higher sensitivity in animals with a heavier bacterial load,
i.e. high shedders (75%) compared to low shedders (15%). Repeated testing of
infected herds identifies a higher proportion of low shedders which are more
likely to be ELISA negative. Thus, the sensitivity of the ELISA test decreases
with repeated herd testing over time, since heavy shedders will be culled first
from the herds.
Descriptors: dairy cattle, ELISA,
paratuberculosis, diagnosis, evaluation, feces, cell cultures, age, disease
prevalence, diagnostic techniques, shedding of Mycobacterium,
detection, Mycobacterium avium subsp. paratuberculosis.
Whittington, R. J.; Hope, A. F.; Marshall, D. J.; Taragel, C. A.; Marsh, I.
Molecular epidemiology of Mycobacterium
avium subsp. paratuberculosis: IS900 restriction fragment length
polymorphism and IS1311 polymorphism analyses of isolates from animals and a
human in Australia. Journal of Clinical Microbiology. September
2000; 38(9): 3240-3248. ISSN: 0095-1137.
NAL Call No.:
QR46.J6
Descriptors: strain distribution and
prevalence, 328 isolates, sheep, dairy and beef cattle, goats, alpacas,
rhinoceros, humans, Johne’s disease, restriction fragment length polymorphism
(RFLP) analysis, genomic DNA, BstEII, 12 IS900 types found, sheep and cattle
specific strains, tracing strain dispersion, Australia.
Whittington, R. J.; Reddacliff, L. A.; Marsh, I.; McAllister, S.; Saunders,
V. Temporal patterns and quantification of
excretion of Mycobacterium avium subsp. paratuberculosis in
sheep with Johne's disease. Australian Veterinary Journal. Jan.
2000; 78(1): 34-37. ISSN: 0005-0423.
NAL Call No.: 41.8
Au72
Descriptors: Merino sheep, excretion frequency,
Johne’s disease, fecal culture for 7 sheep, pen and lab experiments, excretion
patterns, possible impact on environmental contamination, multibacillary and
paucibacillary cases.
Whittington, R. J.; Fell,S.; Walker, D.; McAllister, S.; Marsh, I.; Sergeant,
E.; Taragel, C. A.; Marshall, D. J.; Links, I. J. Use of pooled fecal culture for sensitive and economic
detection of Mycobacterium avium subsp. paratuberculosis
infection in flocks of sheep. Journal of Clinical Microbiology.
July 2000; 38(7): 2550-2556. ISSN: 0095-1137.
NAL Call No.:
QR46.J6
Descriptors: sheep, culturing pooled fecal
samples, test sensitivity, multibacillary paratuberculosis, with paucibacillary
paratuberculosis, compared to serologic and histopathic examinations, 335 farms,
test costs, flock testing.
Wildblood, L. A.; Sinclair, M. C.; Stevenson, K.; Jones, D. G. Effects of in vitro infection with mycobacteria on
oxidative metabolism of macrophages. Immunology. December 2000;
101 (Suppl. 1): 125. ISSN: 0019-2805. Note: Annual Congress of the British
Society for Immunology, Harrogate, UK, December 05-08, 2000.
NAL
Call No.: 448.3 Im6 Suppl.
Descriptors:
Mycobacterium avium subsp. paratuberculosis, pathogen,
Mycobacterium smegmatis, effects on superoxide.
Wraight, M.D.; McNeil, J.; Beggs, D.S.; Greenall, R.K.; Humphris, T.B.;
Irwin, R.J.; Jagoe, S.P.; Jemmeson, A.; Morgan, W.F.; Brightling, P.; Anderson,
G.A.; Mansell, P.D. Compliance of Victorian dairy farmers with current calf
rearing recommendations for control of Johne's disease. Veterinary
Microbiology. Dec 20, 2000; 77(3/4): 429-442. ISSN: 0378-1135. Note: In the
special issue: Paratuberculosis (Johne's Disease) edited by R. Chiodini.
Paper presented at a colloquium held February 14-18, 1999, Melbourne, Australia.
NAL Call No.: SF601.V44
Abstract:
Questionnaires were posted to 800 randomly selected registered Victorian dairy
farmers in 1996. Five hundred and thirty-four responses were received and
analysed. Johne's disease (JD) had been diagnosed on the farm of 13.2% of
respondents in the last 5 years. JD was rated second only to neonatal diarrhoea
in importance as a disease of calves, even though other diseases occurred more
frequently. However, there was a low level of compliance with JD control
recommendations by the respondents. There was no significant difference in the
number of JD control recommendations adopted by farmers between the three major
Victorian regions. There was a significant difference in compliance between
farms having had a diagnosed case of JD and those that had not. Although there
is awareness among dairy farmers of the importance of JD, there appears to be a
poor implementation of measures by farmers to prevent the spread of the disease.
Current JD control recommendations and the method of information transfer to
Victorian dairy farms should be reassessed to ensure that dairy heifers are
reared with minimal risk of transmission of JD.
Descriptors: dairy cattle, calves, Johne's disease,
Mycobacterium avium subsp. paratuberculosis, dairy farms,
farmers' attitudes, animal rearing techniques, disease control measures,
diagnosis, neonatal diarrhea, geographical variation, incidence, diffusion of
information, Victoria, Australia.
Balci, A. Tulay; Wilbey, R. Andrew. Determination of acid phosphatase activity in heat
treated milks by the Fluorophos Test System. International Journal of
Dairy Technology. May 1999; 52(2): 56-58. ISSN: 1364-727X.
NAL
Call No.: SF221.I58
Descriptors: Fluorophos Test
System(R), measurement of acid phosphatase, fruit juices and milk, enhance the
destruction of Mycobacterium avium subsp. paratuberculosis.
Bannantine, John P.; Stabel, Judith R. Identification of Mycobacterium
paratuberculosis antigens present within infected macrophages.
Molecular Biology of the Cell. Nov. 1999; 10 (Suppl. ): 181a. ISSN:
1059-1524. Note: 39th Annual Meeting of the American Society for Cell Biology,
Washington, D.C., USA, December 11-15, 1999.
NAL Call No.:
QH604.C452
Descriptors: white cells, macrophages,
isolation and identification of intracellar bacteria, Johne’s diseases.
Burrells, C.; Clarke, C.J.; Colston, A.; Kay, J.M.; Porter, J.; Little, D.;
Sharp, J.M. Interferon-gamma and interleukin-2 release by lymphocytes derived
from the blood, mesenteric lymph nodes and intestines of normal sheep and those
affected with paratuberculosis (Johne's disease). Veterinary Immunology
and Immunopathology. May 1999; 68(2/4): 139-148. ISSN:
0165-2427.
URL: http://www.sciencedirect.com/science?_ob=JournalURL&_cdi=5189&_auth=y&_acct=C000052423&_version=1&_urlVersion=0&_userid=4250348&md5=f5f60e05fe0e447c7311059c14754776
NAL
Call No.: SF757.2.V38
Descriptors: sheep,
paratuberculosis, interferon, interleukin-2, lymphocytes, lymph nodes,
intestines, cytokines, Mycobacterium paratuberculosis, lesions, major
histocompatibility complex, cd4+ lymphocytes, Mycobacterium avium
subsp. paratuberculosis.
Cobb, Alison J.; Frothingham, Richard. The
GroES antigens of Mycobacterium avium and Mycobacterium
paratuberculosis. Veterinary Microbiology. June 1, 1999;
67(1): 31-35. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors: similarities and differences between species,
possible vaccine agent, Mycobacterium avium subsp.
paratuberculosis.
Crabb, J.H.; Sweeney, R.W.;
Cressman, H.; McAdams, S.; Whitlock,
R.H.
New rapid diagnostic test for Johne's disease in cattle. Proceedings of the Annual Conference of the
American Association of Bovine Practitioners Conference. 1999; (32): 247-249. Note: Meeting held Sept. 23-26, 1999,
NAL
Call No.:
SF961.A5
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis, diagnostic
techniques.
Dei, R.; Tortoli, E.; Bartoloni, A.; Simonetti, M. T.; Lillini, E. HPLC does not differentiate Mycobacterium
paratuberculosis from Mycobacterium avium. Veterinary
Microbiology. March 12, 1999; 65(3): 209-213. ISSN:
0378-1135.
NAL Call No.: SF601.V44
Descriptors: testing of isolates, potential detection
method, no significant differences.
Dotta, U.; Guglielmino, R.; Cagnasso, A.; D' Angelo, A.; Prato, S.; Bosso, M.
Effects of subclinical bovine paratuberculosis
on in-vitro polymorphonuclear neutrophil migration. Journal of
Comparative Pathology. Nov. 1999; 121(4): 399-403. ISSN:
0021-9975.
NAL Call No.: 41.8 J82
Descriptors: white blood cells, neutrophils, subclinical
infection, blood picture, Mycobacterium avium subsp.
paratuberculosis.
Driemeier, David; Farias, Cruz Claudio Estevao; Pereira, Gomes Marcos Jose;
Corbellini, Luis Gustavo; Loretti, Alexandre Paulino; Colodel, Edson Moleta.
Clinical and pathological aspects of bovine
paratuberculosis in Rio Grande do Sul, southern Brazil. Pesquisa
Veterinaria Brasileira. July-Dec. 1999; 19(3-4): 109-115. ISSN: 0100-736X.
Note: In Portuguese with English and Portuguese summaries.
NAL Call
No.: SF756.37.B7 P5
Descriptors: dairy herd,
clinical signs, cattle, necropsy findings described, Mycobacterium
avium subsp. paratuberculosis cultured in Herrold's medium
enriched with mycobactin, many tissues cultured.
El Zaatari, Fouad A. K.; Naser, Saleh A.; Hulten, Kristina; Burch, Paula;
Graham, David Y. Characterization of
Mycobacterium paratuberculosis p36 antigen and its seroreactivities in
Crohn's disease. Current Microbiology. Aug. 1999; 39(2): 115-119.
ISSN: 0343-8651.
NAL Call No.: QR1.C78
Descriptors: possible zoonotic relationships between
Johne’s and Crohn’s, immunoblotting technique, reactivity of human sera from
patients with Crohn’s indicates Mycobacteria may be involved.
Ellingson, Jay L. E.; Stabel, Judith R. Species-specific genetic identification of
Mycobacterium paratuberculosis. Official Gazette of the
United States Patent and Trademark Office Patents. [e-file] Nov. 16, 1999;
1228(3): No pagination. ISSN: 0098-113.
NAL Call No.:
T223.A21
Abstract: An M. paratuberculosis
gene referred to as hspX provides a useful target region for the construction of
suitable probes and primers that are species-specific for distinguishing M.
paratuberculosis from related mycobacteria in a test sample. M.
paratuberculosis is the causative agent of Johne's disease and has been
isolated from human patients with Crohn's disease.
Descriptors: hspX gene, possible species specific probes
and primers, strain differentiation, Johne’s disease agent, Crohn’s disease,
Mycobacterium avium subsp. paratuberculosis.
Elrod, C.C. Mycobacterium paratuberculosis: worse than the Y2K bug. Proceedings Cornell Nutrition Conference for
Feed Manufacturers. 1999; (61): 128-132. ISSN: 0885-7687.
NAL Call No.: 389.79 C81
Descriptors: Mycobacterium avium subsp. paratuberculosis, mycobacterial diseases, disease course, disease
transmission, disease control, herd health status, zoonoses, cattle, Johne’s
disease.
Englund, Stina; Ballagi, Pordany, Andras; Bolske, Goran; Johansson, Karl
Erik. Single PCR and nested PCR with a mimic
molecule for detection of Mycobacterium avium subsp.
paratuberculosis. Diagnostic Microbiology and Infectious
Disease. March 1999; 33(3): 163-171. ISSN: 0732-8893.
Descriptors: detection method, nested PCR based on IS900
plus an internal control molecule, to confirm growth, bovine tissues, primary
bacterial cultures, considered a useful screening tool.
Feola, R. P.; Collins, M. T.; Czuprynski, C. J. Hormonal modulation of phagocytosis and intracellular
growth of Mycobacterium avium ss. paratuberculosis in bovine
peripheral blood monocytes. Microbial Pathogenesis. Jan. 1999;
26(1): 1-11. ISSN: 0882-4010.
NAL Call No.: QR175.M53
Descriptors: growth hormone, prolactin, vitamin D3,
luteinizing hormone, oxytocin, hormone effects on phagocytosis and intracellular
survival, bovine peripheral blood monocytes, intracellular bacillary growth,
Mycobacterium avium subsp. paratuberculosis.
Freeman, Roger; Magee, John; Barratt, Anne; Wheeler, Janice; Steward,
Michael; Lee, Maureen; Piggott, Nigel; Grobusch, Martin P. Rapid immunochromatographic assay for diagnosis of
tuberculosis: Antibodies detected may not be specific. Journal of
Clinical Microbiology. June 1999; 37(6): 2111-2112. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors:
Mycobacterium africanum, Mycobacterium avium, Mycobacterium bovis,
Mycobacterium chelonei, Mycobacterium fortuitum, Mycobacterium kansasii,
Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti,
Mycobacterium paratuberculosis, Mycobacterium smegmatis, Mycobacterium
tuberculosis, Mycobacterium vaccae, Mycobacterium avium subsp.
paratuberculosis, 38 kilodalton antigen.
Garry, F. Producers need to know facts about Johne's disease. Feedstuffs. 1999; 71(19): 12-15. ISSN:
0014-9624.
NAL Call No.: 286.81 F322
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, disease control, disease prevention.
Gasteiner, J.; Wenzl, H.; Fuchs, K.; Jark, U.; Baumgartner, W. Serological cross-sectional study of paratuberculosis
in cattle in Austria. Journal of Veterinary Medicine Series B.
Sept. 1999; 46(7): 457-466. ISSN: 0931-1793.
NAL Call No.:
41.8 Z52
Descriptors: 11,028 cattle, 2757 farms,
prevalence of serum antibodies, Mycobacterium avium subsp.
paratuberculosis, epidemiological study, ELISA (Allied Monitors), 6
year old Holstein Frisian cattle, various regional differences, Austria.
Gilot, Philippe; Coetsier, C. Specificity of
the 34-kilodalton immunodominant protein of Mycobacterium avium subsp.
paratuberculosis (and reply). Clinical and Diagnostic
Laboratory Immunology. Jan. 1999; 6(1): 146-148. ISSN: 1071-412X.
Descriptors: bacterial protein, specificity,
Mycobacterium avium subsp. paratuberculosis.
Grant, I. R.; Ball, H. J.; Rowe, M. T. Effect
of higher pasteurization temperatures, and longer holding times at 72 degree C,
on the inactivation of Mycobacterium paratuberculosis in milk.
Letters in Applied Microbiology. June 1999; 28(6): 461-465. ISSN:
0266-8254.
NAL Call No.: QR1.L47
Descriptors: raw milk, inoculated with 3 strains of
Mycobacterium avium subsp. paratuberculosis, NCTC 8578, B2 and
DVL 943 various heat treatments, survivability.
Greig, Alastair; Stevenson, Karen; Henderson, Dennis; Perez, Valentin;
Hughes, Valerie; Pavlik, Ivo; Hines, Murray E. II; McKendrick, Iain; Sharp, J.
Michael. Epidemiological study of
paratuberculosis in wild rabbits in Scotland. Journal of Clinical
Microbiology. June 1999; 37(6): 1746-1751. ISSN: 0095-1137.
NAL
Call No.: QR46.J6
Descriptors: prevalence, 22
farms, rabbits as vectors, cattle and rabbit disease interactions, molecular
genetic typing looking for strain differences, interspecies transmission,
epidemiology, wildlife a reservoirs and vectors.
Gyimesi, Zoltan S.; Stalis, Ilse H.; Miller, Janice M.; Thoen, Charles O.
Detection of Mycobacterium avium subspecies
avium in formalin-fixed, paraffin-embedded tissues of captive exotic birds using
polymerase chain reaction. Journal of Zoo and Wildlife Medicine.
Sept. 1999; 30(3): 348-353. ISSN: 1042-7260.
NAL Call No.:
SF601 J6
Descriptors: methods, techniques,
Mycobacterium avium subsp. paratuberculosis, avian
tuberculosis, diagnostic study, formalin fixed, paraffin embedded archival avian
tissues, testing by polymerase chain reaction (PCR), reliability, diagnostic
value of test.
Hajtos, Istvan; Glavits, Robert; Malik, Galal. Paratuberculosis in Northern Hungarian sheep
flocks. Magyar Allatorvosok Lapja. July 1999; 121(7): 383-390.
ISSN: 0025-004X. Note: In Hungarian with English and Hungarian summaries.
NAL Call No.: 41.8 V644
Descriptors:
Hungarian Merino sheep, 5 flocks, occurrence of Johne’s disease, clinical and on
the spot examinations, clinical signs, histology findings, ileum, mesenterial
lymph nodes, smear samples of ileal mucosa, Mycobacterium avium subsp.
paratuberculosis, etiology, pathology.
Harris, N. Beth; Feng, Zhengyu; Liu, Xiaofei; Cirillo, Suat L. G.; Cirillo,
Jeffrey D.; Barletta, Raul G. Development of a
transposon mutagenesis system for Mycobacterium avium subsp.
paratuberculosis. FEMS Microbiology Letters. June 1,
1999; 175(1): 21-26. ISSN: 0378-1097.
NAL Call No.: QR1.F44
Abstract: Mycobacterium avium subspecies paratuberculosis, a slow-growing
Mycobacterium, is the causative agent of Johne's
disease. Although M. paratuberculosis is difficult to manipulate genetically,
our laboratory has recently demonstrated the ability to introduce DNA into these
bacteria by transformation and phage infection. In the current study we develop
the first transposon mutagenesis system for M. paratuberculosis using the conditionally replicating
mycobacteriophage phAE94 to introduce the mycobacterial transposon Tn5367.
Southern blotting and sequence analysis demonstrated that the transposon insertion sites are distributed relatively
randomly throughout the M. paratuberculosis genome. We constructed a comprehensive
bank of 5620 insertion mutants using this transposon.
The transposition frequency obtained using this delivery system was 1.0 x 10(-6)
transposition events per recipient cell. Auxotrophic
mutants were observed in this library at a frequency of
0.3%.
Descriptors: methods to introduce
DNA into bacteria, transformation and phage infection, first transposon
mutagenesis system, conditionally replicating mycobacteriophage phAE94,
insertion sites, 5620 insertion mutants.
Harris, N. B.; Liu, X.; Cirillo, J. D.; Barletta, R. G. Transposon mutagenesis of Mycobacterium
paratuberculosis. Abstracts of the General Meeting of the
American Society for Microbiology. 1999; 99: 650. ISSN: 1060-2011. Note:
99th General Meeting of the American Society for Microbiology, Chicago,
Illinois, USA, May 30-June 3, 1999.
NAL Call No.: QR1.A5
Descriptors: Mycobacterium avium subsp.
paratuberculosis, Tn5367 transposon, bacteriophage mediated delivery,
aph gene mutation.
Hermon, Taylor J.; Cheng, J.; Bull, T. Mycobacterium avium subsp.
paratuberculosis in milk: An animal and human pathogen.
Journal of Microbiological Methods. Nov. 1999; 38(3): 217. ISSN:
0167-7012. Note: European Meeting on Molecular Diagnostics, Scheveningen, The
Hague, Netherlands, October 13-16, 1999.
NAL Call No.:
QR65.J68
Descriptors: milk, dairy products,
zoonotic disease, food contaminant, description of biology, issues and concerns.
Higgins, R. Infections of uncertain zoonotic
origin. Medecin Veterinaire du Quebec. 1999; 29(1): 29-35. ISSN:
0225-9591. Note: In French.
NAL Call No.: SF602.M8
Descriptors: dogs, humans, pigs, various diseases
including, Mycobacterium paratuberculosis.
Hubbard, James; Surawicz, Christina M. Etiological role of Mycobacterium in Crohn's
disease: An assessment of the literature. Digestive Diseases.
1999; 17(1): 6-13. ISSN: 0257-2753.
Descriptors:
Mycobacterium chelonae, Mycobacterium paratuberculosis, etiological
role, pathogens, humans, possible zoonotic disease.
Johnson, Ifearulundu Yvette; Kaneene, John B. Distribution and environmental risk factors for
paratuberculosis in dairy cattle herds in Michigan. American Journal
of Veterinary Research. May 1999; 60(5): 589-596. ISSN: 0002-9645.
NAL Call No.: 41.8 Am3A
Descriptors:
3,886 dairy cattle tested, herds, soil risk factors, epidemiology of infection,
pH, iron content, lime addition, pastures, exercise lots, questionnaire on
management practices, productivity levels, Michigan.
Johnson, Ifearulundu Yvette; Kaneene, John B.; Lloyd, James W. Herd-level economic analysis of the impact of
paratuberculosis on dairy herds. Journal of the American Veterinary
Medical Association. March 15, 1999; 214(6): 822-825. ISSN:
0003-1488.
NAL Call No.: 41.8 Am3
Descriptors: herd level analysis, economic losses, dairy
cattle, herds, Mycobacterium avium subsp. paratuberculosis,
cross-sectional study design, sample population, a multistage stratified random
sample of 121 dairy herds, questionnaires were filled out regarding management
practices, herd productivity, labor use, expenditures, blood sampling, Michigan.
Marsh, I.; Whittington R.; Cousins, D. PCR-restriction endonuclease analysis for
identification and strain typing of Mycobacterium avium subsp.
paratuberculosis and Mycobacterium avium subsp. avium
based on polymorphisms in IS1311. Molecular and Cellular Probes.
April 1999; 13(2): 115-126. ISSN: 0890-8508.
NAL Call No.:
RB43.7.M63
Descriptors: cattle, sheep, DNA,
Mycobacterium avium, IS1311 gene, IS900 gene, Mycobacterium avium
avium, Mycobacterium avium subsp. paratuberculosis,
possible diagnostic agent, restriction endonuclease analysis products
interpretation.
McDonald, W. L.; Ridge, S. E.; Hope, A. F.; Condron, R. J. Evaluation of diagnostic tests for Johne's disease in
young cattle. Australian Veterinary Journal. Feb. 1999; 77(2):
113-119. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: development of immune responses, calves, oral
dosing for experimental infection, Mycobacterium avium subsp.
paratuberculosis, natural infection, evaluation of potential diagnostic
tests, testing fecal shedding, Johne’s disease, difficulties in diagnosis.
Moreira, Ana Rita; Paolicchi, Fernando; Morsella, Claudia; Zumarraga, Martin;
Cataldi, Angel; Fabiana, Bigi; Alicia, Alito; Piet, Overduin; van Soolingen,
Dick; Maria, Isabel Romano. Distribution of
IS900 restriction fragment length polymorphism types among animal
Mycobacterium avium subsp. paratuberculosis isolates from
Argentina and Europe. Veterinary Microbiology. Dec. 1999; 70(3-4):
251-259. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors: cattle and deer isolates, 61 isolates, 4
different patterns, BstII digests of genomic DNA, patterns described, Argentina.
Murray, Alan; Gheorghiu, Marin; Gicquel, Brigitte. Promoter of M. paratuberculosis and its use
for the expression of immunogenic sequences. Official Gazette of the
United States Patent and Trademark Office Patents. [e-file] Oct. 19, 1999;
1227(3): No pagination. ISSN: 0098-1133.
NAL Call No.:
T223.A21
Abstract: The invention relates to a
nucleotide sequence which is present at a position adjacent to the 5' end of the
reverse sequence complementary to the open reading frame coding for a potential
transposase contained in the insertion element IS900 in Mycobacterium
paratuberculosis. The nucleotide sequence has promoter functions and contains
important signals for the regulation of transcription and translation. The
invention also relates to methods for cloning and expressing heterologous
proteins using such regulatory sequences, to vectors and transformed host cells
containing these sequences, and to immunogenic compositions prepared by
expression of nucleotide sequences placed under control of these regulatory
sequences.
Descriptors: bacterial genetics,
Mycobacterium avium subsp. paratuberculosis, promoter
functions, regulation of transcription and translation.
Naser, S.; Fenster, W.; Romero, C.; Schwartz, D.; Campbell, D.; Piromalli,
C.; Shafran, I. In vitro evaluation of
anti-tuberculosis drugs against Mycobacterium avium ss.
paratuberculosis for treatment of Crohn's disease.
Gastroenterology. April 1999; 116(4 Pt. 2): A783. ISSN: 0016-5085. Note:
Digestive Disease Week and the 100th Annual Meeting of the American
Gastroenterological Association, Orlando, Florida, USA, May 16-19, 1999.
NAL Call No.: RC799.G37
Descriptors:
Mycobacterium avium subsp. paratuberculosis, susceptibility to
antibiotics, clarithromycin, ethambutol, isoniazid, kanamycin, pyrazinamide,
rifampicin, streptomycin.
Naser, Saleh; Shafran, Ira; El Zaatari, Fouad. Mycobacterium avium subsp.
paratuberculosis in Crohn's disease is serologically positive.
Clinical and Diagnostic Laboratory Immunology. March 1999; 6(2): 282.
ISSN: 1071-412X.
Descriptors: human, Mycobacterium
avium subsp. paratuberculosis, Mycobacterium bovis,
detection.
Ott, Stephen L.; Wells, Scott J.; Wagner, Bruce A. Herd-level economic losses associated with Johne's
disease on US dairy operations. Preventive Veterinary Medicine.
June 11, 1999; 40(3-4): 179-192. ISSN: 0167-5877.
NAL Call No.:
SF601.P7
Descriptors: USDA National Animal Health
Monitoring System's (NAHMS), dairy cattle study, economic losses,
Mycobacterium avium subsp. paratuberculosis, high prevalence
herds, milk reductions, culling cows, losses of $200-250 million annually.
Pavlik, Ivo; Horvathova, Alica; Dvorska, Lenka; Bartl, Jiri; Svastova, Petra;
du Maine, Robin; Rychlik, Ivan. Standardisation
of restriction fragment length polymorphism analysis for Mycobacterium
avium subspecies paratuberculosis. Journal of
Microbiological Methods. Oct. 1999; 38(1-2): 155-167. ISSN: 0167-7012.
NAL Call No.: QR65.J68
Descriptors:
DNA, 1008 strains, digestion with PstI and BstII, hybridized with standard IS900
probe, DNA fingerprints, GelCompar, 13 fragment length polymorphisms.
Puyang, Xiaoling; Lee, Karen; Pawlichuk, Corey; Kunimoto, Dennis Y. IS1626, a new IS900-related Mycobacterium
avium insertion sequence. Microbiology. Nov. 1999; 145(11):
3163-3168. ISSN: 1350-0872.
NAL Call No.: QR1.J64
Nucleotide Sequence: AF071067 GenBank, amino acid
nucleotide sequence.
Descriptors: bacterial identifying
genetics, high-stringency hybridization with the pMB22/S12 probe from IS900 of
Mycobacterium avium subsp. paratuberculosis, 3 clones.
Reichel, Michael P.; Kittelberger, Reinhold; Penrose, Mary E.; Meynell, Robyn
M.; Cousins, Debby; Ellis, Trevor; Mutharia, Lucy M.; Sugden, Edward A.; Johns,
Andrea H.; de Lisle, Geoffrey W. Comparison of
serological tests and faecal culture for the detection of Mycobacterium
avium subsp. paratuberculosis infection in cattle and analysis of
the antigens involved. Veterinary Microbiology. April 1, 1999;
66(2): 135-150. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors: cattle, 341 sera samples,106 fecal samples,
assay evaluation, ELISA, complement fixation test, detection assay, comparison
study.
Sinclair, M. C.; Wildblood, L. A.; Stevenson, K.; Jones, D. G. Cytokine mRNA production in ovine alveolar macrophages
infected with mycobacteria. Immunology. Dec. 1999; 98 (Suppl. 1):
52. ISSN: 0019-2805. Note: Joint Congress of the British Society for Immunology
and the British Society for Allergy & Clinical Immunology, Harrogate,
England, UK, November 30-December 03, 1999.
NAL Call No.:
448.3 Im6 Suppl.
Descriptors: infection with
Mycobacterium avium subsp. paratuberculosis, cytokines.
Sinclair, M. C.; Wildblood, L. A.; Stevenson, K.; Beard, P.; Sharp, J. M.;
Hopkins, J.; Jones, D. G. The initial T-cell and
cytokine profile of lambs experimentally infected with mycobacteria.
Immunology. Dec. 1999; 98(Suppl. 1): 52. ISSN: 0019-2805. Note: Joint
Congress of the British Society for Immunology and the British Society for
Allergy & Clinical Immunology, Harrogate, England, UK, November 30-December
03, 1999.
NAL Call No.: 448.3 Im6 Suppl.
Descriptors: sheep, lambs, Mycobacterium
infection, cytokines, white cell profiles, experimental infection.
Suenaga, Kensuke; Yokoyama, Yuichi; Nishimori, Isao; Sano, Shuichi; Morita,
Masanori; Okazaki, Kazuichi; Onishi, Saburo. Serum antibodies to Mycobacterium
paratuberculosis in patients with Crohn's disease. Digestive
Diseases and Sciences. June 1999; 44(6): 1202-1207. ISSN: 0163-2116.
NAL Call No.: 448.8 Am324
Descriptors:
immunology, humans with Crohn’s disease, serum antibodies, IgG, IgA, IgM, ELISA
assay on sera, unique response to immune response to Mycobacterium
avium subsp. paratuberculosis in patients with Crohn’s.
United States. Animal and Plant Health
Inspection Service. Veterinary Services. Centers for Epidemiology and Animal Health. National Animal Health
Monitoring System (
URL: http://www.aphis.usda.gov/vs/ceah/cnahs/nahms/beefcowcalf/Beef97/bf97john.pdf
NAL
Call No.:
aSF967.P33 W43 1999
Descriptors: overview of the disease,
symptoms, control factors, Mycobacterium
avium subsp. paratuberculosis, paratuberculosis,
Valentin, Weigand Peter; Goethe, Ralph. Pathogenesis of Mycobacterium avium subsp.
paratuberculosis infections in ruminants: Still more questions than
answers. Microbes and Infection. Nov. 1999; 1(13): 1121-1127.
ISSN: 1286-4579. Note: A review.
NAL Call No.: QR180 M53
Descriptors: Johne’s disease, pathogenesis, chronic
enteritis of ruminants, biology of infection and host interaction are unknown.
Waters, W. R.; Stabel, J. R.; Sacco, R. E.; Harp, J. A.; Pesch, B. A.;
Wannemuehler, M. J. Antigen-specific B-cell
unresponsiveness induced by chronic Mycobacterium avium subsp.
paratuberculosis infection of cattle. Infection and
Immunity. April 1999; 67(4): 1593-1598. ISSN: 0019-9567
NAL Call
No.: QR1.I57
Abstract: Mycobacterium avium subsp. paratuberculosis
infection of cattle results in a chronic granulomatous enteritis. Clinical disease (i.e. cachexia, diarrhea and high fecal bacterial counts) is
preceded by a lengthy subclinical stage of disease.
The immunologic mechanisms associated with the progression of infected cattle
from subclinical to clinical disease are unclear. In
this study, a cell proliferation assay was used in combination with flow cytometry to compare peripheral blood lymphocyte responses
of cattle with subclinical paratuberculosis to responses of cattle with clinical paratuberculosis. B cells from cattle with subclinical disease proliferated vigorously upon stimulation
with M. avium subsp. paratuberculosis
antigen, with up to 12.4% of the total B cells responding. However, B cells from
cattle with clinical disease did not proliferate upon antigen stimulation
despite good proliferation in response to concanavalin
A stimulation. In addition, these animals had high
percentages of peripheral blood B cells. B cells from noninfected animals did not proliferate upon M. avium subsp. paratuberculosis antigen
stimulation. Thus, it appears that B-cell proliferation is a sensitive indicator
of subclinical Johne's
disease. Furthermore, the immunologic mechanisms responsible for the
antigen-specific unresponsiveness of peripheral blood B cells may be significant
in the eventual progression from subclinical to
clinical Johne's disease in cattle.
Descriptors: cattle, Johne’s disease,
description of progression of disease from subclinical to clinical states,
immunology associated with progression, cell proliferation assay, flow
cytometry, peripheral blood lymphocyte responses, B cells, antigen stimulation.
Whittington, R. J.; Reddacliff, L.; Marsh, I.; Saunders, V. Detection of Mycobacterium avium subsp.
paratuberculosis in formalin-fixed paraffin-embedded intestinal tissue
by IS900 polymerase chain reaction. Australian Veterinary Journal.
June 1999; 77(6): 392-397. ISSN: 0005-0423.
NAL Call No.:
41.8 Au72
Descriptors: evaluation, comparison
study, DNA extraction methods, formalin-fixed, paraffin-embedded tissues,
detection of Mycobacterium avium subsp. paratuberculosis by
IS900 PCR, disease confirmation, ruminants, experimental laboratory study, three
DNA extraction methods used.
Whittington, R. J.; Marsh, I.; McAllister, S.; Turner, M. J.; Marshall, D.
J.; Fraser, C. A. Evaluation of modified BACTEC
12B radiometric medium and solid media for culture of Mycobacterium
avium subsp. paratuberculosis from sheep. Journal of
Clinical Microbiology. April 1999; 37(4): 1077-1083. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors:
diagnosis, evaluate the culture of Mycobacterium avium subsp.
paratuberculosis, sheep, modified BACTEC 12B radiometric medium,
sensitivity of culture, histopathology, evaluate a range of solid media.
Williams, Stephanie L.; Harris, N. Beth; Barletta, Raul G. Development of a firefly luciferase-based assay for
determining antimicrobial susceptibility of Mycobacterium avium subsp.
paratuberculosis. Journal of Clinical Microbiology. Feb.
1999; 37(2): 304-309. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors: evaluation of antimicrobial agents,
Mycobacterium avium subsp. paratuberculosis, firefly
luciferase-based assay, determining drug susceptibilities, amikacin,
clarithromycin, ethambutol, isoniazid, kanamycin, rifabutin, D-cycloserine,
suggested drug therapy combinations.
Zhao, Ben Yang; Czuprynski, Charles J.; Collins, Michael T. Intracellular fate of Mycobacterium avium
subsp. paratuberculosis in monocytes from normal and infected,
interferon-responsive cows as determined by a radiometric method.
Canadian Journal of Veterinary Research. Jan. 1999; 63(1): 56-61. ISSN:
0830-9000. Note: In English with English and French summaries.
NAL
Call No.: SF601.C24
Descriptors: comparison study,
bovine monocytes, normal and infected cows, strong Th1-like cellular immune
response to ingest and inhibit the intracellular growth, radiometric (BACTEC)
culture, standard plate counting, microscopic counting of acid-fast stained
monocyte monolayers.
Zimmer, K.; Drager, K.G.; Klawonn, W.; Hess, R.G. Contribution to the
diagnosis of Johne's disease in cattle. Comparative studies on the validity of
Ziehl-Neelsen staining, faecal culture and a commercially available DNA-probe
test in detecting Mycobacterium paratuberculosis in faeces from cattle.
Journal of Veterinary Medicine. Mar 1999; 46(2): 137-140. ISSN:
0931-1793.
NAL Call No.: 41.8 Z52
Descriptors: cattle, Mycobacterium avium subsp.
paratuberculosis, feces, diagnosis, paratuberculosis, experimental
infection, diagnostic techniques, asymptomatic infections.
Zimpernik, I.; Awad, Masalmeh M.; Baumgartner, W. M. avium subspecies paratuberculosis
strains isolated from ruminants in Austria. Tieraerztliche
Umschau. June 1, 1999; 54(6): 335-338. ISSN: 0049-3864. Note: In German with
English and German summaries.
NAL Call No.: 41.8 T445
Descriptors: pathogen survey, intestinal contents,
intestines, lymph nodes, cattle, sheep, ruminants, 10 base oligonucleotides, 5
different DNA fingerprints, Mycobacterium avium subsp.
paratuberculosis, Austria.
Bartley, C. B.; Sweeney, M. T.; Plaunt, M. R. Growth and detection of Mycobacteria
paratuberculosis in the ESP Culture System II. Abstracts of the
General Meeting of the American Society for Microbiology. 1998; 98: 507.
ISSN: 1060-2011. Note: 98th General Meeting of the American Society for
Microbiology, Atlanta, Georgia, USA, May 17-21, 1998.
NAL Call No.:
QR1.A5
Descriptors: bacterial culture,
methodologies, Mycobacterium avium subsp. paratuberculosis.
Begara, Mcgorum I.; Wildblood, L. A.; Clarke, C. J.; Connor, K. M.;
Stevenson, K.; McInnes, C. J.; Sharp, J. M.; Jones, D. G. Early immunopathological events in experimental ovine
paratuberculosis. Veterinary Immunology and Immunopathology. May
29, 1998; 63(3): 265-287. ISSN: 0165-2427.
NAL Call No.:
SF757.2.V38
Descriptors: sheep, experimental oral
infection, less than 2 week old lambs, neonatal, cervine isolate,
Mycobacterium avium subsp. paratuberculosis, investigation of
bacteriological, histopathological and immunological changes up to 8 weeks of
age, focal granuloma in Jejunal and ileal Peyer’s patches, CD8+ and CD2+
lymphocyte numbers.
Bewley, J. Controlling Johne's disease in
dairy cattle. Journal of Dairy Science. 1998; 81(Suppl. 1): 380.
ISSN: 0022-0302. Note: Joint Meeting of the American Dairy Science Association
and the American Society of Animal Science, Denver, Colorado, USA, July 28-31,
1998.
NAL Call No.: SF221 A4
Descriptors: dairy cattle, Mycobacterium avium
subsp. paratuberculosis, disease prevention and control,
management and husbandry systems.
Billard, Patrick; Dubow, Michael S. Bioluminescence-based assays for detection and
characterization of bacteria and chemicals in clinical laboratories.
Clinical Biochemistry. Feb. 1998; 31(1): 1-14. ISSN: 0009-9120.
NAL Call No.: RB40.C6
Descriptors:
application of bioluminescence, usefulness of bacterial (lux) and eucaryotic
(luc) luciferase genes, examples of value as "reporters" of many endpoints,
various enteric pathogenic organisms, Mycobacterium avium,
Mycobacterium avium subsp. paratuberculosis, Mycobacterium
tuberculosis.
Brooks, A. Quality of UK milk to be
studied. British Medical Journal BMJ. Aug. 22, 1998; 317(7157):
491. ISSN: 0959-8138.
Descriptors: possible link between
Mycobacterium avium subsp. paratuberculosis and Crohn's
disease, study on microbial content of milk, United Kingdom.
Bull, T. J.; Tizard, M.; Martin, H.; Millar, D.; Doran, T.; Hermon, Taylor J.
The GS element in Mycobacterium avium
ss. paratuberculosis: A mycobacterial pathogenicity island.
Abstracts of the General Meeting of the American Society for
Microbiology. 1998; 98: 509. ISSN: 1060-2011. Note: 98th General Meeting of
the American Society for Microbiology, Atlanta, Georgia, USA, May 17-21, 1998.
NAL Call No.: QR1.A5
Descriptors:
virulence associated gene, GS element, pathogenic bacteria, Mycobacterium
avium subsp. paratuberculosis, Johne's disease.
Burrells, C.; Clarke, C.J.; Colston, A.; Kay, J.M.; Porter, J.; Little, D.;
Sharp, J.M. A study of immunological responses of sheep clinically-affected
with paratuberculosis (Johne's disease). The relationship of blood, mesenteric
lymph node and intestinal lymphocyte responses to gross and microscopic
pathology. Veterinary and Immunology and Immunopathology. Dec 11,
1998; 66(3/4): 343-358. ISSN: 0165-2427.
NAL Call No.:
SF757.2.V38
Descriptors: sheep, paratuberculosis, immune
response, blood, lymph nodes, intestines, lymphocytes, pathology, infections,
Mycobacterium paratuberculosis, bacterial proteins, feces, polymerase
chain reaction, identification, Mycobacterium avium subsp.
paratuberculosis, Mycobacterium avium subsp. silvaticum,
Johne's disease.
Carbonell, P. Histopathological diagnosis of Johne's disease. Australian Veterinary Journal. 1998; 76(7)
499. ISSN:
0005-0423.
URL: http://www.ava.com.au/avjpast.php?journalid=9&plink=avj03.htm
NAL
Call No.:
41.8 AU72
Descriptors: cattle, sheep, Mycobacterium avium subsp. paratuberculosis, paratuberculosis, histopathology, diagnostic techniques.
Cetinkaya, B.; Erdogan, H.M.; Morgan, K.L. Prevalence, incidence and geographical
distribution of Johne's disease in cattle in
URL: http://veterinaryrecord.bvapublications.com/
NAL
Call No.: 41.8
V641
Descriptors: dairy cattle, dairy
herds, Mycobacterium avium subsp. paratuberculosis,
disease prevalence, incidence, geographical distribution, farm surveys,
livestock numbers, vaccination,
Choy, E.; Whittington, R. J.; Marsh, I.; Marshall, J.; Campbell, M. T. A method for purification and characterisation of
Mycobacterium avium subsp. paratuberculosis from the
intestinal mucosa of sheep with Johne's disease. Veterinary
Microbiology. Nov. 1998; 64(1): 51-60. ISSN: 0378-1135.
NAL Call
No.: SF601.V44
Descriptors: methodology,
purification, Mycobacterium avium subsp. paratuberculosis,
sheep intestinal mucosa, multibacillary Johne's disease, restriction fragment
length polymorphism (RFLP) analysis, epidemiology.
Coetsier, Christophe; Havaux, Xavier; Mattelard, Francois; Sadatte, Sanaa;
Cormont, Francoise; Buergelt, Klaus; Limbourg, Bernard; Latinne, Dominique;
Bazin, Herve; Denef, Jean Francois; Cocito, Carlo. Detection of Mycobacterium avium subsp.
paratuberculosis in infected tissues by new species-specific
immunohistological procedures. Clinical and Diagnostic Laboratory
Immunology. July 1998; 5(4): 446-451. ISSN: 1071-412X.
Descriptors: preparation of polyclonal and monoclonal
antibodies, a 362 recombinant polypeptide with B cell epitopes, immunoglobins
for histopathological diagnosis, Johne's disease, more sensitive than
Ziehl-Neelsen staining.
Collins, M.T.; Manning, E.J.B. Eradication of Johne's disease from a heavily infected herd in 12
months. Proceedings of the Annual
Conference of the American Association of Bovine Practioners Conference. 1998; (31): 241-244. Note: Meeting held Sept. 24-26, 1998,
NAL
Call No.:
SF961.A5
Descriptors: cattle, Mycobacterium avium subsp. paratuberculosis infected herd, disease control, disease
eradication.
Ellingson, J. L. E.; Stabel, J. R.; Bishai, W. R.; Frothingham, R.; Miller,
J. M. Evaluation of the repeatability and
accuracy of a polymerase chain reaction method for identification of strains of
the Mycobacterium avium complex. Abstracts of the General
Meeting of the American Society for Microbiology. 1998; 98: 360. ISSN:
1060-2011. Note: 98th General Meeting of the American Society for Microbiology,
Atlanta, Georgia, USA, May 17-21, 1998.
NAL Call No.:
QR1.A5
Descriptors: cattle, humans, pigeons,
primates, Mycobacterium avium, Mycobacterium intracellulare,
Mycobacterium avium subsp. paratuberculosis, diagnosis.
Ellingson, Jay L. E.; Bolin, Carole A.; Stabel, Judith R. Identification of a gene unique to Mycobacterium
avium subspecies paratuberculosis and application to diagnosis of
paratuberculosis. Molecular and Cellular Probes. June 1998;
12(3): 133-142. ISSN: 0890-8508.
NAL Call No.: RB43.7.M63
Descriptors: etiology, hspX gene cloned and sequenced,
species apecific oligonucleotide synthesized, 5’terminus of mycobacterial recA
gene, ovine, bovine and human isolates, Mycobacterium avium subsp.
paratuberculosis, Mycobacterium paratuberculosis, Mycobacterium
avium subsp. silvaticum, Mycobacterium intracellulare,
dioligonucleotide hybridization (dOH) analysis, possible assay method.
Ellis, T. M.; Norris, R. T.; Martin, P. A. J.; Casey, R. H.; Hawkins, C. D.
Evidence for freedom from Johne's disease in
cattle and goats in Western Australia. Australian Veterinary
Journal. Sept. 1998; 76(9): 630-633. ISSN: 0005-0423.
NAL Call
No.: 41.8 Au72
Descriptors: epidemiology, cattle,
goats, Mycobacterium avium subsp. paratuberculosis, Australia.
Ellis, T. M.; Carson, B. A.; Kalkhoven, M. J.; Martin, P. A. J. Specificity of two absorbed ELISAs for surveys of
Mycobacterium paratuberculosis in cattle. Australian
Veterinary Journal. July 1998; 76(7): 497-499. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors:
methods, techniques, cattle, ELISA assay, survey of disease levels,
Mycobacterium avium subsp. paratuberculosis.
Garry, F.B.; Wells, S. Reconsidering Johne's disease in dairy cows. Proceedings of the North American Veterinary
Conference. 1998; 12: 910-911. Note: Meeting held on January 10-14, 1998,
NAL Call
No.:
SF605.N672
Descriptors: dairy cattle, paratuberculosis, Mycobacterium avium subsp. paratuberculosis.
Garry, F. Ten myths about Johne's disease. Compendium on Continuing Education for the
Practicing Veterinarian. 1998; 20(11): 1275-1282. ISSN:
0193-1903.
NAL Call No.: SF601.C66
Descriptors: cattle, paratuberculosis, Mycobacterium avium subsp. paratuberculosis,
disease prevalence, disease transmission, disease course, disease control,
economic impact.
Grant, Irene R. Does Mycobacterium
paratuberculosis survive current pasteurization conditions?
Applied and Environmental Microbiology. July 1998; 64(7): 2760-2761.
ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors: milk processing, milk products, current
pasteurization conditions, bacterial survival, Mycobacterium avium
subsp. paratuberculosis.
Grant, Irene R.; Ball, H. J.; Rowe, M. T. Effect of high-temperature, short-time (HTST)
pasteurization on milk containing low numbers of Mycobacterium
paratuberculosis. Letters in Applied Microbiology. Feb. 1998;
26(2): 166-170. ISSN: 0266-8254.
NAL Call No.: QR1.L47
Descriptors: pasteurization treatment of milk, 72 degreesC
for 15s. raw milk spiked with Mycobacterium avium subsp.
paratuberculosis at various levels, cultured, BACTEC Middlebrook 12B
radiometric medium, Herrold's egg yolk medium containing mycobactin J,
IS900-based PCR, detection of acid-fast survivors, effect of bacterial differing
concentrations.
Grant, Irene R.; Ball, Hywel J.; Rowe, Michael T. Isolation of Mycobacterium paratuberculosis
from milk by immunomagnetic separation. Applied and Environmental
Microbiology. Sept. 1998; 64(9): 3153-3158. ISSN: 0099-2240.
NAL
Call No.: 448.3 Ap5
Descriptors: milk, detection
techniques, Mycobacterium avium subsp. paratuberculosis,
immunomagnetic separation technique, possible rapid detection method.
Gupta, V. K.; Singh, N.; Shankar, H. ELISA
for detection of Mycobacterium paratuberculosis antibodies in
goats. Indian Journal of Animal Sciences. May 1998; 68(5):
462-463. ISSN: 0367-8318.
NAL Call No.: 41.8 IN22
Descriptors: goats, Mycobacterium avium subsp.
paratuberculosis, diagnosis, antibody testing method, ELISA.
Harboe, Morten; Wiker, Harald G.; Ulvund, Gunni; Lund, Pedersen Bent;
Andersen, Ase Bengard; Hewinson, R. Glyn; Nagai, Sadamu. MPB70 and MPB83 as indicators of protein localization
in mycobacterial cells. Infection and Immunity. Jan. 1998; 66(1):
289-296. ISSN: 0019-9567.
NAL Call No.: QR1.I57
Descriptors: marker proteins, culture media,
Mycobacterium bovis BCG, Sauton medium, lysates, and sodium dodecyl
sulfatepolyacrylamide gel electrophoresis (SDS-PAGE), ELISA and Western
blotting, MPB64 and proteins of the antigen 85 complex, 3 heat shock proteins,
DNAK, GroEL, GroES, 2 peaks described.
Higgs, A. R. B.; Hawkins, C. D. Ovine Johne's
disease: The risk associated with sheep imported into Western Australia.
Australian Veterinary Journal. Aug. 1998; 76(8): 546-550. ISSN:
0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: risk assessment, sheep, importation concerns
and screening, Mycobacterium avium subsp. paratuberculosis,
stochastic simulation model, surveillance tests, source flocks, serological
tests on consigned sheep pre and post transport, Western Australia.
Homuth, Matthias; Valentin, Wiegand, Peter; Rohde, M.; Gerlach, Gerald F.
Identification and characterization of a novel
extracellular ferric reductase from Mycobacterium paratuberculosis.
Infection and Immunity. Feb. 1998; 66(2): 710-716. ISSN: 0019-9567.
NAL Call No.: QR1.I57
Descriptors:
Mycobacterium avium subsp. paratuberculosis, reductase enzyme
isolation, mobilizes iron from ferric ammonium citrate, ferritin, and
transferrin by reduction of the metal, some properties of the enzyme mentioned,
amino acids, bacterial physiology.
Hulten, K.; Karttunen, T. J.; Naser, S. A.; El Zimaity, H. M. T.; Graham, D.
Y.; El Zaatari, F. A. K. In situ hybridization
technique for the detection of mycobacterial spheroplasts in paraffin embedded
tissue sections. Abstracts of the General Meeting of the American
Society for Microbiology. 1998; 98: 360. ISSN: 1060-2011. Note: 98th General
Meeting of the American Society for Microbiology, Atlanta, Georgia, USA, May
17-21, 1998.
NAL Call No.: QR1.A5
Descriptors: diagnosis and detection methods, cattle,
tissue assay, cell wall deficient pathogen, Mycobacterium avium
subsp. paratuberculosis.
International Embryo Transfer Society. Conclusions of the Research Subcommittee of the
International Embryo Transfer Society (IETS) Import/Export Committee.
Revue Scientifique et Technique Office International des Epizooties. Dec.
1998; 17(3): 839. ISSN: 0253-1933.
NAL Call No.: SF781.R4
Descriptors: issues of disease transfer, embryos, list of
pathogens, cattle, goats, sheep, swine.
Keswani, J.; Frank, J. F. Thermal
inactivation of Mycobacterium paratuberculosis in milk.
Journal of Food Protection. Aug. 1998; 61(8): 974-978. ISSN:
0362-028X.
NAL Call No.: 44.8 J824
Descriptors: milk, treatment, ultra-high temperature milk
treatment, Mycobacterium avium subsp. paratuberculosis, 3
strains, submerged glass capillary tube method, clumped and declumped
suspensions.
Mainar, Jaime Raul C.; Vazquez, Boland Jose A. Factors associated with seroprevalence to
Mycobacterium paratuberculosis in small-ruminant farms in the Madrid
region (Spain). Preventive Veterinary Medicine. March 27, 1998;
34(4): 317-327. ISSN: 0167-5877.
NAL Call No.: SF601.P7
Descriptors: sheep, goats, 60 flocks, farm factors and
management affecting infection levels, Mycobacterium avium subsp.
paratuberculosis, questionnaires, seroprevalence with agar-gel
immunodiffusion assay, herd size, foreign breeds and crosses, replacement rate,
membership in a professional livestock organization.
Manning, Elizabeth J. B.; Steinberg, Howard; Rossow, Kurt; Ruth, George R.;
Collins, Michael T. Epizootic of
paratuberculosis in farmed elk. Journal of the American Veterinary
Medical Association. Nov. 1, 1998; 213(9): 1320-1322. ISSN: 0003-1488.
NAL Call No.: 41.8 Am3
Descriptors:
elk, description of the John’s type disease, Mycobacterium avium
subsp. paratuberculosis, diagnostic techniques, production
management and disease control suggestions.
May, B.; Fetrow, J.; Kapur, V.; Tune, K. The
use of TaqMan as a technique to detect Mycobacterium
paratuberculosis. Abstracts of the General Meeting of the
American Society for Microbiology. 1998; 98: 181. ISSN: 1060-2011. Note:
98th General Meeting of the American Society for Microbiology, Atlanta, Georgia,
USA, May 17-21, 1998.
NAL Call No.: QR1.A5
Descriptors: diagnosis and detection methods,
Mycobacterium avium subsp. paratuberculosis.
McGraw, L.C. Gene-based test for Johne's disease. Agricultural Research. 1998; 46(10): 18-19.
NAL Call No.: 1.98 AG84. ISSN:
0002-161X.
Descriptors: dairy cattle, Mycobacterium avium subsp. paratuberculosis, bacterial diseases, diagnostic
techniques.
Naser, Saleh A.; Gillespie, Robert F.; Naser, Najih A.; El Zaatari, Foaud A.
K. Effect of IS900 gene of Mycobacterium
paratuberculosis on Mycobacterium smegmatis. Current
Microbiology. Dec. 1998; 37(6): 373-379. ISSN: 0343-8651.
NAL
Call No.: QR1.C78
Descriptors: IS900 gene and/or
its encoding products, involvement in mycobactin dependency, possible
explanation for the slow growth rate, Mycobacterium avium subsp.
paratuberculosis.
Rahn, K.; Shin, S.; Wilson, J.; Johnson, R. P.; Alves, D.; McNab, B.;
Lachowski, W.; Odumeru, J.; Spika, J. Milk as a
potential source of human exposure to Mycobacterium
paratuberculosis. Abstracts of the General Meeting of the
American Society for Microbiology. 1998; 98: 504. ISSN: 1060-2011. Note:
98th General Meeting of the American Society for Microbiology, Atlanta, Georgia,
USA, May 17-21, 1998.
NAL Call No.: QR1.A5
Descriptors: milk, human health risks, zoonotic potential
of Mycobacterium avium subsp. paratuberculosis.
Silbaq, Fauzi S.; Cho, Sang Nae; Cole, Stewart T.; Brennan, Patrick J. Characterization of a 34-kilodalton protein of
Mycobacterium leprae that is isologous to the immunodominant
34-kilodalton antigen of Mycobacterium
paratuberculosis. Infection and Immunity. Nov. 1998;
66(11): 5576-5579. ISSN: 0019-9567.
NAL Call No.: QR1.I57
Descriptors: gene homology, proteins, description of some
characteristics, Mycobacterium avium subsp. paratuberculosis.
Stabel, J. R.; Goff, J. P.; Ackermann, Mark R. Dietary calcium modulates Mycobacterium
paratuberculosis infection in beige mice. Veterinary Immunology
and Immunopathology. Dec. 11, 1998; 66(3-4): 377-390. ISSN: 0165-2427.
NAL Call No.: SF757.2.V38
Descriptors:
mouse model, laboratory experiment, differing levels of dietary calcium and
effects on infection persistence, Mycobacterium avium subsp.
paratuberculosis, 0.02% Ca, 0.15% Ca, 0.45% Ca, 1.0% Ca.
Stabel, J. R. Johne's disease: A hidden
threat. Journal of Dairy Science. Jan. 1998; 81(1): 283-288. ISSN:
0022-0302.
NAL Call No.: 44.8 J822
Abstract: Paratuberculosis, which is also known as Johne's disease, is a chronic, progressive enteric disease
of ruminants caused by infection with Mycobacterium paratuberculosis. Cattle become infected with M. paratuberculosis as calves but often do not develop
clinical signs until 2 to 5 yr of age. The clinical disease is characterized by
chronic or intermittent diarrhea, emaciation, and death. Although animals with
clinical disease are often culled from the herd, animals with subclinical paratuberculosis may
cause economic losses because of reduced milk production and poor reproductive
performance. Although the economic impact of paratuberculosis on the national cattle industry has not
been determined, it is estimated to exceed $1.5 billion/yr. The diagnosis of
subclinical paratuberculosis
is difficult. Bacteriologic culture is the most definitive method of diagnosis,
but culture is time consuming and labor intensive. Serological assays are not
very useful because animals do not develop an antibody response until the
clinical stages of disease. Development of assays to measure cell-mediated
immunity is critical to accurate detection of paratuberculosis in subclinically
infected animals. Although not considered a zoonotic
agent, M. paratuberculosis has been identified in intestinal
biopsy tissue from patients with Crohn's disease,
an inflammatory enteritis in humans. Currently, the
potential human health risk is being addressed by research evaluating
pasteurization of dairy products in the
Descriptors: cattle, discussion of the
signs and symptoms of the disease, difficulties of diagnosis, possible zoonotic
agent in Crohn’s disease, assay concerns, food born illness, dairy products.
Stabel, J. R.; Steadham, E. Survival of
intracellular Mycobacterium paratuberculosis after pasteurization of
raw milk. Journal of Dairy Science. 1998; 81(Suppl. 1): 42. ISSN:
0022-0302. Note: Joint Meeting of the American Dairy Science Association and the
American Society of Animal Science, Denver, Colorado, USA, July 28-31, 1998.
NAL Call No.: SF221 A4
Descriptors:
cattle, milk, intracellular survival, Mycobacterium avium subsp.
paratuberculosis.
Stabel, J. R. Temporal Mycobacterium
paratuberculosis infection in T-cell receptor deficient mice.
FASEB Journal. March 17, 1998; 12(4): A569. ISSN: 0892-6638. Note: Annual
Meeting of the Professional Research Scientists on Experimental Biology 98, Part
1, San Francisco, California, USA, April 18-22, 1998.
NAL Call No.:
QH301.F3
Descriptors: molecular genetic, C57BL/6
mouse model, T cell receptor deficient host, Mycobacterium avium
subsp. paratuberculosis, strains 19698 and Ben, infection,
pathogenesis.
Sung, Nackmoon; Collins, Michael T. Thermal
tolerance of Mycobacterium paratuberculosis. Applied and
Environmental Microbiology. March 1998; 64(3): 999-1005. ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors:
heat tolerance; human and bovine strains Dominic, Ben, BO45, ATCC 19698, in
vitro, 4 temperatures: 62, 65, 68, and 71degree C, thermal death curves, clumped
and singe cells, cell concentrations of clinical Mycobacterium avium
subsp. paratuberculosis strains in milk were 228.8, 47.8, and 21.8
s, respectively, Z value (the temperature required for the decimal reduction
time to traverse 1 log cycle).
Sweeney, Raymond W.; Jones, Douglas E.; Habecker, Perry; Scott, Phillip.
Interferon-gamma and interleukin 4 gene
expression in cows infected with Mycobacterium paratuberculosis.
American Journal of Veterinary Research. July 1998; 59(7): 842-847. ISSN:
0002-9645.
NAL Call No.: 41.8 Am3A
Descriptors: cattle, Mycobacterium avium
subsp. paratuberculosis, clinical progression factors, cytokine
gene expression in affected tissues, Holstein cows, post slaughter sampling of
ileum, cecal lympth nodes, reverse transcriptase-competitive polymerase chain
reaction assay for mRNA expression of interferon-gamma (IFN-gamma) and
interleukin 4.
Tizard, Mark; Bull, Tim; Millar, Douglas; Doran, Tim; Martin, Helene; Sumar,
Nazira; Ford, Jon; Hermon, Taylor John. A low
G+C content genetic island in Mycobacterium avium subsp.
paratuberculosis, and M. avium subsp. silvaticum with
homologous genes in Mycobacterium tuberculosis.
Microbiology. Dec. 1998; 144(12): 3413-3423. ISSN: 1350-0872.
NAL Call No.: QR1.J64
Descriptors:
gene specificity, detection, differential analysis, enteric pathogens,
characterization.
Vannuffel, P.; Coetsier, C.; Bouyer, M.; Philippe, M.; Gala, J. L. P34 and F57 based-multiplex PCR assay for
discrimination between tuberculous and nontuberculous mycobacteria.
Abstracts of the Interscience Conference on Antimicrobial Agents and
Chemotherapy. 1998; 38: 158. Note: 38th Interscience Conference on
Antimicrobial Agents and Chemotherapy, San Diego, California, USA, September
24-27, 1998.
Descriptors: assay technique, humans,
Mycobacterium avium, Mycobacterium bovis , Mycobacterium avium
subsp. paratuberculosis, Mycobacterium tuberculosis, F57
and P34 analysis antigenic proteins.
Wells, S.J.; Ott, S.L.; Hillberg-Seitzinger, A. Key health issues for dairy cattle--new and
old. Journal of Dairy Science. 1998; 81(11): 3029-3035. ISSN: 0022-0302.
URL: http://jds.fass.org/contents-by-date.0.shtml
NAL
Call No.: 44.8 J822
Abstract: The objective of this paper is to use
available information to evaluate the relative importance of various health
issues affecting dairy cattle. In addition to traditional ranking using
evaluation methods based on impacts to animal productivity, this paper considers
zoonotic risks, international trade implications, and
animal welfare concerns. Traditional production costs rank mastitis,
reproductive problems, and lameness as the top dairy cattle diseases. When the
other areas of importance are included, the top-ranked diseases change to
include salmonella, Johne's disease, bovine viral
diarrhea-associated disease, and mastitis. Researchers in the dairy industry may
want to reevaluate their criteria for setting research priorities to include
zoonotic risks, international trade implications, and
animal welfare concerns.
Descriptors: dairy cows, animal
health, milk production, bovine mastitis, animal welfare, production costs,
bovine diarrhea virus, paratuberculosis, zoonoses, cryptosporidiosis, foodborne diseases, international trade, decision making,
research projects, dairy research, research priorities.
Whittington, R.; Marsh, I.; Choy, E.; Cousins, D. Polymorphisms in IS1311, an insertion sequence common
to Mycobacterium avium and Mycobacterium avium subsp.
paratuberculosis, , can be used to distinguish between and within these
species. Molecular and Cellular Probes. Dec. 1998; 12(6): 349-358
ISSN: 0890-8508.
NAL Call No.: RB43.7.M63
Descriptors: IS1311 insertion sequence, use as a probe,
sheep, cattle strains, species evolution.
Whittington, R. J.; Marsh, I; Turner, M. J.; McAllister, S.; Choy, E.;
Eamens, G. J.; Marshall, D. J.; Ottaway, S. Rapid detection of Mycobacterium
paratuberculosis in clinical samples from ruminants and in spiked
environmental samples by modified BACTEC 12B radiometric culture and direct
confirmation by IS900 PCR. Journal of Clinical Microbiology. March
1998; 36(3): 701-707. ISSN: 0095-1137.
NAL Call No.: QR46.J6
Descriptors: cattle, sheep, goats, radiometric culture
medium BACTEC 12B with PANTA PLUS, mycobactin J, and egg yolk, detection of
Mycobacterium avium subsp. paratuberculosis, feces, mesenteric
lymph nodes, intestinal walls, cattle, sheep, goats, IS900 PCR in the primary
cultures, methodology, spiked soil and pasture samples, sensitivity, Herrold's
egg yolk medium, PCR.
Williams, Stephanie Louise. Analysis of Mycobacterium avium subspecies paratuberculosis
Susceptibility to Antimicrobial Agents. 1998; 54 leaves,
ill. Note: Thesis (M.S.).
Descriptors: Mycobacterium avium subsp. paratuberculosis, bacterial diseases, susceptibility to
antibiotics, animal pathogen.
Alzuherri, H. M.; Little, D.; Clarke, C. J. Altered intestinal macrophage phenotype in ovine
paratuberculosis. Research in Veterinary Science. Sept.-Oct.,
1997; 63(2): 139-143. ISSN: 0034-5288.
NAL Call No.: 41.8
R312
Descriptors: Scottish back-faced ewes, sheep, Johne’s
disease, immunohistological studies, intestinal macrophages, diseased sheep
expressed MHC class II, LFA-1 and CR4 antigens weakly, comparison with normal
tissues, reverse transcriptase-polymerase chain reaction analysis, MHC class II
MRNA, intestinal whole tissue samples, no significant difference between control
and diseased groups, Mycobacterium avium subsp.
paratuberculosis.
Bannantine, John P.; Barletta, Raul G.; Thoen, Charles O.; Andrews, Robert E.
Jr. Identification of Mycobacterium
paratuberculosis gene expression signals. Microbiology. 1997;
143(3): 921-928. ISSN: 1350-0872.
NAL Call No.: QR1.J64
Descriptors: DNA library constructed in the transcriptional
translational fusion vector pYUB76, eight clones were sequenced and
characterized further, Mycobacterium avium subsp.
paratuberculosis.
Bassey, Effiong O. E.; Collins, Michael T. Study of T-lymphocyte subsets to healthy and
Mycobacterium avium subsp. paratuberculosis-infected
cattle. Infection and Immunity. 1997; 65(11): 4869-4872. ISSN:
0019-9567.
NAL Call No.: QR1.I57
Descriptors: cattle, Johne’s disease, host immune defenses,
T lymphocyte contribution to defense, lymphoproliferation and gamma interferon
(IFN-gamma) production was measured in response to phytohemagglutinin (PHA) and
an Mycobacterium avium antigen preparation (A-PPD), correlation between
proliferation and IFN-gamma production in response to A-PPD but not to PHA.
Begara, Mcgorum Isabel M.; Wildblood, Louise A.; Jones, Douglas G. Early immune events following experimental infection
of lambs with Mycobacterium avium subspecies
paratuberculosis. Biochemical Society Transactions. 1997;
25(2): 279S. ISSN: 0300-5127. Note: 660th Meeting of the Biochemical Society,
Joint Congress with the British Society for Immunology, Harrogate, England, UK,
December 10-13, 1996.
NAL Call No.: QD415.A1B58
Descriptors: sheep, lambs, progression of the disease in
the immune system, experimental infection study, Mycobacterium avium
subsp. paratuberculosis.
Clarke, C. J. Paratuberculosis and molecular
biology. Veterinary Journal. 1997; 153(3): 245-247. ISSN:
1090-0233.
NAL Call No.: SF601 V484
Descriptors: biochemistry, molecular, genetics, immunity,
pathology, Mycobacterium avium subsp. paratuberculosis.
Collins, Michael T. Mycobacterium
paratuberculosis: A potential food-borne pathogen? Journal of
Dairy Science. Dec., 1997; 80 (12): 3445-3448. ISSN: 0022-0302
NAL Call No.: 44.8 J822
Abstract: Mycobacterium paratuberculosis commonly infects dairy cattle, leading
to Johne's disease, which is also known as paratuberculosis. The infection is chronic, progressive, and
incurable. As the infection progresses, excretion of M. paratuberculosis in feces and milk occurs, and the
bacterium spreads through the blood to multiple internal organs.
Consequently, raw products originating from cattle may harbor M. paratuberculosis. Thermal treatments, such as
pasteurization, are commonly relied on to kill food-borne bacterial pathogens
that can infect humans. The small number of studies conducted to determine the
thermal resistance of
M. paratuberculosis suggest that it is less
susceptible to destruction by heat killing than are milkborne zoonotic bacterial
pathogens such as Listeria spp. or Mycobacterium bovis. Published reports concerning the thermal
resistance of M. paratuberculosis in milk are reviewed herein, and key
issues concerning the efficacy of pasteurization for elimination of M. paratuberculosis from milk are summarized.
Descriptors: Johne’s disease, raw bovine
based products, human health risks, review of literature on thermal resistance
of bacteria, Mycobacterium avium subsp. paratuberculosis.
Cook, W. E.; Cornish, T. E.; Shideler, S.; Lasley, B.; Collins, M. T. Radiometric culture of Mycobacterium avium
paratuberculosis from the feces of tule elk. Journal of Wildlife
Diseases. 1997; 33(3): 635-637. ISSN: 0090-3558.
NAL Call No.:
41.9 W64B
Descriptors: tule elk, Cervus
elaphus nannodes, Point Reyes National Seashore, California,
detection/incidence of Mycobacterium avium subsp.
paratuberculosis, fecal samples, cultured on modified BACTEC 12B
radiometric medium, positive results in 2 groups of elk, non-invasive technique
for wildlife Mycobacterium monitoring.
Davies, H. L. Ovine Johne's disease.
Australian Veterinary Journal. Nov., 1997; 75(11): 799. ISSN:
0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: sheep, Mycobacterium avium subsp.
paratuberculosis, human health risks, food contaminant, Australia.
De Lisle, G. W. Can Johne's disease be
eradicated from sheep in Australia? Australian Veterinary Journal.
1997; 75(5): 336. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: sheep disease, Johne’s, Mycobacterium
avium subsp. paratuberculosis, control and eradication.
Doran, Tim; Tizard, Mark; Millar, Douglas; Ford, Jon; Sumar, Nazira;
Loughlin, Mark; Hermon, Taylor John. IS900
targets translation initiation signals in Mycobacterium avium subsp.
paratuberculosis to facilitate expression of its hed gene.
Microbiology. 1997; 143(2): 547-552. ISSN: 1350-0872.
NAL Call
No.: QR1.J64
Descriptors: microbial genetics,
IS900 insertion sites, unique targeting process.
Durham, P. J. K.; Paine, G. D. Serological
survey for antibodies to infectious agents in beef cattle in northern South
Australia. Australian Veterinary Journal. 1997; 75(2): 139-140.
ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: cattle, disease incidence, survey, blood sera,
pathogens, Chlamydia, Coxiella burnetii, Mycobacterium avium
subsp. paratuberculosis, Australia.
El Zaatari, Fouad A. K.; Naser, Saleh A.; Graham, David Y. Characterization of a specific Mycobacterium
paratuberculosis recombinant clone expressing 35,000-molecular-weight
antigen and reactivity with sera from animals with clinical and subclinical
Johne's disease. Journal of Clinical Microbiology. 1997; 35(7):
1794-1799. ISSN: 0095-1137.
URL: http://www.pubmedcentral.gov/tocrender.fcgi?iid=7098
NAL Call No.: QR46.J6
Descriptors: cattle, sheep, goats, recombinant clone
expressing a 35,000 molecular weight Mycobacterium avium subsp.
paratuberculosis antigen (p35 antigen), constructed expression library
of Mycobacterium paratuberculosis in Escherichia coli,
immunoblotting, possible diagnostic method for serodiagnosis of all ages of
animals.
Ellingson, J. L. E.; Bolin, C. A.; Stabel, J. R. Identification of a new genetic element unique to
Mycobacterium paratuberculosis and application to diagnosis of
paratuberculosis. Abstracts of the General Meeting of the American
Society for Microbiology. 1997; 97(0): 550. ISSN: 1060-2011. Note: 97th
General Meeting of the American Society for Microbiology, Miami Beach, Florida,
USA, May 4-8, 1997.
NAL Call No.: QR1.A5
Descriptors: genetics, specificity, cattle strain, possible
diagnostic test, Mycobacterium avium, Mycobacterium
intracellulare, Mycobacterium avium subsp.
paratuberculosis.
Feizabadi, M. M.; Robertson, I. D.; Hope, A.; Cousins, D. V.; Hampson, D. J.
Differentiation of Australian isolates of
Mycobacterium paratuberculosis using pulsed-field gel
electrophoresis. Australian Veterinary Journal. Dec., 1997;
75(12): 887-889. ISSN: 0005-0423.
NAL Call No.: 41.8 Au72
Descriptors: strain variations of Mycobacterium
avium subsp. paratuberculosis, pulsed field gel electrophoresis,
typing technique, 35 Australian isolates and 1 United Kingdom reference strain,
banding patterns from endonuclease digested material, 2 groupings, strain
transmission studies, Australia.
Feizabadi, Mohammad M.; Robertson, Ian D.; Cousins, Debby V.; Dawson, David
J.; Hampson, David J. Use of multilocus enzyme
electrophoresis to examine genetic relationships amongst isolates of
Mycobacterium intracellulare and related species.
Microbiology. 1997; 143(4): 1461-1469. ISSN: 1350-0872.
NAL
Call No.: QR1.J64
Descriptors: diversity and
distribution of Mycobacterium spp., Australia, genetic relationships at
17 enzyme loci amongst a collection of reference strains and isolates, initially
identified Mycobacterium. intracellulare ,'X' mycobacteria,
Mycobacterium scrofulaceum, Mycobacterium avium, Mycobacterium
avium subsp. paratuberculosis, difficulties in differentiation.
Felix, J. L.; Huang, L.; Walsh, A. F.; Safranek, B. W.; Naser, N. A.; Naser,
S. A. PCR detection of the IS900 gene is
Mycobacterium avium strains isolated from HIV patients.
Abstracts of the General Meeting of the American Society for
Microbiology. 1997; 97(0): 553. ISSN: 1060-2011. Note: 97th General Meeting
of the American Society for Microbiology, Miami Beach, Florida, USA, May 4-8,
1997.
NAL Call No.: QR1.A5
Descriptors: PCR, genetics, IS900 gene detection methods,
humans.
Francois, B.; Krishnamoorthy, R.; Elion, J. Comparative study of Mycobacterium
paratuberculosis strains isolated from Crohn's disease and Johne's disease
using restriction fragment length polymorphism and arbitrarily primed polymerase
chain reaction. Epidemiology and Infection. 1997; 118(3): 227-233.
ISSN: 0950-2688.
NAL Call No.: RA651.A1E74
Descriptors: pathogenicity mechanisms study, Crohn’s
disease, Johne’s disease, Mycobacterium avium subsp.
paratuberculosis, human, sheep and cattle strains, DNA, RFLP, IS900,
arbitrarily primed polymerase chain reaction (AP-PCR).
Garry, Franklyn. Johne's
disease: what do I need to know?. USDA, APHIS, VS, CEAH, [1997?]
URL: http://www.aphis.usda.gov/vs/ceah/cahm/Beef_Cow-Calf/bf97john.htm
NAL Call No.: aSF967.P33J66 1997
Descriptors: paratuberculosis, economic aspects of
the disease, control, Mycobacterium avium subsp. paratuberculosis,
Gormley, Eamonn; Sandall, Laurie; Hong, Cai; Lawton, David; Murray, Alan.
Identification and differentiation of
mycobacteria using the P-AN promoter sequence from Mycobacterium
paratuberculosis as a DNA probe. FEMS Microbiology Letters.
1997; 147(1): 63-68. ISSN: 0378-1097.
NAL Call No.: QR1.F44
Descriptors: 165 bp DNA fragment containing the P-AN
promoter from Mycobacterium avium subsp. paratuberculosis,
probe in Southern blots, detection of related sequences in other species of
mycobacteria.
Gupta, V. K.; Singh, Nem; Singh, S. V.; Shankar, Hari. Adoption of M. paratuberculosis (isolated
from goat and sheep) into liquid medium from solid medium. Indian
Veterinary Medical Journal. 1997; 21(1): 14-17. ISSN: 0250-5266.
Descriptors: goat and sheep isolates, Mycobacterium
avium subsp. paratuberculosis, Herrold's egg yolk medium with
mycobactin J, modified Watson & Raid liquid medium, aeration requirement, 2
pH levels, limited success in liquid medium.
Gwozdz, J. M.; Reichel, M. P.; Murray, A.; Manktelow, W.; West, D. M.;
Thompson, K. G. Detection of Mycobacterium
avium subsp. paratuberculosis in ovine tissues and blood by the
polymerase chain reaction. Veterinary Microbiology. 1997; 57(2-3):
233-244. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors: 12 ewes sheep, polymerase chain reaction (PCR)
test, DNA extractions, blood, liver, ileocecal lymph node, ileum, assay
comparison study, serological tests: complement fixation test (CFT), gel
diffusion test (AGID), two enzyme-linked immunosorbent assays (ELISA).
Higgs, T. Sheep Johne's
disease--keeping it out of WA. Journal of Agriculture. 1997; 38 (3): 77-80. ISSN: 0021-8618.
NAL
Call No.:
23 W52J
Descriptors: sheep, Mycobacterium avium subsp. paratuberculosis,
disease prevention,
Holsinger, V. H.; Rajkowski, K. T.; Stabel, J. R. Milk pasteurisation and safety: A brief history and
update. Revue Scientifique et Technique Office International des
Epizooties. Aug., 1997; 16(2): 441-451. ISSN: 0253-1933. Note: In English
with English, French, and Spanish summaries.
NAL Call No.:
SF781.R4
Descriptors: food safety, milk
processing, efficiency of current pasteurization methods in regard to pathogens,
Mycobacterium avium subsp. paratuberculosis, Listeria
monocytogenes, Escherichia coli O257:H7, Bacillus cereus
endospores.
Huang, L.; Naser, N. A.; Naser, S. A. Cloning
of a Mycobacterium paratuberculosis 32K-encoding gene: A possible
fibronectin attachment protein-encoding gene. Abstracts of the General
Meeting of the American Society for Microbiology. 1997; 97(0): 561. ISSN:
1060-2011. Note: 97th General Meeting of the American Society for Microbiology,
Miami Beach, Florida, USA, May 4-8, 1997.
NAL Call No.:
QR1.A5
Descriptors: genetics, cloning of specific
genes, fibronectin, proteins, Mycobacterium avium subsp.
paratuberculosis.
Hveem, Eli. Importation of cattle: An
evaluation of the risk of the importation and spread of paratuberculosis
infections. Norsk Veterinaertidsskrift. 1997; 109(11): 669-671.
ISSN: 0332-5741. Note: In Norwegian.
Descriptors:
epidemiology, cattle, disease introduction risks, Mycobacterium avium
subsp. paratuberculosis.
Hwang, Eui Kyung; Jean, Young Hwa; Son, Hyun Joo; Moon, Oun Kyong; Kim, Jae
Hoon; Bae, You Chan; Park, Jung Won; Choi, Sang Ho; Yoon, Sang Bo. A case report of Johne's disease in a Korean native
cow. RDA Journal of Veterinary Science. Dec., 1997; 39(2): 33-41.
ISSN: 1226-5675. Note: In Korean with Korean and English summaries.
NAL Call No.: SF604 R33
Descriptors:
Korean native cow, case study, Mycobacterium avium subsp.
paratuberculosis, necropsy, classical clinical signs, gross and
histopathologic lesions, results of the acid-fast tissue staining,
immunohistochemical staining and electron microscopy.
Jark, Uwe; Ringena, Ibeling; Franz, Beate; Gerlach, Gerald F.; Beyerbach,
Martin; Franz, Burkart. Development of an ELISA
technique for serodiagnosis of bovine paratuberculosis. Veterinary
Microbiology. 1997; 57(2-3): 189-198. ISSN: 0378-1135.
NAL Call
No.: SF601.V44
Descriptors: Mycobacterium
avium subsp. paratuberculosis isolate, large-scale culture,
efficient preparation of a lipoarabinomannan containing antigen was developed
and standardized, ileocaecal lymphnodes cultured to isolate viable
Mycobacterium paratuberculosis ELISA.
Johnson, Ifearulundu Yvette J.; Kaneene, John B. Relationship between soil types and Mycobacterium
paratuberculosis. Journal of the American Veterinary Medical
Association. 1997; 210(12): 1735-1740. ISSN: 0003-1488.
NAL Call
No.: 41.8 Am3
Descriptors: cattle, soils,
Mycobacterium avium subsp. paratuberculosis relationship.
Klausen, J.; Perez, V.; Giese, S. B.; Garcia, Marin J. F.; Ahrens, P. Immunological detection of sheep experimentally
infected with strains of Mycobacterium avium subspecies containing
insertion sequence IS901/IS902 and a 40 kDa protein. Veterinary
Microbiology. 1997; 57(2-3): 181-187. ISSN: 0378-1135.
NAL Call
No.: SF601.V44
Descriptors: monoclonal antibody,
40 kDa protein, Mycobacterium avium strains (IS901/IS902 positive),
developed a blocking ELISA, experimentally infected sheep sera, diagnostic
value, indirect ELISA, AGID and blocking ELISA compared.
Mason, O.; Rowe, M. T.; Ball, H. J. Is
Mycobacterium paratuberculosis a possible agent in Crohn's disease?
Implications for the dairy industry. Milchwissenschaft. 1997;
52(6): 311-316. ISSN: 0026-3788. Note: In English with summaries in English and
German.
NAL Call No.: 44.8 M5933
Descriptors: dairy products, milk, ice cream, cheese, human
health risks, Mycobacterium avium subsp. paratuberculosis
contamined milk, possible zoonotic agent, potential impacts on dairy industry,
recommendations for future research.
McDowell, R. M.; McElvaine, M. D. Long-term
sequelae to foodborne disease. Revue Scientifique et Technique Office
International des Epizooties. Aug., 1997; 16(2): 337-341. ISSN: 0253-1933.
Note: In English with English, French, and Spanish summaries.
NAL
Call No.: SF781.R4
Descriptors: possible
relationship between Mycobacterium avium subsp.
paratuberculosis and Crohn’s disease, descriptions of syndromes,
epidemiology, economic information, reduction in food borne diseases.
Morgan, K.L.; Cetinkaya, B.; Egan, K. Johne's
and Crohn's: Inflammatory bowel diseases with a similar aetiology? In
Society for Veterinary Epidemiology and Preventive Medicine. Edited by
Goodall, E.A.; Thrusfield, M.V. The Society, England, UK, 1997; p. 47-56. ISBN:
0948073292. Note: From a meeting held in Chester, England, UK, April 9-11, 1997.
Descriptors: intestinal diseases, humans, cattle, sheep,
Mycobacterium avium subsp. paratuberculosis, possible cause of
Crohn’s disease.
Mulder, M. A.; Zappe, H.; Steyn, L. M. Characterization of the Mycobacterium
tuberculosis katG promoter and regulation of expression.
Abstracts of the General Meeting of the American Society for
Microbiology. 1997; 97(0): 566. ISSN: 1060-2011. Note: 97th General Meeting
of the American Society for Microbiology, Miami Beach, Florida, USA, May 4-8,
1997.
NAL Call No.: QR1.A5
Descriptors: genetics, promoter, physiology, bacterial
genetics, Escherichia coli, Mycobacterium avium subsp.
paratuberculosis, Mycobacterium smegmatis, Mycobacterium
tuberculosis.
Mutharia, L. M.; Moreno, W.; Raymond, M. Analysis of culture filtrate and cell wall-associated
antigens of Mycobacterium paratuberculosis with monoclonal
antibodies. Infection and Immunity. 1997; 65(2): 387-394. ISSN:
0019-9567.
NAL Call No.: QR1.I57
Descriptors: specific antigens, release of antigens and
distribubion of specific epitopes in Mycobacterium species, immunoblot
analysis, monoclonial antibodies, Mab B6A.
Obasanjo, Iyabo O.; Grohn, Yrjo T.; Mohammed, Hussni O. Firm factors associated with the presence of
Mycobacterium paratuberculosis infection in dairy herds on the New York
State Paratuberculosis Control Program. Preventive Veterinary
Medicine. Oct., 1997; 32(3-4): 243-251. ISSN: 0167-5877.
NAL
Call No.: SF601.P7
Descriptors: extensive
questionnaire, data from 33 herds, New York State Paratuberculosis Control
Program, farm factors Mycobacterium avium subsp.
paratuberculosis infection in dairy herds, 31 continuous and 67
categorical risk factors, univariable logistic regression, 10 factors: the type
of farm operation (commercial/registered or both), earlier diagnosis of the
disease before entering the control program; number of clinical cases in the
previous year, clinical cases farm or purchased animals, typical signs in
clinical cases, fecal exposure of calves 0-6 weeks of age, contact with adult
animal feces due to shared cleaning equipment, spreading feces on fields that
contaminated forage, treatment and handling of those suspected of having
Johne’s, frequency of barn cleaning, New York State.
Ollis, G.W. Johne's disease: a cloud on the horizon. Advances in Dairy
Technology. 1997; 9: 151-162. ISSN: 1184-0684.
URL: http://www.wcds.afns.ualberta.ca/
NAL Call No.: SF223.W478
Descriptors: Mycobacterium avium subsp. paratuberculosis, possible
economic impact of the disease, control concerns.
Onet, George E. Current paratuberculosis
diagnosis in cattle. Large Animal Practice. July-Aug., 1997;
18(4): 18-22. ISSN: 1092-7603.
NAL Call No.: SF601 B6
Descriptors: diagnosis, methods, cattle, mycobacteria,
issues, concerns regarding testing methods.
Pell, Alice N. Manure and microbes: Public
and animal health problem? Journal of Dairy Science. Oct., 1997;
80(10): 2673-2681. ISSN: 0022-0302.
NAL Call No.: 44.8 J822
Descriptors: microbial contamination in the environment,
waste management, human health risks, control and remediation, pathogen
contaminants, Cryptosporidium parvum, Giardia spp., Listeria
monocytogenes, Escherichia coli O157:H7, Salmonella spp., and
Mycobacterium avium subsp. paratuberculosis, enteric viruses,
clinical symptoms, control methods, recommendations for control.
Perez, V.; Tellechea, J.; Badiola, J. J.; Gutierrez, M.; Garcia, Martin J. F.
Relation between serologic response and
pathologic findings in sheep with naturally acquired paratuberculosis.
American Journal of Veterinary Research. 1997; 58(8): 799-803. ISSN:
0002-9645.
NAL Call No.: 41.8 Am3A
Descriptors: 134 adult sheep, culled for illness, tested
blood, sera testing, correlations between lesions and serologic response, sheep,
natural infection, intestinal lesions, Mycobacterium avium subsp.
paratuberculosis, efficacy of agar gel immunodiffusion (AGID) and ELISA
as diagnostic tests.
Rainsford, K. D. Emerging research in
gastrointestinal diseases. In: Cell Injury and Protection in the
Gastrointestinal Tract: From Basic Sciences to Clinical Perspectives 1996
edited by Mozsik, G.; Nagy, L.; Par, A.; Rainsford, K. D. Kluwer Academic
Publishers, AZ Dordrecht, Netherlands; Kluwer Academic Publishers, MA 1997; p.
1-7. ISBN: 0792387201. Note: Fourth International Symposium, Pecs, Hungary,
October 8-11, 1995.
Descriptors: Helicobacter
pylori, Mycobacterium avium subsp. paratuberculosis,
research.
Reichelderfer, M.; Cherney, T. M.; Chicks, D. S.; Harms, B. A.; Manning, E.
B.; Collins, M. T. Seroprevalence of
Mycobacterium paratuberculosis (Mptb) antibodies in inflammatory bowel
disease (IBD) patients and two populations at risk of exposure to this
pathogen. Gastroenterology. 1997; 112(4 Suppl.): A1069. ISSN:
0016-5085. Note: Digestive Disease Week and the 97th Annual Meeting of the
American Gastroenterological Association, Washington, D.C., USA, May 11-14,
1997.
NAL Call No.: RC799.G37
Descriptors: possible zoonotic bacteria, pathology,
Mycobacterium avium subsp. paratuberculosis.
Rowe, Michael T.; Fearon, Anna M.; Johnston, Donald E.; Early, John. Dairy research in the Food Science Division,
Belfast. International Journal of Dairy Technology. May, 1997;
50(2): 61-63. ISSN: 1364-727X.
NAL Call No.: SF221.I58
Descriptors: dairy related, heat resistance of
Mycobacterium avium subsp. paratuberculosis, Escherichia
coli, raw milk, shelf life of pasteurized milk, high pressure processing of
dairy products, Ireland.
Sacco, T.; Gennero, M.S. Indagine sierologica in
allevamenti problema sul territorio regionale per la paratubercolosi. [Johne's disease serological investigation on suspected
infected herds in
Descriptors: Piedmont cattle,
infected herds, Johne’s disease, Mycobacterium avium subsp. paratuberculosis, Mycobacterium phlei, paratuberculosis,
serological survey,
Scheibl, Peter; Gerlach, Gerald F. Differentiation of Mycobacterium
paratuberculosis isolates by rDNA-spacer analysis and random amplified
polymorphic DNA patterns. Veterinary Microbiology. 1997; 57(2-3):
151-158. ISSN: 0378-1135.
NAL Call No.: SF601.V44
Descriptors: strain identification, methods, molecular
techniques, 16 isolates, nucleotide sequence analysis of rDNA-spacer, random
amplified polymorphic DNA (RAPD) analysis using decamer primers with GC contents
of 60 to 70%, evaluation of assay, potential use as a method to differentiate
strains.
Secott, T. E.; Ohme, A. M.; Barton, K. S.; Rommel, F. A. Comparison of Mycobacterium paratuberculosis
detection methods: Standard culture vs. accelerated culture. Abstracts
of the General Meeting of the American Society for Microbiology. 1997;
97(0): 550-551. ISSN: 1060-2011. Note: 97th General Meeting of the American
Society for Microbiology, Miami Beach, Florida, USA, May 4-8, 1997.
NAL Call No.: QR1.A5
Descriptors:
detection methods comparison, cattle strains, Mycobacterium avium
subsp. paratuberculosis.
Stabel, J. R.; Steadham, E. M.; Bolin, C. A. Heat inactivation of Mycobacterium
paratuberculosis in raw milk: Are current pasteurization conditions
effective? Applied and Environmental Microbiology. Dec., 1997;
63(12): 4975-4977. ISSN: 0099-2240.
NAL Call No.: 448.3 Ap5
Descriptors: current commercial pasteurization methods,
Mycobacterium avium subsp. paratuberculosis contaminated raw
milk, in vitro experiments, pasteurization regimes, viability, 65, 72, 74, or 76
degree C, 0 to 30 min, 72 degrees, was effective.
Stabel, J. R.; Steadham, E.; Bolin, C. A. Heat inactivation of Mycobacterium
paratuberculosis in raw milk by the holder test-tube method and
laboratory-scale pasteurizer method. Abstracts of the General Meeting
of the American Society for Microbiology. 1997; 97(0): 183. ISSN: 1060-2011.
Note: 97th General Meeting of the American Society for Microbiology, Miami
Beach, Florida, USA, May 4-8, 1997.
NAL Call No.: QR1.A5
Descriptors: raw milk, in vitro study, heat tolerance,
survival after various pasteurization treatments, Mycobacterium avium
subsp. paratuberculosis.
Stabel, J. R. Johne's disease: A hidden
threat. Journal of Animal Science. 1997; 75(Suppl. 1): 48. ISSN:
0021-8812. Note: 89th Annual Meeting of the American Society of Animal Science,
Midwestern Section.
NAL Call No.: 49 J82
Descriptors: cattle, Mycobacterium avium subsp.
paratuberculosis, Johne's disease, economic impact, animal health
protection and safety, possible zoonotic disease.
Staerk, K. D. C.; Frei, Staeheli C.; Frei, P. P.; Pfeiffer, D. U.; Danuser,
J.; Audige, L.; Nicolet, J.; Strasser, M.; Gottstein, B.; Kihm, U. Incidence and costs of health problems in Swiss dairy
cattle and their calves (1993-1994). Schweizer Archiv fuer
Tierheilkunde. 1997; 139(8): 343-353. ISSN: 0036-7281. Note: In German with
German, English, French, and Italian summaries.
NAL Call No.:
41.8 SCH9
Descriptors: dairy cattle, 13 dairy
herds, blood and feces collected, pathogenicity, pathogens identified included
Leptospira hardjo, Coxiella burnetii, Mycobacterium avium
subsp. paratuberculosis.
Steele, Marina L.; McNab, W. Bruce; Poppe, Case; Griffiths, Mansel W.; Chen,
Shu; Degrandis, Stephanie A.; Fruhner, Lynne C.; Larkin, Carolyn A.; Lynch, John
A.; Odumeru, Joseph A. Survey of Ontario bulk
tank raw milk for food-borne pathogens. Journal of Food
Protection. Nov., 1997; 60(11): 1341-1346. ISSN: 0362-028X.
NAL
Call No.: 44.8 J824
Descriptors: proportion, raw
milk, Listeria monocytogenes, Salmonella spp., Campylobacter
spp., and/or verotoxigenic Escherichia coli (VTEC), 1,720 pick ups,
food borne pathogens, Ontario, Canada.
Stevenson, K.; Sharp, J. M. The contribution
of molecular biology to Mycobacterium avium subspecies
paratuberculosis research. Veterinary Journal. 1997;
153(3): 269-286. ISSN: 1090-0233.
NAL Call No.: SF601 V484
Descriptors: discussion of research into molecular aspects
of the bacteria.
Stitt, D. T.; Sturm, K. M. Preliminary growth
requirements of Mycobacterium paratuberculosis in the BBL MGIT
mycobacteria growth indicator tube. Abstracts of the General Meeting
of the American Society for Microbiology. 1997; 97(0): 570. ISSN: 1060-2011.
Note: 97th General Meeting of the American Society for Microbiology, Miami
Beach, Florida, USA, May 4-8, 1997.
NAL Call No.: QR1.A5
Descriptors: methodologies, physiology, growth factors,
Mycobacterium avium subsp. paratuberculosis.
Sung, N.; Collins, M. T. Heat resistance of
Mycobacterium paratuberculosis. Abstracts of the General
Meeting of the American Society for Microbiology. 1997; 97(0): 443. ISSN:
1060-2011. Note: 97th General Meeting of the American Society for Microbiology,
Miami Beach, Florida, USA, May 4-8, 1997.
NAL Call No.:
QR1.A5
Descriptors: bacterial characteristics,
heat tolerance, Mycobacterium avium subsp. paratuberculosis.
Thorne, J. G.; Hardin, L. E. Estimated
prevalence of paratuberculosis in Missouri, USA cattle. Preventive
Veterinary Medicine. 1997; 31(1-2): 51-57. ISSN: 0167-5877.
NAL
Call No.: SF601.P7
Descriptors: disease incidence,
cattle, 89 herds, seroprevalance of Mycobacterium avium subsp.
paratuberculosis absorbed ELISA for detection of antibodies.
United States. Animal and Plant Health Inspection Service. Veterinary Services National Animal Health Monitoring System
(
NAL Call No.: aSF967.P33J64 1997
Descriptors: dairy cattle, dairy
farms, status of the disease, paratuberculosis, Mycobacterium avium subsp. paratuberculosis,
Valente, C.; Cuteri, V.; Giandomenico, R. Quondam; Gialletti, L.;
Franciosini, M. P. Use of an experimental chicks
model for paratuberculosis enteritis (Johne's disease). Veterinary
Research. 1997; 28(3): 239-246. ISSN: 0928-4249. Note: In English with
summaries in English and French.
NAL Call No.: SF602 A5
Descriptors: animal disease model, conventional chicks
immunodepressed by a Cyclophosphamide injection and concurrent inoculation of
Infectious Bursal Disease Virus (IBDV), experimental infection,
Mycobacterium avium subsp. paratuberculosis, 4 month study,
shedding of bacteria, intestinal lesions, aggregation of macrophages with
monocytes and lymphocytes, no diarrhea, possible useful model to study the
disease.
Zhao, Benyang; Collins, Michael T.; Czuprynski, Charles J. Effects of gamma interferon and nitric oxide on the
interaction of Mycobacterium avium subsp. paratuberculosis
with bovine monocytes. Infection and Immunity. 1997; 65(5):
1761-1766. ISSN: 0019-9567.
NAL Call No.: QR1.I57
Descriptors: cattle, while blood cells, recombinant bovine
gamma interferon (rIFN-gamma), NO, interaction of Mycobacterium avium
subsp. paratuberculosis.
Begara, Mcgorum I.; Wildblood, L.; Jones, D. G. Early immune events following experimental infection
of lambs with Mycobacterium avium subspecies
paratuberculosis. Immunology. 1996; 89(Suppl. 1): 65.
ISSN: 0019-2805. Note: Joint Congress of the British Society for Immunology and
the Biochemical Society, Harrogate, England, UK, December 10-13,
1996.
NAL Call No.: 448.3 Im6 Suppl.
Descriptors: lamb, sheep, immunity.
Clarke, C. J.; Colston, A.; Little, D.; Kay, J.; Alzuherri, H. M.; Sharp, J.
M.; Burrells, C. The immune response in
paratuberculosis infection of small ruminants. Veterinary Immunology
and Immunopathology. 1996; 54(1-4): 321. ISSN: 0165-2427. Note: Fourth
International Veterinary Immunology Symposium, Davis, California, USA, July
1995.
NAL Call No.: SF757.2.V38
Descriptors:
goat, sheep, immune system responses, Mycobacterium avium subsp.
paratuberculosis.
Grgic, Z.; Vidic, Branka; Lazic, S.; Stojanov, I. Paratuberculosis (Johne's disease).
Veterinarski Glasnik. 1996; 50(7-8): 481-490. ISSN: 0350-2457. Note: In
Serbo-Croatian with English and Russian summaries.
NAL Call No.:
41.8 J93
Descriptors: disease description,
Mycobacterium avium subsp. paratuberculosis, distribution,
diagnostic methods mentioned, prevention and control measures.
Gupta, V. K.; Singh, Nem; Singh, S. V.; Shankar, Hari. Faecal microscopic examination: A tool for diagnosis
of Johne's disease in small ruminants. Indian Veterinary Medical
Journal. 1996; 20(3): 213-214. ISSN: 0250-5266.
Descriptors:
goats, fecal examination, diagnostic methods, Mycobacterium
avium subsp. paratuberculosis.
Johnson, L.R.W. Johne's disease. Proceedings of the North American Veterinary
Conference. 1996; 10: 671. Note: Meeting held Jan. 13-17, 1996,
NAL Call
No.:
SF605.N672
Descriptors: Camelidae, Mycobacterium avium subsp. paratuberculosis,
paratuberculosis.
Meylan, Mireille; Rings, D. Michael; Shulaw, William P.; Kowalski, Joseph J.;
Bech, Nielsen Steen; Hoffsis, Glen F. Survival
of Mycobacterium paratuberculosis and preservation of immunoglobulin G
in bovine colostrum under experimental conditions simulating
pasteurization. American Journal of Veterinary Research. 1996;
57(11): 1580-1585. ISSN: 0002-9645.
NAL Call No.: 41.8 Am3A
Descriptors: survival of bacteria Mycobacterium
avium subsp. paratuberculosis in pasteurized colostrum, effect on
IgG concentration in colostrum, pasteurization temperatures (63 C) for 30
minutes and approximately 20 to 23 C cultured in Herrold's egg yolk medium with
and without mycobactin J did not kill all bacteria.
Neutra, Marian R.; Kraehenbuhl, Jean Pierre. Antigen uptake by M cells for effective mucosal
vaccines. In Mucosal Vaccines. Edited by Kiyono, H.; Ogra, P. L.;
McGhee, J. R. Academic Press, Inc., California, US; Academic Press Ltd.,
England, UK. 1996; p. 41-55. ISBN: 0124105807.
NAL Call No.:
QR185.9 M83M86 1996
Descriptors: various enteric
pathogens, Mycobacterium avium subsp. paratuberculosis,
Salmonella spp., Shigella spp., Vibrio cholerae,
Yersinia spp.
Olcott, B.M. Johne's disease. Proceedings of the North American Veterinary
Conference. 1996; 10: 636-638. Note: Meeting held Jan. 13-17, 1996,
NAL Call
No.:
SF605.N672
Descriptors: cattle, paratuberculosis, Mycobacterium avium subsp. paratuberculosis, diagnosis, clinical aspects, disease
control.
Rossiter,
Descriptors: livestock, on the farm
suggestions, disease prevention and control, Mycobacterium avium subsp. paratuberculosis.
Shome, Rajeswari; Shome, B. R.; Krishnappa, G.; Raghavan, R. Diagnosis of bovine paratuberculosis by crossed
immunoelectrofocusing. Indian Veterinary Journal. 1996; 73(9):
911-913. ISSN: 0019-6479.
NAL Call No.: 41.8 IN2
Descriptors: sonicated antigens, Mycobacterium
avium subsp. paratuberculosis, Mycobacterium. phlei and
Corynebacterium renale, electrophoresed against bovine
antiparatuberculosis serum in CrIEF with reference to their antigenicity,
antigenic sharing and specific diagnosis.
Wards, Barry J. Evaluation of defined media
suitable for isolation of auxotrophic mutants of mycobacteria. Journal
of Basic Microbiology. 1996; 36(5): 355-362. ISSN: 0233-111X.
NAL Call No.: QR1 Z4
Descriptors: 5
liquids evaluated, solid support matrices added to liquids, Tween 80 inhibitory
effect, agar inhibited, Middlebrook 7H9.
USDA and USDA Sponsored
Research
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 JUN 2005 TERM: 31
May 2008 FY: 2005
INVESTIGATOR: Habtemariam, T.; Yehualaeshet,
T.
PERFORMING INSTITUTION: Microbiology,
SUBJECT: Comparison and validation of IS900 and
putative sequence (Mptb52.16) as a diagnostic tool for Mycobacterium avium
subsp. paratuberculosis.
NON-TECHNICAL SUMMARY: Prolonged incubation
period of Mycobacterium avium subsp. paratuberculosis and
individual variability in subclinical and clinical disease expression makes the
diagnosis of the disease challenging. The goal of this study is to develop
a more rapid and sensitive DNA-based (conventional or real-time PCR-based
diagnostic test) to detect M. avium subsp. paratuberculosis in
milk. The specificity and susceptibility of real-time PCR based on IS900
and putative sequence as target will be compared.
OBJECTIVES: General:
Paratuberculosis (Johne's disease) is a chronic granulomatous enteric disease of
mainly ruminants caused by Mycobacterium avium subsp.
paratuberculosis. A prolonged incubation period and great
individual variability in subclinical and clinical disease expression are
characteristic of paratuberculosis. Excretion of the organism may occur
for prolonged periods (1 to 2.5 years) before the onset of clinical disease
(1,2). Thus, early diagnosis of infected animals is important to avoid
spreading of the disease, because control is dependent on detection and culling
of infected animals as early as possible. Until recently, only a few M.
paratuberculosis-specific genes and antigens/epitopes have been identified,
of which IS900 has been mainly documented followed by some putative sequences
(3). Several PCR assays based on IS900 have been developed for the
detection of M. avium subsp. paratuberculosis (4,5). PCR has
been used to improve the identification of microorganisms, especially where
traditional microbiological detection methods have serious limitations. The goal
of this study is to develop a more rapid and sensitive DNA-based (conventional
or real-time PCR-based diagnostic test) to detect M. avium subsp.
paratuberculosis in milk. We will compare the specificity and
susceptibility of real-time PCR based on IS900 and putative sequence as target.
Specific objectives: Objective 1: To optimize the conventional PCR and
real-time PCR-based diagnostic test of M. avium subsp.
paratuberculosis based on IS900- insertion segment and putative sequence,
Mptb52.16. Cost analysis, including material and labor, indicated an
approximately 50% higher cost per test for bacteriological culture than for the
conventional and real-time PCR tests. The real-time PCR (RT-PCR) method is
relatively simple and robust, and results can be achieved within 24 h. The
additional advantage of DNA-based assays is the detection of non-culturable
organisms where it is critical to detect all sources of infection.
Objective 2: Determine the diagnostic limit of DNA-based diagnostic
methods in spiked milk. Milk and fecal samples are the most common
specimens for paratuberculosis diagnosis. Milk is considered to be a
difficult specimen for the detection of organisms by PCR, due to the presence of
large amounts of fat and calcium ions. Detectable quantities of M.
avium subsp. paratuberculosis have previously been reported in the
milk of both clinically infected and subclinically infected cattle with Johne's
disease. Therefore, we selected to spike the milk as the first line of
sample to determine the specificity and limitation of RT-PCR as a diagnostic
tool. Objective 3: Compare and validate the real-time PCR using IS900-
insertion and putative sequence (Mptb52.16). The main goal of this
objective is to examine whether any of the fragments have better diagnostic
potential to diagnose M. avium subsp. paratuberculosis.
Purified DNA will be analyzed by conventional and real-time PCR targeting
IS900 and putative sequence to detect M. avium subsp. paratuberculosis
in milk.
APPROACH: The DNA-based RT- PCR will target IS900 segment and
putative sequence. The details of the sequence (AF503873, Mptb52.16), for
the primers and probe synthesis will be accessed from the GenBank.
Bacterial strains, which will be used in this investigation, are: Strain
*Source or reference Origin M. avium, 15769 ATCC chicken M.
paratuberculosis, 19698 ATCC (type strain) bovine M. paratuberculosis
43015 ATCC human M. scrofulaceum 19275 ATCC M. vaccae 15483 ATCC
cow's milk *Sources of bacterial strains are from ATCC, American Type Culture
Collection (Rockville, MD, USA); The strains of M. avium, scrofulaceum
and M. vaccae will be used as a negative control. Bacterial
suspension preparation and bacterial growth: After repeated treatment of cells
in the Branson ultrasonic cleaner to disintegrate of clumps an approximate
measure of cell number will be determined by using the optical density at 550 nm
or hematocytometer. Extraction of mycobacterial DNA from culture and
spiked milk: Due to the complex, difficult matrix involved, several
strategies will be considered for the DNA extraction. To overcome this
problem, organisms will be concentrated to a pellet by centrifugation and
resuspended in prewarmed in PBS. DNA will be isolated from growing
cultures and purified by using freeze thawing, enzymatic degradation, lysis,
phenol-chloroform treatment, and isopropanol precipitation. Samples of
milk (10 ml) will be spiked with 10 to 106 M. avium subsp.
paratuberculosis organisms, and the organisms will be concentrated by
centrifugation and resuspended in 2 ml of PBS. Real-time PCR assay.
RT-PCR will be conducted in a Smartcycler. To evaluate the
usefulness of the technique we will perform a parallel study of culture
detection and Ziehl-Neelsen stain of M. avium subsp.
paratuberculosis. Quantitation: The unknown targets will be
evaluated by using DNA samples containing various amounts of known template
(range, 101 to 106 copies). Personnel and Institutional capacity: The
experience of the first PI in molecular diagnosis of Mycobacterium bovis,
as a PhD research work, will be potential to solve the unformatted difficulties.
PROJECT CONTACT:
Email: teyehual@tuskegee.edu
URL: http://compepid.tuskegee.edu/
PROJ
TYPE:
USDA INHOUSE PROJ STATUS:
TERMINATED
START: 01 DEC 1998 TERM:
12 JUN 2002 FY: 2002
INVESTIGATOR: Stanker L
H; Ravva S V; Duffy B K
PERFORMING INSTITUTION:
OBJECTIVES: 1)
Develop methods to identify Salmonella, Campylobacter, and other
bacterial and parasitic pathogens, as they are found in animal waste, and define
their survival characteristics; 2) Develop methods to handle and treat animal
manure during production in order to preclude transmission of these pathogens to
land and/or crops for human food.
APPROACH: A combination
of microbiological and biochemical approaches will be employed to characterize
the biology of pathogens in animal waste. Pathogens in manure will be
studied by confocal and scanning electron microscopy to determine whether
biofilms are present. New methods for detection and identification of
pathogens will be developed. Pathogen reporter strains will be produced.
The survival of pathogens in manure will be studied by microbiology and
molecular biology approaches. New compounds and/or treatment methods for
minimizing pathogens will be developed and tested. This research should be
conducted in collaboration with the U.S. Salinity Laboratory in
5. Duffy, B., Sarreal,
C., Stevenson, R., Ravva, S., Stanker, L. Regrowth of pathogenic bacteria in
compost teas and risk of transmission to strawberry plants.
Proceedings of 2002 International Symposium: Composting and Compost
Utilization. 2002.
1. Ravva, S.V., Duffy, B.K., Stanker, L.H., Mandrell, R.E. Foodborne
pathogens in dairy environments. 30th United States-Japan
Cooperative Program in Natural Resources (UJNR) Protein Resources Panel Meeting.
October 15-19, 2001 in Tsukuba,
2. Stanker, L.H.,
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: NEW
START: 13 JUN 2002 TERM:
31 MAY 2006 FY: 2005
INVESTIGATOR: Mcgarvey J
A; Ravva S V; Hernlem B J
PERFORMING INSTITUTION:
OBJECTIVES: 1. To
identify factors influencing survival and re-growth of human pathogenic bacteria
in a dairy system, including transfer of pathogens from manure and manure
by-products to crops. 2. To identify bacterial populations in the
manure environment. 3. To apply this information for designing pathogen
control strategies that will be both effective and
dairy-friendly.
APPROACH: Our overall
approach will be to examine pathogenic and non-pathogenic bacteria presence, and
their re-growth and transfer to agricultural crops during commercial dairy
operations, test these hypotheses in laboratory/greenhouse studies using
pathogens with bioluminescent and or antibiotic resistant markers and then
evaluate laboratory based pathogen control technologies in field trials at
commercial dairies. Rapid, sensitive pathogen detection methodologies that
are currently available will be adopted for evaluating the life cycle of
pathogen transmission on a typical
PROGRESS: 2003/10 TO
2004/09 1. What major problem or issue is being resolved and how are you
resolving it (summarize project aims and objectives)? How serious is the
problem? What does it matter? Americans suffer from 76 million cases
of food poisoning each year, causing 5,000 deaths, and costing $7 billion in
lost productivity. Most food poisoning is caused by bacteria such as those
present at high levels in manure. These include strains of E. coli,
Salmonella, and Campylobacter. Livestock also suffers from
transfer of bacterial pathogens, including Mycobacterium avium
paratuberculosis, responsible for Johne's Disease in cattle. Farm
animals and their manure are often present at high density near croplands.
Microbes from manure may be transferred to crops by aerosol, especially in
dust-, wind- and fog-prone areas. In addition, manure is often used as
fertilizer on crops for animal feed and fodder, as well as crops intended for
human consumption. This can allow direct contact between manure and
food/feed, as well as causing widespread contamination of soil. Over 80
million tons of animal manure are produced each year in the
1. Duffy, B., Sarreal,
C., Stevenson, R., Ravva, S., Stanker. L. Regrowth of pathogenic bacteria in
compost teas and risk of transmission to strawberry plants. F.C. Michel,
Jr., R.F. Rynk and H.A.J. Hoitink,editors. The JG Press, Inc.,
3. Mcgarvey, J.A.,
Bermudez, L.E. 2004. Differential gene expression in mononuclear phagocytes
infected with pathogenic and non-pathogenic mycobacteria. [No Journal name
given] 136(6):490-500.
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 07 MAR 2005 TERM:
31 DEC 2006 FY: 2005
INVESTIGATOR: Mcgarvey J
A; Mitloehner F; Zhang R
PERFORMING INSTITUTION:
OBJECTIVES: The goal of
this project is to compare dairy waste treatment methodologies, especially
varying levels of aerobic and anaerobic treatment, as well as wastewater lagoon
circulation, aeration and covering for the reduction of pathogens and volatile
compound emission. These studies will provide greater understanding of how
pathogens persist or are destroyed under various conditions and simultaneously
elucidate the type of volatile organic compounds that are emitted during
treatment. The studies will involve lab scale aerobic and anaerobic
digesters, as well as on site dairy waste lagoon experiments conducted at an
operating dairy, and thus real world conditions. The results of these
studies will have impact on the way diary waste is treated for both human health
and environmental considerations.
APPROACH: Dairy waste
treatment methodologies are of concern because of human illnesses caused by
pathogens within manure and because of volatile organic gas emissions which
cause poor air quality in and around dairy operations. Pathogens such as
E. coli O157:H7. Salmonella spp., Campylobacter spp. etc.
have caused outbreaks associated with improper diary waste treatment. In
addition, improper treatment of diary waste can emit volatile chemicals into the
atmosphere, including volatile fatty acids (VFAs), volatile organic compounds
(VOCs), and ammonia. Furthermore, improper application of diary waste to
crop fields can result in the accumulation of sodium chloride, phosphate,
nitrate and nitrite. These chemicals not only impact crop production, but
also leach into ground water making it unsuitable for human or animal
consumption. To better understand how dairy waste can be treated to
eliminate pathogens, and decrease air emissions and unwanted groundwater
leaching, we will initiate bench scale aerobic and anaerobic digester
experiments. We will feed raw diary waste (manure and urine) into aerobic
and anaerobic reactors under different parameters such as temperature, amount of
dissolved oxygen, redox potential, retention time, etc. and analyze the starting
material and effluent for microbial content. We will also collect gasses
emitted from the waste treatment systems and analyze their chemical composition
using GC/MS. We will conduct experiments with manure that has been spiked
with known amounts of pathogenic bacteria including Salmonella, E.
coli O157:H7, Mycobacterium avium subsp. paratuberculosis,
etc. to determine the effect these methodologies have on pathogen growth and
survival. Lastly we will conduct experiments on a working 800-cow dairy
farm. This farm is uniquely suited for experiments on waste treatment
methodologies because it has two waste lagoons that receive waste from the same
source, but are run independently of each other, thus providing an experimental
treatment lagoon and a control lagoon. We will treat one lagoon under
conditions found to be ideal for the reduction of pathogen and volatile organic
compound emission, and chemical changes as they evolve. This work will not
only provide proof of principal in lab experiments but will show how these
concepts correlate to real world conditions on a working dairy. Documents SCA
with UC-Davis.
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 OCT 2001 TERM:
30 SEP 2006 FY: 2005
INVESTIGATOR: Cullor, J.
S.
PERFORMING INSTITUTION:
Population Health & Reproduction,
NON-TECHNICAL SUMMARY:
Detection of M. paratuberculosis in young cattle continues to be
difficult using current tests. In an effort to improve the sensitivity and
specificity of PCR for Johne's disease screen assays, we plan to investigate a
micro-colony PCR detection method.
OBJECTIVES: Our
objective is to assess and optimize the PCR confirmation of M.
paratuberculosis microcolonies. The primary hypothesis to be tested is
that PCR analysis can be performed on micocolonies of M. paratuberculosis
appearing between 7-14 days after spirally plated on Middlebrook agar plates.
The use of PCR on micro-colonies will circumvent the problems of
sensitivity and PCR inhibition when this technique is used directly on broth
cultures, manure or tissues.
APPROACH: Bovine manure
from clinically normal cows will first be spiked with up to 1x10(8) CFU/g of
M. paratuberculosis and decontaminated via the standard protocol used by
the California Animal Health Food Safety Laboratory (CAHFS,
No publications reported
this period.
PROJECT
CONTACT:
Name: Cullor, J. S. Phone:
559-688-1731. Fax: 559-686-4231
Email: mailto:jscullor@ucdavis.edu
URL: http://www.vmtrc.ucdavis.edu/dfsl/dfsl.html
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT
NO: 98-35204-6535 PROPOSAL NO: 9802523
START: 01 DEC 1998 TERM:
30 NOV 2002 FY: 2003 GRANT YR: 1998
GRANT AMT:
$149,906
INVESTIGATOR: Gardner,
OBJECTIVES: 1. To
determine the effects of conditional dependence of test sensitivity when
combinations of tests are used for individual and herd diagnosis. 2. To
estimate sensitivity and specificity of two or more tests in combination when
there are more than two populations and no Gold standard.
APPROACH: To achieve
Objective #1, we will use existing data on tests for bovine paratuberculosis,
swine brucellosis, swine toxoplasmosis and beta-lactan residues in low milk.
As a model for other diseases, we will determine the optimal combination
of tests to determine an individual's and herd's paratuberculosis status,
incorporating decision and cost-benefit analyses, where ever appropriate.
For Objective #2, we will evaluate data sets that include results for
multiple tests for paratuberculosis and other animal diseases and use the
estimation-maximization algorithm and Gibbs sampler to perform
calculations.
PROGRESS: 1998/12 TO
2002/11. We have implemented a Bayesian method for estimation of
sensitivity and specificity when there are 2 correlated (dependent) tests and 2
populations with different prevalences and the true disease status is unknown
(i.e. there is no gold standard). All uncertainty in the accuracy of tests
and disease prevalence is modeled through the use of probability distributions.
Our previous work identified that a positive correlation between test
results lead to an overestimation of the accuracy of both tests using
traditional statistical methods that assume that the tests are conditionally
independent (uncorrelated). Correlation typically occurs when the 2 tests
measure similar biologic processes e.g. serum antibody responses. The
model has been applied to the evaluation of 2 serologic tests for toxoplasmosis
in pigs and we have shown that the model yields unbiased estimates of test
sensitivity and specificity. We have developed a web-based interface using
an HTML form for implementation of methods to estimate test sensitivity and
specificity in the absence of a gold-standard. The programs can
incorporate data obtained from several populations, results of multiple tests
and can account for data from a reference population in which the true status
(infected or not infected) or each individual is known exactly. Two
estimation methods are used and both assume test independence conditional on the
infection status of individuals and constant test accuracy in each population.
The program is available at www.epi.ucdavis.edu/diagnostictests/
IMPACT: 1998/12 TO
2002/11 The development of a web-based program will allow for more
widespread implementation of these methods by scientists involved in the
assessment of accuracy of animal diagnostic tests.
PUBLICATIONS: 1998/12 TO
2002/11
1.
4. Pouillot R, Gerbier
G,
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT
NO: 2001-35204-10874 PROPOSAL NO: 2001-02494
START: 15 OCT 2001 TERM:
31 OCT 2003 FY: 2005 GRANT YR: 2002
GRANT AMT:
$205,000
INVESTIGATOR: Gardner,
NON-TECHNICAL SUMMARY:
Trade in animals and animal products is in part dependent on the validity of
assurances that exporting herds and countries provide about the infection status
of their animals. Our objective is to develop Bayesian models that can be
used to make improved inferences about freedom from infection for a single herd
or multiple herds in a country/region. We will use beta distributions to
model uncertainty and variability in test sensitivity and specificity, and
prevalence. For the single-herd model, we will use bovine paratuberculosis
as our example because of current interest in the Voluntary Johne's Disease Herd
Status Program (VJDHSP) and the difficulties inherent in differentiating low
prevalence from non-infected herds. For the multiple-herd model, we will
use survey data on porcine reproductive and respiratory syndrome, infectious
bovine rhinotracheitis and bluetongue to validate our model. There are
often extensive surveillance data that can complement negative survey findings,
but there are no standardized methods for incorporating these data into
assessment of freedom from infection. Our final objective is to develop
Bayesian methods for incorporation of non-survey data and adjustment for
time-dependent changes in the quality of survey and surveillance data. We
will use data on bovine spongiform encephalopathy, brucellosis and tuberculosis
for these assessments. The methods developed will be adaptable to most
infectious livestock diseases, including those of interest to commodity groups
such as the VJDHSP and to those that are federally regulated such as
brucellosis.
OBJECTIVES: To develop
Bayesian methods for: (1) Certification of the status of a single herd with
respect to prevalence and freedom from infection (incorporating the prior
probability of infection and uncertainly and variability in test sensitivity and
specificity). (2) Certification of status of a group of herds with respect
to within-herd prevalence, proportion of infected herds and freedom from
infection (incorporating the prior probability of infection, uncertainty and
variability in test sensitivity and specificity, and the possible clustering of
positive test results at the herd level). (3) Incorporation of non-survey
data and adjustment for time-dependent changes in the quality of survey and
surveillance data.
APPROACH: We will use
beta distributions to model uncertainty and variability in test sensitivity and
specificity, and prevalence. Gibbs sampling will be used to combine prior
distributions and herd-level test results into a posterior prevalence
distribution. For the single-herd model, we will use bovine
paratuberculosis as our example because of current interest in the Voluntary
Johne's Disease Herd Status Program (VJDHSP) and the difficulties inherent in
differentiating low prevalence from non-infected herds. For the
multiple-herd model, we will use survey data on porcine reproductive and
respiratory syndrome, infectious bovine rhinotracheitis and bluetongue to
validate our model. PROGRESS: 2001/10 TO 2003/10. Trade in animals
and animal products is in part dependent on the validity of assurances that
exporting herds and countries provide about the infection status of their
animals. We developed Bayesian hierarchical models for determining
infection status and infection prevalence given testing of all or a sample of
animals from a single herd with an imperfect test. Expert prior
information about herd infection status, diagnostic test accuracy are
incorporated into the model. Posterior versus prior probabilities are
presented as a curve, summarizing the probability of infection over a range of
possible prior probability values. The model has been applied to serologic
data for paratuberculosis in dairy herds. For the multiple herd setting,
we created a model that allows for 3 levels of inference: probability that a
country (region) is free of infection, the proportion of infected herds in an
infected country, and the within-herd prevalence. The model uses test
results from animals sampled in a two-stage cluster sample of herds. The
model was validated with simulated data and applied to surveys of
1. Suess EA,
3. Hanson TE, Johnson
WO,
6. Johnson WO, Su CL,
9. Branscum AJ,
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 15 APR 2005 TERM:
14 APR 2009 FY: 2005
INVESTIGATOR: Gardner,
OBJECTIVES: 1. To
quantify and evaluate the role of the environmental bio-burden of
Mycobacterium avium subsp. paratuberculosis (Map) in the
transmission of Johne's disease on dairy farms. 2. To evaluate optimal
testing strategies for detection of Map in dairy herds.
APPROACH: Objective 1,
numbers of Map bacteria in multiple environmental locations in dairy herds will
be quantified using Herrold's egg yolk medium and the Trek ESP II system.
Cultures which yield values that are very high shedders will be quantified
further by serial dilution to estimate the most probable numbers of bacteria in
the samples. Objective 2, a stochastic simulation model will be modified
to evaluate various testing (including use of environmental samples) and
sampling methods for detection of Map in dairy herds.
PROGRESS: 2005/01 TO
2005/12. The specific objectives of the study are to 1) quantify
concentrations of Map, as measured by culture on Herrolds egg yolk medium (HEYM)
and in liquid culture (Trek ESP II), in environmental samples including recycled
lagoon water used for flushing cow alleyways, 2) collect environmental Map data
biannually with the goal of correlating changes in current values with changes
in cohort specific Map risk when females born in the herd at the time of
sampling are in the second or later lactation, and 3) quantify the Map colony
counts on HEYM tubes where results are recorded as too numerous to count (TNTC),
equivalent to approximately more than 70 colonies per tube. We started our
investigation in a dairy with about 2700 lactating cows (aggregated in 12
strings), 300 dry cows and about 150 pregnant heifers. Currently, fecal
culture prevalence and ELISA seroprevalence of cows (n=976) at dry-off are 9.4%
and 4.6%, respectively. Testing of fecal slurry samples in February 2005
collected from alleyways using a standardized protocol showed that 100% (12/12)
were positive on HEYM, including 25% (3/12) alleyways had at least one HEYM tube
that had Map colonies that were TNTC. Repeat testing of the herd in
October 2005 using the Trek ESP II system yielded similar findings. In
November 2005, we investigated logistical aspects of detection of TNTC cows in
this herd. All environmental samples were positive by quantitative
real-time (qrt) PCR and one sample was positive using the qualitative PCR
available through the Minnesota Diagnostic Laboratory. We are currently
doing follow-up testing of 3 strings identified as having different likelihoods
(high, moderate and low, respectively) of having cows that are shed Map.
Group-level serum ELISA results correlated well with qrtPCR data.
Samples from 17 ELISA positive cows within these strings were submitted
for HEYM culture and qrtPCR testing in December 2005.
IMPACT: 2005/01 TO
2005/12. Cows shedding large numbers of Map pose a tremendous risk for
transmitting the organism to other cattle on the farm, and they may also
contribute to passive (pass through) fecal shedding of Map by uninfected cows,
and thus false-positive fecal culture results. That some fecal culture
results (low and moderate shedders) might be false positives is a major paradigm
shift for management of bovine paratuberculosis and also has implications for
evaluation of serologic tests for Map because most investigators use fecal
culture as the gold standard.
PUBLICATIONS: 2005/01 TO
2005/12.
Berghaus RD, Farver TB, Anderson
RJ, Jaravata CC,
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT
NO: 2003-35204-13374 PROPOSAL NO: 2003-02398
START: 01 AUG 2003 TERM:
31 JUL 2006 FY: 2005 GRANT YR: 2003
GRANT AMT:
$157,000
INVESTIGATOR: Gardner,
NON-TECHNICAL SUMMARY:
Correct classification of herd status for animal pathogens is an integral
component of disease control programs, risk-factor studies, health certification
programs, and risk analyses related to animal movements. Our long-term
research goal is to develop new methods to assess test accuracy for animal
diseases, to improve classification of herd disease status and apply these
methods to herd testing for bovine paratuberculosis. First, we will
develop methods that use quantitative test results in the overall assessment of
herd-level sensitivity and specificity. To achieve this objective we will
use ELISA values for paratuberculosis infected and non-infected cattle and
develop a generalized linear model that includes animal and herd-level risk
factors. Second, we will develop Bayesian methods for estimating the
herd-level sensitivity and specificity of testing systems for animal diseases
when there are two conditionally independent or dependent tests. We expect
that Bayesian methods will be superior to traditional frequentist methods for
assessing the accuracy of herd-level tests when there is no "gold standard" and
where tests are conditionally dependent. We will use paired ELISA and
fecal culture results from three paratuberculosis studies. We will assess
cut-off dependent and independent approaches for herd classification.
Methods developed in the proposed research will be applicable to many
infectious animal diseases where quantitative test results are available and
where herd-level interpretation of test results in the basis of classification
of disease risk.
OBJECTIVES: Develop and
apply methods that account for the quantitative nature of test results in the
overall assessment of herd-level sensitivity and specificity. Develop and
apply Bayesian methods for estimating the herd-level sensitivity and herd-level
specificity of testing systems for animal diseases when there is one test or two
conditionally independent or dependent tests. APPROACH: For objective 1, we will
develop a general linear mixed model that discriminates the quantitative test
scores from infected and non-infected animals. The model will allow for
the possibility of animal-level risk factor (covariate) information such as age,
lactation number, an indicator of purchased versus raised etc., and for
herd-level information such as average age, type of ownership etc. In
addition, we will extend this univariate model to a multivariate model that
allows for several diagnostic tests. The model will be applied to ELISA
and culture data for bovine paratuberculosis. Once this initial study is
completed using "gold standard" information, we will extend the problem to the
situation where the true status of individual animals is unknown. This
will be achieved with use of a "mixture" model that is based on weighted average
of the densities of test results corresponding to infected and non-infected
animals. For objective 2, we will develop and compare cutoff-based and
cutoff-independent methods of assessing herd-level sensitivity and specificity.
The latter method allocates a herd as positive if the posterior
probability that the herd is infected, given all observed data, is larger than a
specified value e.g. 95%. The methods will be applied to one test in a
single population, two tests in one population, and two tests in two or more
populations. We will also allow for the possibility of sequential and
simultaneous use of multiple tests. Our Bayesian approach will involve
Gibbs sampling, a Markov chain Monte Carlo simulation technique, that allows for
incorporation of existing information about test sensitivity and specificity,
and disease prevalence.
PROGRESS: 2005/01 TO
2005/12. Our long-term goal is to develop new methods to assess test
accuracy for animal diseases, to improve classification of herd disease status
and apply these methods to herd testing for bovine paratuberculosis. As
part of our first objective, we developed and applied Bayesian methods for
estimating the herd-level sensitivity and herd-level specificity of testing
systems for animal diseases when there is one test or two conditionally
independent or dependent tests. We considered 4 different sampling
schemes: a single test case and three sequential test cases. The
corresponding herd-level characteristics were calculated and compared with
different sample sizes, sampling schemes, animal-level sensitivity, specificity,
and cut-off values. Models were developed to incorporate animal or
herd-level risk factors and models with small herd size are also considered.
We compared posterior estimates of animal and herd-level characteristics
for these four sampling schemes with simulated data. Two examples, one for
bovine paratuberculosis and a second for Salmonella in pig herds, were
used to demonstrate application of the methods in field studies (Su et al.,
2006). As part of our second objective, we developed a Bayesian approach
to sample size calculations for cross-sectional studies designed to estimate
sensitivity and specificity of one or more diagnostic tests. Sample size
calculations can be made for common study designs such as one test in one
population, two conditionally independent or dependent tests in at least 2
populations, and three tests at least 2 populations. We determined a
sample size combination that yields high predictive probability, with respect to
the future study data, of accurate and precise estimates of sensitivity and
specificity. We also consider hypothesis testing for demonstrating the
superiority or equivalence of one diagnostic test relative to another. The
predictive probability can also be computed when the sample size combination is
fixed in advance, thereby providing a power-like measure for the future study.
The method is straightforward to implement using the S-Plus/R library
emBedBUGS together with WinBUGS (Branscum et al., 2006).
IMPACT: 2005/01 TO
2005/12. Correct classification of herd status for animal pathogens is an
integral component of disease control programs, risk-factor studies, health
certification programs, and risk analyses related to animal movements.
This classification is primarily dependent on the interpretation of
diagnostic tests results at the herd-level. Our approach is based on
Bayesian methods which allow incorporation of prior information and knowledge
about test performance into the current study. Our research findings allow
users greater flexibility in study planning and data analysis than are sometimes
available with traditional statistical approaches. Wherever possible, we
have written code in the shareware program WinBUGS so that it can be used
widely. Code for these problems is available to users on our website, www.epi.ucdavis.edu/diagnostictests/
PUBLICATIONS: 2005/01 TO
2005/12
1. Branscum AJ, Johnson
WO,
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 2000 TERM:
30 SEP 2004 FY: 2003
INVESTIGATOR: Gardner,
NON-TECHNICAL SUMMARY:
If countries and regions are able to "certify" freedom from important animal
pathogens, trade opportunities may increase and product export costs may
decrease. To develop a Bayesian statistical approach (using Gibbs
sampling) to quantification of disease freedom. The output from the model
will be probability distributions that can be used to make inferences about the
proportion of diseased herds, within-herd prevalence, and the probability that a
country is free of disease. The research will be involve collaboration
with others in the
OBJECTIVES: 1. Develop a
Bayesian approach to certify disease freedom of a country/region that
incorporates uncertainty in probability estimates. 2. Compare frequentist
and Bayesian approaches to certify disease freedom using common data sets and to
compare sample size requirements for surveys with both
approaches.
APPROACH: 1. The
Bayesian approach will be implemented with the Gibbs sampler, an interactive
Markov-chain Monte Carlo method. The mathematical calculations will
incorporate the prior probability that a country is free of disease, the
uncertainty in sensitivity and specificity estimates and the possible clustering
of positive test results at a herd level. The output will be a
probabilistic estimate of disease freedom. 2. Frequentist and Bayesian
estimates will be compared with common published data sets on porcine
reproductive and respiratory syndrome and Newcastle Disease. The effect of
selected prior distributions for the Bayesian approach will be evaluated.
Sample sites used in frequentist calculations for surveys will be compared
with estimates that we will derive using Bayesian approaches.
PROGRESS: 2000/10 TO
2004/09 Quantitative methods to certify freedom from animal pathogens (no
change from what was submitted last year (see below): Quantitative approaches
are needed to allow scientifically-valid inferences about freedom of animals
from important pathogens that affect animal trade locally, regionally and
internationally. Freedom in the context of these inferences includes a
herd prevalence of a pathogen less than a threshold value (e.g. <0.2% of
infected herds). In a related project, we have developed Bayesian models to make
probabilistic inferences for multiple herds and for single herds. The
single herd model has both a binomial sampling version (relevant to a small
sample of the herd e.g. 10% of animals) and a hypergeometric version (relevant
to testing of the entire herd. In the model, expert prior information
about the infection status of the herd, diagnostic test accuracy (sensitivity
and specificity) and within-herd prevalence are used, when such data are
available. Post-test probabilities versus pre-test probabilities of
infection are presented in the novel form of a curve, summarizing the
probability of infection over a range of possible prior probability values.
The primary objective of this study is to collect field data to validate
the suitability of the Bayesian models under field conditions. The model
is currently being evaluated using serologic and fecal culture data for
Mycobacterium paratuberculosis infection in 29 herds in the Central
Valley of California. ELISA testing of 60 adult cows in each of the
selected herds has been completed. Results were interpreted as per
standard procedures at the California Animal Health and Food Safety Laboratory:
<0.2 = negative, 0.2 to 0.35 = suspicious, and >0.35 = positive. For
the 29 herds, the median number of positive or suspicious animals out of the 60
cows tested was 3 (range, 0 to 15). Five herds had no positive cows in 60
tested. We have completed follow-up ELISA testing of all adult cows in 2
of the herds with 0/60 positive on the initial screening and found 15/332 (4.5%)
and 16/1144 (1.4%) ELISA-positive/suspicious samples. Fecal samples are
currently being cultured from the 31 reactors to try and unequivocally establish
whether these 2 herds are infected.
IMPACT: 2000/10 TO
2004/09. Our initial findings indicated that screening of 60 lactation-2
or older cows with ELISA in large California dairy herds (median size, 700 cows)
provides a reasonable balance between cost of testing and failing to detect low
prevalences of M. paratuberculosis infection.
PUBLICATIONS: 2000/10 TO
2004/09.
1.
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 APR 2005 TERM:
31 MAY 2007 FY: 2005
INVESTIGATOR: Cullor, J.
S.
PERFORMING INSTITUTION:
Population Health and Reproduction.
NON-TECHNICAL SUMMARY:
In order to insure animal health, food safety and security, and supply needed
scientific information to develop better management practices and support and
enforce regulatory decisions, there is a need for a broad based detection system
to rapidly detect potential vectors of animal and foodborne diseases on the
dairy farm environment. This project seeks to develop a rapid and high
sample throughput detection system that can be applied to a wide variety of
on-farm sample types including milk, cattle feed and water for the control of
infectious agents.
OBJECTIVES: The overall
goal of this project is to further develop, optimize and characterize the
sensitivity, specificity and ease of performance of an automated DNA extraction
method coupled with PCR technology on a variety of on-farm sample types, for the
identification of infectious agents, or potential vectors of infectious
diseases. These sample types include 1.) mastitic milk, for the direct and
rapid detection of various bacterial pathogens including Mycoplama bovis
and streptococcus species 2.) cattle feed, for the detection of prohibited
ingredients including ruminant DNA to prevent the spread of Mad Cow disease and
3.) agricultural water for the presence of potential waterborne pathogens
including E. coli 0157 and Salmonella which can be shed by
asymptomatic cattle.
APPROACH: 1.) To
evaluate a automated DNA extraction protocol to be used on milk, cattle feed and
agriculture water for its ability to abrogate the effects of inhibitory agents
and rapidly process numerous samples. 2.) To further develop PCR primers
and florescent probes to detect and identify various waterborne infectious
agents including E. coli 0157 and Salmonella. 3.) To
optimize and characterize each DNA extraction /PCR assay for sample throughput,
lower limit of detection, sensitivity, specificity and ease of performance using
laboratory spiked samples.
PROGRESS: 2005/01 TO
2005/12. An automated DNA extraction system based on magnetic bead
technology has been purchased, set-up, and its use, including training, offered
to other research units within the
PUBLICATIONS: 2005/01 TO
2005/12.
No publications reported
this period
PROJECT
CONTACT:
Name: Cullor, J. S. Phone: 559-688-1731. Fax:
559-686-4231
Email: jscullor@ucdavis.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 APR 2005 TERM:
31 MAY 2010 FY: 2005
INVESTIGATOR: Gardner,
NON-TECHNICAL SUMMARY:
There are many deficiencies in existing knowledge about the transmission and
detection of Map in cattle herds, including how to most effectively use
currently-available tests for diagnosis of Map infection. This project
will assess persistence of the Map on dairy farms and methods for quantification
of bioburden.
OBJECTIVES: 1. To
quantify and evaluate the role of the environmental bio-burden of
Mycobacterium avium subsp. paratuberculosis (Map) in the
transmission of Johne's disease on dairy farms. 2. To evaluate optimal
testing strategies for detection of Map in dairy herds.
APPROACH: For objective
1, numbers of Map bacteria in multiple environmental locations in dairy herds
will be quantified using Herrold's egg yolk medium and the Trek ESP II system.
Cultures which yield values that are very high shedders will be quantified
further by serial dilution to estimate the most probable numbers of bacteria in
the samples. For objective 2, a stochastic simulation model will be
modified to evaluate various testing (including use of environmental samples)
and sampling methods for detection of Map in dairy herds.
PROGRESS: 2005/01 TO
2005/12 The objectives of the study were to evaluate the effectiveness of
various testing methods for detection of Map-infected herds at the initial step
of herd classification, and 2) to determine the most cost-effective testing
strategies for detection of Map-infected herds for various herd demographic
factors. A stochastic simulation model was used to compare the
cost-effectiveness of 7 currently-available testing methods for detection of
Map-infection in
No publications reported
this period
PROJECT
CONTACT:
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 27 SEP 2002 TERM: 26
SEP 2003
INVESTIGATOR: Gardner,
PERFORMING
INSTITUTION: Medicine and Epidemiology.
SUBJECT: Field evaluation of
fecal pool cultures for detection of Mycobacterium paratuberculosis in large
dairy herds.
NON-TECHNICAL SUMMARY: Johne's Disease is a chronic
infectious and wasting bacterial disease of ruminants caused by Mycobacterium
avium subspecies paratuberculosis (MAP) and occurs worldwide.
This project will apply new epidemiologic approaches to test evaluation
and prevalence estimation for Mycobacterium paratuberculosis in dairy
herds using field data.
APPROACH: 1. Determine the sensitivity of pooled fecal
culture by 2 methods (TREK and traditional HEY culture) relative to individual
fecal culture. 2. Estimate the prevalence of infected herds and
within-herd prevalence in
PROGRESS: 2002/09 TO 2003/09 We evaluated the sensitivity of
pooled fecal culture for detection of Mycobacterium avium subsp.
paratuberculosis (Map) in large dairy herds and assessed the utility of
the method for estimation of Map prevalence. We used a cross-sectional
study design that involved random sampling of 60 cows in each of 29
IMPACT: 2002/09 TO
2003/09. Use of fecal pools from 10 cows was a cost-effective tool for
herd screening and might provide a good estimate of the percentage of
Map-infected cows in low prevalence herds.
PUBLICATIONS: 2002/09 TO
2003/09
Saraya Tavornpanich, Ian A. Gardner, Randall J. Anderson, Sang Shin,
Robert H. Whitlock, Terry Fyock, John M. Adaska, Richard L. Walker, Sharon K.
Hietala. 2004. Evaluation of pooled fecal culture for detection of
Mycobacterium avium
PROJECT
CONTACT:
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JAN 2003 TERM: 31
DEC 2004
INVESTIGATOR: Adaska, J. M.
PERFORMING INSTITUTION:
CA Animal Health and Food Safety Laboratory System (CAHFS).
PROGRESS: 2003/01 TO
2004/12 The main objective of the project was to determine whether or not
the causal organism of Johne’s disease, Mycobacterium avium ssp.
paratuberculosis (MAP), was present and viable in pre- and
post-pasteurized samples of hospital milk being fed to calves on calf ranches.
We initially enrolled five calf ranches but one dropped out after the
initial sampling period leaving data from four for analysis. Three of the
calf ranches each collected milk from approximately forty dairies while the
fourth collected milk from 15 dairies. All four ranches reported that they
heated milk to approximately 165degreesF and had holding time of 2-3 minutes.
We were able to identify MAP by PCR in about 5% of pre-pasteurization
samples and from the same percentage of post-pasteurization samples. There
was no agreement between which samples were positive pre-pasteurization and
which were positive post-pasteurization. It needs to be kept in mind that
PCR identifies the presence of DNA and can be positive even in samples where no
viable or infectious organisms are present. By culture we have been able
to identify viable organisms in 2.5% of the total samples with an equal number
found in pre-pasteurization samples and post-pasteurization samples. The
results of this study indicate that hospital milk collected from several dairies
and fed to calves on calf ranches is a potential source of infection of calves
with the causal organism of Johne’s disease. We were able to isolate MAP
from post-pasteurization samples indicating that the pasteurization methods
currently in use on the calf ranches in this study (165 degrees F for 2-3
minutes) may not be adequate to kill MAP in hospital milk. Because the
pasteurization equipment was not evaluated or monitored during the course of the
study however it is possible that technical problems with the equipment
resulting in contamination of post-pasteurization samples or inadequate
temperature or time of pasteurization may have resulted in inadequate killing of
MAP. The significance and benefit to the dairy industry from this work is
that a major question, whether dilution, by combining hospital milk from several
dairies, would result in MAP being undetectable and presumably an insignificant
source of infection in milk fed to calf ranch calves. Further, the study
answered the question of whether or not on-farm pasteurization eliminates 100%
of the viable organisms in those same milk samples. 3. Conclusions:
Mycobacterium avium ssp paratuberculosis was detected by PCR from
approximately 5% of hospital milk fed to calves on four
PUBLICATIONS: 2003/01 TO
2004/12
No publications reported
this period
PROJECT
CONTACT:
Name: Adaska, J. M. Phone: 559-688-7543. Fax:
559-686-4231
Email: jmadaska@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JAN 2002 TERM:
31 DEC 2002 FY: 2003
INVESTIGATOR: Cullor, J.
S.; Smith, W.; Kirk, J.
PERFORMING INSTITUTION:
Population Health & Reproduction.
NON-TECHNICAL SUMMARY:
The detection of M. paratuberculosis (Johne's disease) in young cattle
continues to be difficult using current tests. There is a lack of good
screening assays that are fast, inexpensive and sensitive enough to regularly
and frequently screen cattle. This project seeks to improve Johne's
disease screening assays by modifying the conventional media culturing method in
ways to shorten the time required for results, while maintaining low costs, ease
of performance and the sensitivity/specificity which is characteristic of
conventional culturing methods.
OBJECTIVES: Conventional
media culturing for M. paratuberculosis involves decontaminating the
sample with various agents and antibiotics followed by subculturing onto solid
agar slants which are incubated for many weeks to months before visible colonies
appear. This project examines the hypothesis that the culturing step can
be modified by the substitution of spiral plating on Middlebrook agar and the
addition of micro-colonial morphology screening to obtain primary culture
results more rapidly.
APPROACH: The first
objective is to assess the ability of the spiral plating micro-colony morphology
screening method (SP/MCM) to return results more rapidly than the conventional
culture method using 'spiked' manure samples. Once this is confirmed the
second objective is to assess the SP/MCM method on actual field samples from
herds with high incidence of Johne's disease.
PROGRESS: 2002/01 TO
2002/12. Previous results funded by other grants, suggested that a
modification in the way that manure samples were plated and screened could
provide a more rapid detection of Mycobacterium paratuberculosis, however
these results were obtained from manure samples containing very high numbers of
the organism. In order to compare the modified culture technique to
conventional culture methods, additional studies were necessary to optimize the
sensitivity (lower limit of detection) of the assay. Because M.
paratuberculosis has an extremely prolonged growth rate, clinical samples
are first "decontaminated" with agents that will suppress the growth of other
faster growing bacteria. However these agents can also suppress the growth
of mycobacteria to varying degrees. Several methods to decontaminate the
samples prior to plating are being investigated and optimized so that the very
low numbers of mycobacteria that may be present in the naturally infected animal
can be detected. Results to date suggest that a commonly used
decontamination agent, HPC (hexadecylpyridinium chloride) continues to suppress
the growth of mycobacteria after being plated and during incubation, thus
hindering the detection of very low numbers in the sample.
IMPACT: 2002/01 TO
2002/12. Johne's is a contagious bacterial disease of ruminants that has
significant animal health, economic, and potential human health consequences.
This grant provides additional funding to investigate and optimize the
sensitivity of a more rapid culture method for the detection of the M.
paratuberculosis from bovine manure.
PUBLICATIONS: 2002/01 TO
2002/12
No publications reported
this period
PROJECT
CONTACT:
Name: Cullor, J. S. Phone: 559-688-1732. Fax:
559-688-4231
Email: jscullor@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JAN 2002 TERM:
31 DEC 2002 FY: 2003
INVESTIGATOR: Gardner,
OBJECTIVES: This project
will examine whether Bayesian methods can be successfully applied to analysis of
Johne's Disease herd-test results thereby better accounting for uncertainty in
test performance, prevalence estimates and the herd-specific pretest (prior)
probability of JD.
APPROACH: This will be
accomplished by developing and expanding an existing Bayesian model for
certification of Johne's disease. This will include addressing multiple
stages of disease, hypergenometric sampling and use of multiple
tests.
PROGRESS: 2002/01 TO
2002/12. We have developed a Bayesian computer model to allow improved
inferences about the infection status of dairy herds with Mycobacterium
paratuberaculosis, the causative agent of Johne's disease, based on herd
testing. The model links laboratory test results from a sample of cows or
the entire cow herd with test accuracy data and prior information from the herd
to provide updated inferences about the probability that the herd is infected
and within-herd prevalence. In the model, uncertainty in all model inputs
is modeled as a probability. The model currently is being validated with
serum enzyme-linked immunosorbent assay (ELISA) and fecal culture data from 29
PUBLICATIONS: 2002/01 TO
2002/12
No publications reported
this period
PROJECT
CONTACT:
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JAN 2003 TERM: 30
DEC 2004 FY: 2004
INVESTIGATOR: Gardner,
PERFORMING INSTITUTION: Medicine & Epidemology.
SUBJECT:
Certification of
OBJECTIVES: This project will examine whether
Bayesian methods can be successfully applied to analysis of Johne's Disease
herd-test results, thereby better accounting for uncertainty in test
performance, prevalence estimates and the herd-specific present probability of
JD.
APPROACH: 1. Determine the sensitivity of pooled fecal culture relative
to individual fecal culture. 2. Estimate the prevalence of infected dairy
herds and within-herd prevalence based on pooled fecal culture results and
individual animal results.
PROGRESS: 2003/01 TO 2004/12 The objectives
of the study were to 1) estimate the sensitivity of pooled fecal culture(10
randomly-selected samples per pool) for detection of Mycobacterium avium
subsp. paratuberculosis (Map) in large dairy herds and 2)assess the
utility of the method for estimation of Map prevalence. A cross-sectional
study design that involved random sampling of 60 cows in each of 29
IMPACT: 2003/01 TO 2004/12 Use of fecal pools from 10 cows was
a cost-effective tool for herd screening and might provide a good estimate of
the percentage of Map-infected cows in low prevalence herds with minimal amounts
of previous testing. Other low cost detection methods such as
environmental sampling are currently being evaluated by our group in
collaboration with the
PUBLICATIONS: 2003/01
TO 2004/12
1. Tavornpanich, S., I.A. Gardner, R.J. Anderson, S. Shin, R.H.
Whitlock, T.Fyock, J.M. Adaska, R.L. Walker, and S.K. Hietala.
Evaluation of microbial culture of pooled fecal samples for detection
of Mycobacterium avium subsp. paratuberculosis in large dairy
herds. American Journal of Veterinary Research 2004;
65:1061-1070.
PROJECT
CONTACT:
Name: Gardner,
Email: iagardner@ucdavis.edu
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 01 JAN 1994 TERM:
30 JUN 2006 FY: 2005
INVESTIGATOR: Cullor, J.
S.
PERFORMING INSTITUTION:
Population Health and Reproduction.
OBJECTIVES: The Dairy
Food Safety Laboratory's mandate is to provide consistent, rapid response of
applied research on herd health and food safety questions as they arise.
The Laboratory has effectively served as the focus of collaborative
efforts between UC faculty (Veterinary Medicine, Veterinary Extension, Animal
Science), state and federal regulatory agencies, the National Mastitis Council,
National Milk Producer's Federation, Cal Poly SLO, dairy producers, processing
plants/cooperatives, farm advisors, and private industry. The DFSL is
gaining a high profile in private and public arenas as a genuinely outstanding
effort and has received glowing compliments from a USDA site review panel in
1995.
APPROACH: Areas of
applied and basic research which the Laboratory will pursue during this funding
period include: A. Expand the Dairy Food Safety Laboratory Home Page on the
internet. B. Continue development of the J6 vaccine and perform vaccine safety
trials on commercial products. C. Continue discussions with
IMPACT: 2005/01 TO
2005/12. The DFSL accomplishes its mission by performing rapid response,
applied research on dairy herd health and on-farm food safety issues of concern
to the public. This program sustains and enhances the marketability of
milk and dairy beef to the consumer in
1. Kirk,JH,
3. Wu, JY, Delwiche MJ,
Cullor, JS, Smith Wl. Deoxyribonucleic acid sensor for the detection of
somatic cells in bovine milk. Biosystems Engineering. 2005; 90(2):
143-151
4. Cullor, JS.
Applied biosecurity for dairy farms. Medecin Veterinaire du
Quebec. 2004; 34(1/2): 32-33.
5. Payne MA, Wetzlich
SE, Robb EJ, Brown SA,
7. M. C. Lagunas-Solar,
J. S. Cullor, N. X. Zeng, T. D. Truong, T. K. Essert, W. L. Smith and C. Pina.
Disinfection of dairy and animal farm wastewater with radiofrequency
power. In Press, Journal of Dairy Science 2006.
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 28 JAN 2003 TERM: 27
JAN 2005
INVESTIGATOR: Cullor, J. S.
PERFORMING INSTITUTION:
Population Health and Reproduction.
SUBJECT: Diagnostic testing and
management schemes for the control of the Johne's agent in
milk.
NON-TECHNICAL SUMMARY: Johne's disease is a chronic
infectious and wasting bacterial disease of ruminants caused by Mycobacterium
avium subspecies paratuberculosis (MAP) and occurs worldwide.
The PI has undertaken preliminary work to develop a rapid and sensitive
Johne's non-invasive diagnostic and a management program for eradication of
Johne's disease. This project will take the next step to incorporate the
diagnostic into Dairy-BTM (Dairy Breakthrough Management - a HACCP program) and
develop an interactive software program.
OBJECTIVES: The specific aim
of this project is to further develop, refine and test an improved Johne's
diagnostic test on both manure and milk and then integrate the test into an
existing Johne's management program that is then reduced to farm-ready
interactive software. This project is supported by the UC Star
Biotechnology Program, RZ Syntopical Technologies and California Dairy Research
Foundation.
APPROACH: The two fold approach is: Can spiral plating technology
be used to generate a rapid sensitive and specific Johne's disease assay and 2)
Can the Johne's spiral plate assay be incorporated into a management program,
reduced to software, that is effective in preventing Johne's infection in
non-impacted herds and eliminating Johne's disease in impacted
herds?
PROGRESS: 2003/01 TO 2005/01. A rapid culture method for the
detection of Mycobacterium avium subsp. paratuberculosis (MAP) in
raw milk has been developed. The method incorporated a zwitterionic
detergent that concentrates MAP bacteria (CB18) and spiral plating with
microscopic colony screening. Raw bulk tank milk from a paratuberculosis
negative herd was spiked with different concentrations of MAP (10(6) to
10cfu/ml) and processed using this novel method as well as the conventional
method (HEYM). Time and limit of detection was recorded and compared
between the two assays. Both essays were repeated independently eight
times. On average, the presence of MAP in spiked milk samples could be
detected between 14 and 45 days (mean=23) using the CB18/spiral plater method
and between 21 and 63 days (mean=30.9) using the HEYM culture method (the time
to detection between the two methods was statistically different at p<0.001).
Samples containing higher concentrations of spiked MAP were detected
earlier than the samples containing lower concentrations in both methods and the
limit of detection did not differ statistically. A real time PCR assay
using CB18 was also developed and evaluated. Bulk tank milk was spiked
with 10(4) to 1cfu of MAP per ml. Different DNA extraction methods, milk volumes
(5 versus 12.5ml) and PCR probes were tested and compared. The best assay
method was able to detect 100% of the samples spiked with 100cfu/ml (9 out of
9), 55% of the samples spiked with 10cfu/ml (5 out of 9) and 20% of the samples
spiked to 1cfu/ml (1 out of 5). Both the real time PCR and milk culture
methods using CB18 are currently being tested on samples from dairy farms.
The DFSL is collaborating with other UC Davis investigators who have been
providing pre and post pasteurized waste milk from calf ranches in the
IMPACT: 2003/01 TO 2005/01. Johne's is a contagious bacterial
disease of ruminants that has significant animal health, economic, and potential
human health consequences. The results thus far are providing the
preliminary data for designing field testing experiments to determine
sensitivity and specificity of the assay so that positive and negative predicted
value versus disease prevalence can be determined. This data will
eventually be used in the development of on-farm management protocols to control
the spread of Johne's disease.
PUBLICATIONS: 2003/01 TO 2005/01
No
publications reported this period
PROJECT CONTACT:
Name: Cullor, J. S. Phone: 559-688-1731. Fax:
559-688-4231
Email
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 MAR 1999 TERM:
30 JUN 2004 FY: 2004
INVESTIGATOR: Sommers,
L. E.; Auld, G. W.; Burns, P. D.; Byrne, P. F.; Garry, F. B.; Kelly, E.
F.
PERFORMING INSTITUTION:
Administration.
NON-TECHNICAL SUMMARY:
Interdisciplinary teams are needed to solve complex problems in agricultural
production systems. This project examines Johne's disease, use of GIS for
precision agriculture, reproduction in beef cows, and stress tolerance in
wheat.
OBJECTIVES: Research
will be conducted by interdisciplinary teams of scientists in the following
areas: 1) investigate the development of new foodlinks between local producers
and organizations serving food; 2) evaluate regulation of prostaglandin
synthesis and efficacy of feeding fish meal in ruminants; 3) identify
physiological mechanisms and selection criteria for stress tolerance in wheat;
4) investigate the epidemiology, molecular genetics, and immunology of Johne's
disease; and 5) develop techniques for improved use of spatial statistics and
remote sensing in precision farming. APPROACH: Laboratory and field experiments
will be conducted by 5 teams of researchers to accomplish the stated objectives.
PROGRESS: 1999/03 TO
2004/06. I. Creating local food links - This sub-project was designed to
promote local, sustainable food links; develop an educational model to promote
these food links; and test an interpersonal approach to encourage new links
between local food producers and organizational buyers. Over 250 phone
interviews were conducted with food buyers and producers to identify barriers
and motivators associated with direct marketing of local foods. An
educational video and pamphlets were produced. Meetings were organized between
farmers and food buyers. II. Regulation of Prostaglandin Synthesis in
Domestic Farm Animals - The sub-project improved understanding of how oxytocin
regulates endometrial secretions of prostaglandin and investigated whether
feeding fish meal to beef cows during the first 21 days of breeding season
increased conception rates. Experiments conducted showed that fishmeal
supplementation increased fertility by 15% in postpartum first-calf beef cows.
It was hypothesized that the omega-3 fatty acids found in fishmeal become
incorporated in uterine endometrium and attenuate PGF2a synthesis during
maternal recognition of pregnancy and result in enhanced fertility.
Several experiments to determine the molecular and cellular mechanisms
that regulate uterine PGF2a synthesis were conducted. III. Improved heat
and drought tolerance of
No publications reported
this period
PROJECT
CONTACT:
Name: Sommers, L.
E. Phone: 970-491-5371. Fax: 970-491-7396
Email: lsommers@lamar.colostate.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT
NO: 2003-35204-13685 PROPOSAL NO: 2003-02501
START: 15 SEP 2003 TERM: 14 SEP
2006 FY: 2005 GRANT YR: 2003 GRANT AMT: $200,000
INVESTIGATOR: Belisle, J.
T.; Orme,
PERFORMING INSTITUTION:
Microbiology.
SUBJECT:
Proteomic definition of T cell antigens of Johne's disease.
NON-TECHNICAL SUMMARY: Johne's disease has a major economic impact on the
cattle and dairy industry. The inability to control this disease is due to
the lack of an effective early diagnosis or effective vaccine. This
project will use modern biochemical and immunological approaches to identify the
immunodomnant T cell antigens produced by the bacterial agent that causes
Johne's disease, Mycobacterium paratuberculosis. These antigens
will represent potential vaccine and early diagnostic targets.
APPROACH: The
identification of T cell antigens will be acheived by 2D-liquid phase
electrophoresis (LPE) separation of M. paratuberculosis subcellular
fractions, followed by testing of the 2D-LPE fractions aginst whole blood of
cattle uninfected and infected with M. paratuberculosis. The read
out for immune T cell activation will be IFN-gamma production. The
proteins of the fractions that stimulate the most dominant IFN-gamma response
will be identified by electrospray mass spectrometry. The genes encoding
the proteins defined as immunodominant in the above assays will be cloned into
an E. coli or M. smegmatis expression vector and the recombinant
proteins produced as His-tagged fusion products. These recombinant
proteins will subsequently be used to confirm T cell antigenicity using the
whole blood IFN-gamma assay.
PROGRESS: 2003/01 TO
2003/12. Funding for this project started in Sept. 2003. A Research
Associate (50% effort) was hired and started work on January 5, 2004.
Since the start of this project we have continued to generate large scale
cultures of M. avium subsp. paratuberculosis strains 517 and K-10.
The generation of a large number of protein fractions for T cell assays
will begin in March 2004. Additionally, the calves for experimental
infections are expected to be purchased in April of 2004. In addition to
these ongoing activities we have acquired the latest version of the M.
paratuberculosis genome sequence from Dr. Bannentine (USDA, NADL) and have
performed or own in silico comparative analysis of this genome against that of
M. avium subsp. avium to identify paratuberculosis specific gene
fragments. This was done using a program called PipMaker developed by
PUBLICATIONS: 2003/01 TO
2003/12
2003
None
PROJECT
CONTACT:
Name: Belisle, J. T.
Phone: 970-491-6549. Fax: 970-491-1815
Email: jbelisle@colostate.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 2003-34405-13795 PROPOSAL NO: 2003-06088
START: 15 AUG 2003 TERM: 14 AUG 2004 FY: 2004 GRANT YR: 2003 GRANT AMT:
$696,539
INVESTIGATOR: Salman, M.
PERFORMING INSTITUTION:
Environmental Health Research.
SUBJECT: Enhancement of the program for economically important
infectious animal diseases.
NON-TECHNICAL SUMMARY: A
multidisciplinary research center is needed to study animal diseases of economic
importance. Integration of studies covering broad spectrum of disciplines
is needed to prevent duplication of existing efforts and programs. A
comprehensive study approach is expected to lead to improved disease
surveillance, risk assessment, management, and control/prevention strategies.
Furthermore, these studies will lead to the generation of fundamental
knowledge concerning disease transmission, diagnosis, pathogenesis, and
virulence of economically important animal diseases.
APPROACH: The
Center will include three major sections which will be simultaneously integrated
into the research approach: biology of infectious diseases, epidemiology of
animal diseases, and risk analysis/assessment. An advisory group will be
composed of scientists from all involved disciplines, commodity representatives,
state departments of agriculture, and consumer advocates.
PROGRESS: 2003/08 TO
2004/08. TSEs 6 commercial screening assays were evaluated for deer/elk. A
project was initiated which could result in diagnostic tests and prevention
methods for prionic infections. Personnel were trained on the western blot
test for the presence of CNS tissue in food products. PEIIAD hosted a
conference TSE in Animal Populations: Facts & Fiction to address research
and policy issues. Participation in international organizations in risk
assessment and classification of countries for BSE status: Dr. Salman was
re-appointed to the scientific working group of the GBR. West Nile Virus (WNV)
Epidemiology: A survey with the goal of determining the long-term outcome
of WNV-affected horses was initiated. A study has been initiated to
compare antibody titers of WNV in vaccinated horses to those recovering from
natural infection. APHI personnel also investigated the possibility of
development of an ELISA test for detection of IgG to WNV. Vesicular
Stomatitis (VS) Participation in the field validation of the newly developed
real-time PCR for VSV detection Test development: A one-step single tube
multiplex reverse-transcriptase PCR test for detection of the VSV in biological
samples and insects was developed and validated. Molecular epidemiology:
Molecular fingerprinting is being used in conjunction with GIS analysis to
understand the spread of the VSV. Serological data: The team has demonstrated
serological evidence of VSV during non-outbreak years. Equine Infectious
Diseases Equine clostridiosis Toxoid development: Development of a toxoid
against equine clostridiosis for use in broodmares prior to foaling has been
investigated. Test development and validation: A test to identify
clostridial beta 1 and beta 2 toxins in clinical samples was developed and is
now being validated. Treatment: The use of metranidazone and the
subsequent development of resistance were investigated. Mycobacterial work
M bovis and M tuberculosis Serological testing PCR development and
testing Non-domestic species Molecular epidemiology M avium ssp
paratuberculosis (Johne’s disease) Diagnostic strategies PCR
development and testing Assessment of the presence of M avium ssp
paratb in selected lymph nodes & other tissues Food Safety and Risk
Analysis E. coli O157 testing Fecal sampling protocols Analytical methods
Modeling prevalence in clusters Modeling low prevalence Modeling test dependence
Modeling transmission Global Vet Epidemiology Researchers have continued to
collaborate with several animal health researchers and regulators in the design
& implementation of projects related to surveillance and risk analysis.
Other Topics Researchers have secured funding to gather corresponding
antimicrobial resistance data from intensive livestock raising units in
PUBLICATIONS: 2003/08 TO 2004/08
1. Paul S. Morley, Josie
L. Traub-Dargatz, et. al. Availability of antimicrobial drugs for use in
animals without a prescription.
15. Salazer P,
Traub-Dargatz JL, Morley PS, et al. Characterization of the 2002 West Nile
Virus epidemic in Nebraska and Colorado equids. J Am Vet Med Assoc
[In Press].
16. Geiser S, Seitzinger
A, Salazar P, et al. Economic impact of West Nile Virus on the Colorado and
Nebraska equine industries: 2002. [Government Report].
USDA:APHIS:VS, Centers for Epidemilogy and Animal Health.
18.
Salazer P, Traub-Dargatz JL, Morley PS, et al. Characterization of the 2002
West Nile Virus epidemic in Nebraska and Colorado equids. Scientific
Proceedings of the 4th Annual Phi Zeta Research Day of the Theta Chapter, CSU
College of Veterinary Medicine and Biomedical Science, Fort Collins, CO,
2003, p 34.
19. Traub-Dargatz JL,
Morley PS, Salazer P, et al. Characterization of the 2002 West Nile Virus
epidemic in Nebraska and Colorado equids. Presented at the 10th
International Society for Veterinary Epidemiology and Economics Symposium,
22.
PROJECT
CONTACT:
Name: Turney, L. Phone:
970-491-6229
Email: lturney@cvmbs.colostate.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 1998
TERM: 30 SEP 2004 FY: 2004
INVESTIGATOR: Niswender, G.
PERFORMING
INSTITUTION: College Administration.
SUBJECT: Bacterial diseases and the immune
system.
APPROACH: Improved
diagnostic procedures will be developed for the detection of several important
pathogenic bacterial (for example, Brucella ovis; Mycobacterium
ovis; Mycobacterium paratuberculosis and Clostridium
perfringens). Tests will include improved enzyme immunoassays,
polymerase chain reaction to detect bacterial DNA and/or RNA, and use of
fluorescently labeled recombinant DNA probes and antibodies to specific coat
proteins. These reagents will be used to study the disease process and the
epidemiology of individual infections. Finally, in some cases more
effacacious recombinant vaccines will be developed to prevent the disease.
PROGRESS: 1998/10 TO
2004/09. Mice of the CBA inbred strain background expressing the well
characterized mutation designated xid in the cytoplasmic signalling enzyme
Bruton's protein kinase have been previously noted to illustrate shifts in T
helper type 1 (Th1)/Th2 immunity which is underlined by an apparent failure to
produce the regulatory cytokine interleukin-10. This study examined if
this extended to infection with Mycobacterium tuberculosis, which also
depends on Th1 immunity. Contrary to expectations, xid mice showed
evidence of a transient early susceptibility to pulmonary infection, changes in
macrophage morphology, and decreased activation of lung natural killer cells,
while showing evidence of substantial IL-10 production and accumulation in lung
lesions macrophages, but paradoxically this did not influence the course of the
chronic disease. In addition, macrophages from the lungs of xid mice also
expressed high levels of CD14. These observations suggest that the xid
mutation in cellular signalling has much wider effects on the immune system than
previously thought. In a separate study, major histocompatibility complex
class I tetramer reagent was used to track antigen-specific CD8 T cells in the
lungs of mice immunized with the tuberculosis vaccine candidate Mtb72F.
The results show that CD8 T cells recognizing an immunodominant
Mtb32-specific epitope could be detected in significant numbers over the course
of infection in mice exposed to low-dose aerosol challenge with Mycobacterium
tuberculosis and that prior vaccination substantially increased the numbers
of these cells early in the lungs. The effector phenotype of the cells was
shown by the demonstration that many secreted gamma interferon, but very few
contained granzyme B. As the course of the infection progressed, many
activated CD8 T cells down-regulated expression of CD45RB and upregulated
expression of the interleukin-7 receptor alpha chain, indicating a transition of
these cells to a state of memory. These data support the hypothesis that
M. tuberculosis-specific CD8 T cells can be targeted by vaccination with
the Mtb72F polyprotein.
IMPACT: 1998/10 TO
2004/09. Mycobacterial infection in dairy cattle remains a significant
economic loss to producers. How the immune system responds to these
infections is poorly understood. This limitation has severely hampered the
development of a vaccine effective for eliminating mycobaterial infections
(Johne's Disease) in dairy cattle. Some of these studies show that
specific bacterial proteins can be used to specifically target components of the
immune system, a mechanism that may lead to an effective vaccine for prevention
of the multi-billion loss to the dairy industry caused by Johne's disease.
PUBLICATIONS: 1998/10 TO
2004/09
1. Junqueira-Kipnis AP,
Kipnis A, Henao Tamayo M, Harton M, Gonzalez Juarrero M, Basaraba RJ, Orme IM.
2005. Interleukin-10 production by lung macrophages in CBA xid mutant
mice infected with Mycobacterium tuberculosis. Immunology.
115:246-52.
2. Irwin SM, Izzo AA,
Dow SW, Skeiky YA, Reed SG, Alderson MR, Orme IM. 2005. Tracking
antigen-specific CD8 T lymphocytes in the lungs of mice vaccinated with the
Mtb72F polyprotein. Infect Immun. 73:5809-16.
3. Perry JA, Olver CS,
Burnett RC, Avery AC. 2005. Cutting edge: the acquisition of TLR tolerance
during malaria infection impacts T cell activation. J Immunol.
174:5921-5.
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 18 FEB 2000 TERM: 30
SEP 2005 FY: 2005
INVESTIGATOR: Elzo, M. A.; Johnson,
PERFORMING INSTITUTION:
Animal Sciences.
SUBJECT: Improvement of beef cattle in multibreed
populations: phase III.
NON-TECHNICAL SUMMARY: Prediction of genetic
values of purebred and crossbred animals in multibreed populations.
Estimation of genetic variation and combining ability of animals in
multibreed populations. Devise new and more precise genetic-statistical
models to predict the genetic values of animals and their combining ability in
populations of animals composed of purebred and crossbred animals.
APPROACH: New
genetic-statistical models and procedures will be devised, followed by the
generation of computer programs to be tested and validated using simulated,
experimental, and multibreed field data sets. New computing algorithms
will be used and(or) devised as needed. National and international experimental
and field data sets will be used. National and international researchers
will collaborate in specific parts of this project.
PROGRESS: 2000/02 TO
2005/09. This is the final report of Phase III of this multibreed project
in beef cattle. The most important accomplishments of Phase III were: 1)
establishment of long-term research collaborations with researchers from Brazil,
Chile, and Thailand, and continuation of research collaboration with researchers
from Colombia, 2) establishment of a long-term research collaboration with
researchers from the College of Veterinary Medicine of UF on the effects of
paratuberculosis on production, reproduction, and carcass traits in multibreed
beef cattle, 3) development of dedicated software for editing data, constructing
connected datasets and pedigree files, and evaluating animals for additive and
nonadditive genetic effects of growth and dairy traits in multibreed populations
in Chile, Thailand, and the US, 4) development of multibreed genetic evaluation
models, estimation of additive and nonadditive variance and covariance
components, and prediction of genetic values of purebred and crossbred animals
from Bos taurus x Bos taurus and Bos taurus x Bos
indicus multibreed populations for dairy, growth, and carcass traits, 4)
results from the Thai Holstein x Bos indicus dairy cattle population
indicated that 5/8 to 3/4 Bos taurus cows would produce greater amounts
of milk than animals with higher Bos taurus fractions, that nonadditive
genetic variation was smaller than additive genetic variation (moderate
heritabilities and low nonadditive ratios in all breed groups), and that
additive, nonadditive, and total genetic predictions were highly correlated
under Thai tropical conditions, 5) results from the Chilean Holstein x Bos
taurus dairy cattle population showed that Holstein and 3/4 Holstein
produced the largest amounts of milk, that heritabilities for milk yield were
moderate regardless of the Holstein fraction of the breed group, that
nonadditive variance ratios were negligible but that heterosis was similar to
other crossbred dairy populations under temperate climatic conditions, 6)
results from the research on nonadditive genetic effects in a Brazilian Nellore
cattle subpopulation indicated that the variation due to sire x maternal
grandsire interaction effects was 1/3 of the additive genetic variation for
weight at 120 days and 240 days (weaning), suggesting that sire x maternal
grandsire interactions will need to be tested before deciding on a national
genetic evaluation model for this breed in Brazil, 7) results from the UF
Angus-Brahman multibreed herd showed that sire direct genetic prediction for
growth traits tended to increase, but maternal ones tended to decrease from
Angus to Brahman, that sire direct genetic predictions for hot carcass weight,
yield grade, and shear force tended to increase, and marbling and tenderness
tended to decrease from Angus to Brahman, and that there was no trend from Angus
to Brahman for sire nonadditive genetic predictions, and 8) the paratuberculosis
study found that Brahman fraction of dam and days in lactation were positively
associated, and dam weight change, birth weight of calf, and calf preweaning
gain were negatively associated with ELISA scores.
IMPACT: 2000/02 TO
2005/09. Phase III of this research had both national and international
impact. It influenced the widespread adoption of multibreed genetic evaluation
procedures for the evaluation animals in beef and dairy cattle populations both
nationally and internationally. Research and development collaborations
with scientists from
PUBLICATIONS: 2000/02 TO
2005/09
1. Elzo, M. A., D. O.
Rae, S. E. Lanhart, J. G. Wasdin, W. P. Dixon, and J. L. Jones. 2005. Factors
associated with ELISA scores for paratuberculosis in an Angus-Brahman multibreed
herd of beef cattle. J. Anim. Sci. (In Press).
2. Elzo, M. A., D. O.
Rae, S. Lanhart, J. Wasdin, P. Dixon, and J. Jones. 2005. Factors Associated
with ELISA Sample/Positive Ratio Scores for Paratuberculosis in an Angus-Brahman
Multibreed Herd of Beef Cattle. Page 123 in Proc. 38th Annu. Conf. Am.
Assoc. Bov. Pract.,
5. Koonawootrittriron,
S., M. A. Elzo, S. Tumwasorn, and T. Tongprapi. 2005. Age at first calving of
dairy cattle in a multibreed population of
6. Koonawootrittriron,
S., M. Elzo, P. Sopanarat, S. Prasanpanich, J. Teingthum, C. Chaimongkol, T.
Sainui, K. Nithichai, T. Tongprapi, and T. Ralukmun. 2005. D.P.O. Sire
& Dam Summary 2004. Dairy Promotion Organization, Ministry of
Agriculture and Cooperatives of
7. Reyes, A. de los, M.
A. Elzo, A. C. Sanches, R. B. Lobo, and L. A. F. Becerra. 2005. Effect of
sire x maternal grandsire interactions on (co)variance estimates and genetic
trends for pre-weaning growth traits in Brazilian
8. Reyes, A. de los, M.
A. Elzo, A. C. Sanches, R. B. Lobo, and L. A. F. Becerra. 2005. Inclusion of
sire x maternal grandsire interaction in models for the estimation of
(co)variances and the prediction of genetic values for pre-weaning growth traits
in Brazilian
9.
Reyes, A. de los, M. A. Elzo, R. Lobo, and L. Becerra. 2005. Sire x maternal
grandsire interaction for pre-weaning growth traits in Brazilian
PROJECT
CONTACT:
Name: Elzo, M. A. Phone:
352-392-7564. Fax: 352-392-7652
Email: elzo@animal.ufl.edu
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 OCT 2005 TERM: 30 SEP 2010
INVESTIGATOR: Elzo, M. A.; Johnson,
PERFORMING INSTITUTION: Animal Sciences.
SUBJECT:
Improvement of beef cattle in multibreed populations: Phase IV.
NON-TECHNICAL SUMMARY: Accurate prediction of genetic values for
economically important traits of purebred and crossbred animals is essential to
devise appropriate mating and selection strategies in multibreed populations.
This project seeks to develop genetic-economic models and procedures to
improve mating and selection strategies in national and international multibreed
populations under a variety of environmental conditions.
APPROACH: New
genetic-statistical models will be devised and subsequently tested and validated
using simulated, experimental, and field national and international multibreed
datasets of various degrees of unbalancedness. New computing algorithms
will be incorporated and (or) devised as needed. National and
international researchers will collaborate in various stages of the research.
PROJECT
CONTACT:
Name: Elzo, M. A. Phone:
352-392-7564. Fax: 352-392-7652
Email: elzo@animal.ufl.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: EXTENDED
START: 01 JUL 2000
TERM: 30 JUN 2006 FY: 2005
INVESTIGATOR: Rae, D. O.
PERFORMING
INSTITUTION:
SUBJECT:
Raising the calf crop in
NON-TECHNICAL SUMMARY: Florida, despite enjoying a
subtropical climate and nearly year-round grazing, has one of the lowest average
calf crops in the continental U.S.; being approximately 76% which is more than
10% below the national average. Contributing factors include the stress of
a hot, humid environment and the presence of large numbers of Bos indicus
derived cattle. This project aims to identify and characterize a number of
female-related factors which contribute to reproductive efficiency in beef
cattle.
PROGRESS: 2004/10 TO
2005/09. Johne's disease investigation: Dam and calf genetic and
environmental factors were evaluated for their association with enzyme-linked
immunosorbent assay (ELISA) s/p ratio scores for paratuberculosis in a
multibreed beef cattle population. The linear mixed model analysis used
359 ELISA s/p ratio scores from 340 dams: Angus (A), Brahman (B), 3/4 A 1/4 B,
1/2 A 1/2 B, 1/4 A 3/4 B, and Brangus (5/8 A 3/8 B). Important dam
regression effects were: 1) B - A effect was positive indicating an upward trend
of ELISA scores towards 100% B dams, and 2) weight change from before calving to
the date of the blood sample in May indicating a negative association between
weight maintenance and ELISA scores. Relevant calf regression effects
were: 1) birth weight, 2) calf gain from birth to the date of the dam blood
sample, and 3) calf age on the date of the dam blood sample. Dams with
high ELISA s/p ratio scores produced smaller calves, gained less weight (or lost
weight) during the preweaning season, and produced less milk, which in turn may
have caused calves to have smaller preweaning gains. The objective of our
prior study was to estimate the prevalence of Mycobacterium avium subsp.
paratuberculosis (MAP) infection among beef and dairy cattle in the State
of
IMPACT:
2004/10 TO 2005/09. Factors identified as associated with
Mycobacterium ELISA s/p ratio scores could help cattle producers with
culling decisions related to paratuberculosis control and eradication efforts in
beef cattle. The study found high ELISA s/p ratio scores to be associated
with lower cow weights (and perhaps lower milk production); these were evidenced
in lower calf birth weight and lower preweaning gains. Based on these
results, there appears to be a significant negative impact of subclinical
paratuberculosis on production traits of dams and calves. We have
previously evaluated the prevalence of Johne's disease in the
PUBLICATIONS: 2004/10 TO
2005/09
scores for paratuberculosis in an Angus-Brahman multi
breed herd of beef cattle. Proceedings 38th Annual Conv AABP 38:213
2005, abstract.
2. Elzo MA, Rae DO,
Lanhart SE, Wasdin JG,
PROJECT
CONTACT:
Name: Rae, D. O. Phone:
352-392-4700. Fax: 352-392-7551
Email: owen@rams.vetmed.ufl.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 AUG 2003 TERM: 31
JUL 2004 FY: 2004
INVESTIGATOR: Corn, J. L.; Davidson, W. R.; Fischer, J. R.
PERFORMING INSTITUTION:
SUBJECT:
Mycobacterium avium subspecies paratuberculosis in free-ranging birds and
mammals on livestock premises.
NON-TECHNICAL SUMMARY: Ruminant and
non-ruminant wildlife may become exposed to Mptb via feeding on contaminated
grain, forage in pastures, feces, or on infected prey. The purpose of this
study is to determine if wildlife associated with livestock premises are
infected by Mptb. OBJECTIVES: (a) To determine if infection by Mycobacterium
avium subspecies paratuberculosis occurs in free-ranging mammals and
birds on infected livestock premesis; (b) To determine if the prevalence of
infection by Mycobacterium avium suspecies paratuberculosis is
higher in free-ranging mammals and birds on infected livestock premesis versus
non-infected premesis; (c) To determine habitat and spatial associations of
infected wildlife with livestock on livestock premesis. APPROACH: Intensive
sampling of wildlife will be conducted in the immediate vicinity of livestock
premises in the Midwest United States (
PUBLICATIONS: 2003/08 TO
2004/07
No publications reported
this period
PROJECT
CONTACT:
Name: Corn, J. L. Phone:
706-542-1741. Fax: 706-542-5865
Email: jcorn@vet.uga.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 SEP 2004 TERM: 31
AUG 2005 FY: 2005
INVESTIGATOR: Hurley, D. J.; Donovan, D. C.; Reber, A. J.
PERFORMING INSTITUTION:
SUBJECT: Comparison
of fresh and frozen colostrums in transfer of mycobacterial immunity.
NON-TECHNICAL SUMMARY: Current production practice utilizes the
substitution of frozen colostrum for colostrum from the mother when the mother
does not make enough or the colostrum does not appear to be of good quality.
We are learning that the cells found in colostrum from the mother appear
to play a role in immune development of the newborn. A direct comparison
of calves receiving fresh colostrum from their mothers with those receiving
frozen colostrum to assess the effects of maternal cells on immune development
is critic to making good management recommendations. This project will
compare the effect of fresh colostrum containing intact maternal cells with
frozen colostrum that still contains the contents of maternal cells and frozen
colostrum that had the maternal cells removed before freezing on the development
of critical immune functions to the lifelong health of the calf. The
findings will allow us to make a better definition of quality colostrum and a
basis to analyze its role in management programs for neonatal calves.
OBJECTIVES: The goal of this project is to determine the effect of maternal
colostral leukocytes on the maturation and function of antigen presenting cells
in the development of specific adaptive immunity after feeding colostrum.
Maternal cells could play two specific roles in transfer of maternal
adaptive immunity; to participate in cellular interactions between antigen and
leukocytes and initiate adaptive responses, or to provide soluble factors
analogous to transfer factor in priming adaptive specific immunity. The
use of frozen colostrum would ablate the first function, but may allow or even
facilitate the second. Our hypothesis is that freezing colostrum will
reduce the efficacy of colostrum by destroying colostral leukocytes, which are
be needed to stimulate the neonatal adaptive immune responses. The project
has two objectives: 1) To determine the phenotype of neonatal mononuclear
leukocytes after ingestion of fresh or frozen colostrum, and 2) To determine the
function of calf cells after ingestion of fresh or frozen colostrum.
PROGRESS: 2004/01 TO
2004/12. Johne's disease is a major economic problem in raising cattle.
Herd prevalence estimates indicate that 25% to 35% of dairy herds are
infected in dairy production area of the
PUBLICATIONS: 2004/01 TO
2004/12
No publications reported
this period
PROJECT
CONTACT:
Name: Hurley, D. J.
Phone: 706-542-6371. Fax: 706-542-8833
Email: dhurley@vet.uga.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 SEP 2004 TERM: 31
AUG 2005 FY: 2005
INVESTIGATOR: Vandenplas, M. L.; Okinaga, T.; Hurley, D.
J.
PERFORMING INSTITUTION:
SUBJECT:
Correlating Map induced NF-kB activation with NOD2 mutations in
Johne's disease.
NON-TECHNICAL SUMMARY: Infection with
Mycobacterium avium ssp paratuberculosis (Map) and Johne's disease
are a significant economic problem in rearing cattle. It has been
recognized for 30 years that resistant and sensitive individuals can be found
within the population of cattle. At present, there are no direct methods
to identify resistant individuals without challenging them with the organism.
This project will utilize a readily measurable physiological response of
white blood cells to infection with Map to sort cattle into two groups, and then
allow us to look for differences in the genes that control that response as a
starting point in a biological definition of resistant and susceptible animals.
The results of this project will provide candidate genetic markers for the
development of Johne's resistant herds.
APPROACH: Animals from
two herds will be utilized. Blood samples will be collected from 10 cattle
housed at a facility that has gone through two years of screening under the
Johne's control program and has no evidence of Johne's disease on the facility.
Blood samples from 10 cattle in the Georgia Johne's demonstration herd
will also be collected. This herd has active Johne's disease; cattle not
showing symptoms of Johne's disease animals will be selected as donors.
Blood will be collected and transported to the lab within 6 h of
collection. Buffy coat will be collected for each animal, and the buffy,
layered over Histopaque 1083 to generate a population of mononuclear cells.
PBMCs will be suspended in RPMI + 10% FCS and incubated at 37C with the
bacterial products (1 hours) or Map organisms (14 hr). At the end of the
incubation time, a nuclear extract will be prepared, the released nuclear
protein will be collected by centrifugation and the protein quantified.
The electrophoretic mobility shift assays for each nuclear protein extract
will be incubated at room temperature for 20 minutes with 32P-labeled NF-kB
oligonucleotide and the complexes resolved on polyacrylamide gels. Each
gel will also include nuclear extract from LPS-stimulated human Mono Mac 6 cells
as an inter-assay control. The gels will be dried and visualized on a
phosphoimager. Relative change in complex intensity will be determined by
densitometry and expressed as a percentage of Mono Mac 6 cell nuclear extract.
The NOD2 clone will be obtained from
PROJECT
CONTACT:
Name: Hurley, D. J.
Phone: 706-542-6371. Fax: 706-542-8833
Email: dhurley@vet.uga.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 JUL 2004 TERM: 30
SEP 2005 FY: 2005
INVESTIGATOR: Quinn, F. D.
PERFORMING INSTITUTION:
SUBJECT: Crohn’s disease: potential acquisition through
pasteurized milk.
NON-TECHNICAL SUMMARY: Mycobacterium
paratuberculosis causes Johne’s disease in cattle and other ruminants and
may cause Crohn’s disease in humans. We propose to expose a strain of
mouse routinely used in inflammatory bowel disease studies to M.
paratuberculosis antigens combined with homogenized and pasteurized milk fat
to determine if this exposure is associated with the time of onset and nature of
observed Crohn’s-like illness.
APPROACH: If our
hypothesis is correct, persons likely to become ill from foodborne and other
exposures to M. paratuberculosis (MAP) will either be immune compromised
and develop invasive multi-system disease that may or may not involve the
gastrointestinal tract, or have a poorly regulated Th1 response to enteric
microflora, perhaps including MAP. The proposed experiments will explore
the latter by using a rodent model of spontaneous enteritis that has a
predictable onset of clinical disease associated with inflammatory cytokine
imbalance. In addition, because of the influence of lipid vehicles on
Th1/Th2 response to antigens, MAP delivered in a lipid food matrix is more
likely to stimulate a Th1 dominated response. Therefore, this proposal
will use high-fat vehicles derived from foods that may be naturally contaminated
with MAP. Several animal models of spontaneous and induced intestinal
inflammation have been developed to investigate the etiology and pathogenesis of
inflammatory bowel disease (Crohn’s disease and ulcerative colitis). One
model, the SAMP1/Yit mouse, develops a syndrome that closely resembles Crohn’s
disease in that it spontaneously develops and most intensely involves the ileum
with segmental, transmural granulomatous enteritis. Onset of illness in
the mice begins around 20 weeks of age, with nearly 100% affected by 30 weeks of
age and continuation of lesions and illness at least through 80 weeks of age.
Disease appears to be mediated by an abnormal TNF-alpha and
IL-12 response. To test the hypothesis that early exposure to MAP antigens
may be a triggering event in the pathogenesis of Crohn’s disease, we propose to
expose SAMP1/Yit mice to MAP antigens before their anticipated onset of
enteritis to determine if this exposure is associated with modifications in the
time of onset and nature of illness. The presence of heat-killed
Mycobacterium species in milk gives it adjuvant-like qualities that
induce a helper T cell type 1 (Th1)-dominated immune response to bacterial
antigens present in the guts of persons with a certain genetic background.
The inciting antigens are likely to be normal enteric flora but may be
mycobacterial antigens. Twenty-eight SAMP1/Yit mice will be acquired at 4
weeks and 28 mice at 8 weeks from
PUBLICATIONS: 2004/01 TO
2004/12
No publications reported this period
PROJECT
CONTACT:
Name: Quinn, F. D.
Phone: 706-542-5790. Fax: 706-542-5771
Email:
fquinn@vet.uga.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 15 DEC 2005 TERM: 14
DEC 2006
INVESTIGATOR: Karls, R.; Pence, M.
PERFORMING INSTITUTION:
SUBJECT: Isolation of mycobacteriophage that target M. avium
ssp. paratuberculosis.
NON-TECHNICAL SUMMARY: Antibiotic treatment
of cattle infected with Johne's disease is not practical. This purpose of
this project is to isolate and develop mycobacteriophages that may serve as a
cost-effective intervention strategy to prevent disease transmission.
APPROACH: Soil and
manure samples from farms with known Johne's Disease will be screened for the
presence of mycobacteriophages using a plaque assay. Once
mycobacteriophages have been identified, the mycobacterial host range of each
will be determined using both saprophytic and pathogenic mycobacterial species.
Those that can infect M. avium ssp. paratuberculosis (MAP)
will be characterized further. They will be assayed on a variety of MAP
strains to identify whether any target a host receptor that is absent on some
clinical MAP strains. Phage plaque morphology will be examined for the
presence of a lysogenic growth stage (turbid plaque phenotype). Genetic
analysis of phage that target MAP will be performed. If necessary, the
repressor of lysogeny will be disrupted to produce phage that grow only in a
lytic mode.
PROJECT
CONTACT:
Name: Karls, R. Phone:
706-542-2584. Fax: 542-5771
Email:
rkarls@vet.uga.edu
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED MULTISTATE PROJ NO: NC-62
START: 01 OCT 2000 TERM: 30 SEP 2002 FY: 2002
INVESTIGATOR: Wu, C. C.;
Lin, T. L.
PERFORMING INSTITUTION: Veterinary Pathobiology.
SUBJECT: Enteric diseases of swine and cattle: prevention,
control and food safety.
NON-TECHNICAL SUMMARY: Johne's disease
causes chronic enteritis in cattle and contributes to significant economic loss
in the dairy cattle industry. The mechanisms by which Mycobacterium
paratuberculosis enter the intestinal cells are poorly understood. The
purpose of the project is to determine the role of fibronectin attachment
protein in the first steps of the pathogenesis of Johne's disease.
Immunomagnetic-capture PCR assay will also be developed to rapidly detect
Mycobacterium paratuberculosis in bovine feces.
APPROACH:
Mycobacterium paratuberculosis (Mpt) genome will be screened for
fibronectin attachment protein (FAP) homologues using fibronectin binding assay
and a PCR-generated fragment of FAP from Mycobacterium avium as a probe.
Segments of the FAP gene will be cloned in antisense orientation into a
transcription vector and introduced into Mpt. Wild type Mpt and anitsense
mutants will be used to determine fibronectin-mediated attachment and
internalization by Mpt in vitro and in vivo. In addition, DNA will be
extracted from Mpt in feces captured by magnetic beads linked to
antimycobacterial antibodies and subjected to PCR. The
immunomagnetic-capture PCR assay will be used to test field samples for the
presence of Mpt. PROGRESS: 2000/10 TO 2002/09. Mycobacterium avium
subsp. paratuberculosis expresses a fibronectin- attachment protein (FAP)
homologue, FAP-P, which is required for binding of fibronectin (FN).
Several FAPs have been shown to mediate FN-dependent attachment and
internalization of mycobacteria in vitro, suggesting an important role for these
proteins in the pathogenesis of mycobacterial disease. The objective of
the present study was to determine if the interaction of FAP-P and FN
contributed to the attachment and internalization of M. avium subsp.
paratuberculosis by epithelial cells in vitro. Infection of T-24
bladder epithelial cells and Caco-2 intestinal epithelial cells with
FN-opsonized organisms led to a 1.5 to 2-fold increase in the number of cells
that had attached mycobacteria relative to those infected with non-opsonized
bacteria. The frequency of invasion of both cell lines by M. avium
subsp. paratuberculosis was enhanced 2.5 to 3-fold in the presence of FN.
The addition of the FN binding peptide from M. avium subsp.
avium FAP did not diminish bacterial attachment to either cell line;
however, peptide treatment inhibited internalization of bacteria by both cell
lines by greater than or equal to 65%. Attachment and internalization of
antisense and natural FAP-P mutants of M. avium subsp.
paratuberculosis by both cell lines were reduced by 35-55% and 50-80%,
respectively. The results indicate that FN facilitates attachment and
internalization of M. avium subsp. paratuberculosis by epithelial
cells in a FAP-P-dependent manner.
IMPACT: 2000/10 TO
2002/09. Fibronectin facilitates attachment and internalization of M.
avium subsp. paratuberculosis by epithelial cells in a
FAP-P-dependent manner. Attachment of Mpt to M cells and the subsequent
translocation of organisms by these cells to the underlying gut-associated
immune tissue are the necessary initial steps in the development of
paratuberculosis. By gaining an understanding of the mechanisms and
macromolecules involved in these processes, one can begin to develop herd
management and immunization strategies that may limit the spread of infection
within herds.
PUBLICATIONS: 2000/10 TO
2002/09
1. Secott, TE, Lin, TL, and Wu, CC. 2002. Fibronectin attachment
protein is necessary for efficient attachment and invasion of epithelial cells
by Mycobacterium avium subsp. paratuberculosis.
Infection and Immunity, 70: 2670-2675.
2. Secott, T. E.; Lin,
T. L.; Wu, C. C. 2002. Fibronectin-attachment protein mediates in vivo
invasion of M cells by Mycobacterium avium subsp.
paratuberculosis. The Proceedings of the 2002 Annual Meeting of
The American Society for Microbiology, page 121.
PROJECT
CONTACT:
Name: Wu, C. C. Phone:
765-494-7459. Fax: 765-494-9181
Email:
wuc@purdue.edu, and mailto:tllin@purdu.edu
PROJ
TYPE:
HATCH PROJ STATUS: REVISED
START: 01 OCT 2005 TERM: 30 SEP
2008 FY: 2005
INVESTIGATOR: Vemulapalli, R.; Wu, C. C.; Lin, T. L.
PERFORMING INSTITUTION: Veterinary Pathobiology.
NON-TECHNICAL SUMMARY: No suitable vaccines are
presently available for prevention and control of bovine paratuberculosis.
Using a mouse model, this project examines the proteins of M.
paratuberculosis to identify a protective protein that can used to develop
recombinant vaccine against paratuberculosis. The proposed research will
aid in the development of a recombinant vaccine against bovine paratuberculosis.
OBJECTIVES: Johne's
disease, also known as paratuberculosis, is a significant health and economic
problem to cattle industry worldwide (1,2,3). The causative agent of this
diseases is Mycobacterium avium subspecies paratuberculosis (M.
paratuberculosis), a slow growing, facultative intracellular bacterium that
is very closely related to Mycobacterium avium subspecies avium
(M. avium). Several antigens are common to both M. avium
and M. paratuberculosis and they contain high percentage of identity at
amino acid level. Presently, no effective vaccine is available for use in
cattle against this disease. Our current knowledge about M.
paratuberculosis antigens involved in eliciting host protective immune
responses to the infection is very minimal (3). Researchers' ability to
conduct in-depth studies is severely restricted by the lack of a single,
suitable laboratory animal model as well as the very slow multiplication rate
and prolonged incubation period of M. paratuberculosis (>2 years).
In comparison, M. avium multiplies faster and readily infect
in-bred strains of mice, and following parenteral inoculation, the bacteria
disperse to various organs and replicate to high numbers in spleen, liver and
lung. The overall objective of this revised research project is to
characterize the immunological properties of several M. paratuberculosis
proteins by generating DNA vaccines and characterizing the elicited immune
responses in mouse models. Protective potential of the immunogenic
proteins will be determined by challenging the immunized mice with M. avium.
Objective 1. Generation of DNA vaccines with selected M.
paratuberculosis proteins. In Johne's disease, the onset of clinical
signs coincident with a switch in the host immune response from Th1 to Th2 type.
Therefore, development of a robust Th1 type immune response is required
for resistance against clinical disease in M. paratuberculosis infection.
DNA vaccines are well known to induce strong Th1-biased immune responses.
We will select several potential protective proteins of M.
paratuberculosis and construct their DNA vaccines using commercially
available mammalian expression vectors. Objective 2. Immunological
and protection studies with the DNA vaccines in BALB/c and/or C57BL/6 strains of
mice. We will first immunize BALB/c mice with the DNA vaccines and study
their immune responses, particularly phenotypic characterization of
antigen-specific T cells, antigen specific production of interferon-g (INF-g)
and other cytokines, antigen-specific cytotoxic T cells, and isotypes of
antibodies induced, if any. Based on our previous experience, BALB/c mice
may not develop specific immune responses against certain M.
paratuberculosis proteins. In such cases, we will conduct the
immunological studies in C57BL/6 mice. Information thus generated will be
used to screen and identify potentially protective proteins of M.
paratuberculosis. We will then carryout challenge experiments in both
BALB/c and C57BL/6 mice with M. avium to determine their cross protection
pontential.
APPROACH: Construction
of DNA vaccines: DNA vaccines will be constructed using pSecTag2 mammalian
expression plasmid (Invitrogen, Inc.). The genomic DNA of a virulent,
cattle isolate of M. paratuberculosis will be extracted (4) and the
coding sequences of the selected proteins of M. paratuberculosis will be
amplified via PCR using the specifically designed primer-pairs and the genomic
DNA as template. The amplified fragments will be cloned into pSecTag2 and
then sequenced to confirm the integrity of the gene sequence. Confirmation
of expression of the protein by DNA vaccine construct. The ability of the
DNA vaccine constructs to express the cloned gene products will be confirmed in
vitro. For this, COS-7 cells will be transfected with each one of the DNA
vaccine plasmids and the cells will be assayed for the expressed products by
Western blot analysis using mouse and cattle antisera to M.
paratuberculosis. Vaccine preparation. E. coli cells
harboring the plasmids containing the DNA vaccine constructs will be grown in
large volumes of liquid broth. The plasmids will be extracted from the
E. coli cultures using EndoFree Mega Prep kits (Qiagen, Inc.). The
extracted plasmids will be dissolved in phosphate buffered saline (PBS) solution
at a concentration of 1 mg/ml and stored at -20 degrees C until use. Mice
immunization and testing of selected immune responses. Female mice of 6-8
week old will be used. Group of 5 mice will be injected intramuscularly
with 100 ug of DNA vaccine. Mice receiving PBS will serve as controls.
At 2 and 4 weeks after initial immunization, same dose of vaccine will be
given as boosters. All the mice will be bled retro-orbitally to collect
serum samples before immunization and at 4 and 6 weeks post-immunization.
At week 6, mice will be euthanatized and their splenocytes will be used
for characterization of T cell responses. For some vaccines, it may be
necessary to give additional booster(s) to induce antigen-specific immune
responses. The specific antibody response will be determined using
immunoblot (Western) analysis and ELISA. The T cell responses will be
analyzed by detection of cytotoxic T lymphocytes and T cells secreting IL-4,
IL-5 and INF-g when co-cultured with M. paratuberculois-infected
macrophages and upon stimulation with the specific antigens. Protection
studies. Groups of 5 mice will be immunized with the selected DNA vaccines as
described above. A group of 5 mice will be injected with PBS and serve as
unvaccinated control. Two weeks after the last booster immunization, mice
will be challenged with 100,000 colony forming units (CFU) of M. avium.
Four after the challenge, the mice will be euthanatized and their spleens,
livers and lungs will be harvested. The bacterial burden in the collected
organs will be determined by homogenizing the tissues and then plating the
10-fold dilutions of the homogenates on Middlebrook 7H9 agar plates supplemented
with OADC enrichment. The decrease in the number of bacteria in each organ
of the vaccinated mice will be compared to that of unvaccinated mice and used as
a measurement to calculate the protective efficacy.
PROGRESS: 2005/01 TO
2005/12. Four selected antigens [fibronectin attachment protein (FAP),
antigen 85-B, major membrane protein (MMP), and Mn-superoxide dismutase (SOD)]
of Mycobacterium paratuberculosis were expressed in Brucella
abortus vaccine RB51 using plasmids containing different promoter elements.
These antigens were also overexpressed in E. coli and then purified
for use in immune response analyses. Stable expression of FAP and MMP in
B. abortus RB51 could not be achieved with any of the plasmid constructs
tested. In contrast, the expression of 85-B and SOD antigens was found to
be very stable in B. abortus RB51 harboring specific recombinant
plasmids. The ability of the recombinant RB51 strains to induce
heterologous antigen-specific immune responses was tested in BALB/c mice and
found it to be less efficient; though antigen-specific antibody and T cell
responses were detected in the vaccinated mice, the degree of these immune
responses was low as determined by the amount of interferon-gamma secreted by
the T cells upon stimulation with purified 85-B and SOD. Therefore, as an
alternate strategy, a replication defective human adenoviral vector system (hAd)
was used for the expression and delivery of the 85-B and SOD antigens.
Intramuscular inoculation of the recombinant hAd expressing 85-B antigen
induced higher levels of antigen-specific T cell responses. Furthermore,
priming with RB51/85-B and subsequent boosting with hAD-85B resulted in the
highest level of Th1 type-biased 85B-specific T cell responses. To
determine the protective ability of the induced 85B-specific immune responses,
the vaccinated mice were challenged with virulent M. avium, bacteria that
are antigenically very closely related to M. paratuberculosis.
Based on the tissue bacterial burden, mice in the vaccinated groups, in
comparison with the unvaccinated control group, did not show significant level
of resistance against the challenge. Studies to examine the protective
potential of SOD using both recombinant RB51 and hAD expression systems are
ongoing.
IMPACT: 2005/01 TO
2005/12. The findings of this research will aid in the development of a
recombinant vaccine against bovine paratuberculosis
PUBLICATIONS: 2005/01 TO
2005/12.
1. Gulani, J. and
Vemulapalli, R. 2004. Expression of potential protective proteins of
Mycobacterium avium subsp. paratuberculosis in Brucella
abortus RB51, a new approach to vaccine development against Johne’s
disease. 104th General Meeting of American Society for Microbiology,
Ernest N. Memorial Convention Center, May 23-27, New Orleans,
LA.
2. Sanakkayala, N.,
Gulani, J., Vemulapalli, R. 2004. Induction of specific mucosal and systemic
immune responses by intranasal inoculation of mice with live and
gamma-irradiated recombinant Brucella abortus RB51. 57th
Brucellosis Research Conference. Nov. 13-14, 2004,
Name: Vemulapalli, R.
Phone: 765-494-7560 Fax: 765-494-9830
Email:
rvemulap@purdue.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 OCT 2004 TERM: 30
SEP 2009 FY: 2005
INVESTIGATOR: Davis, J. K.
PERFORMING INSTITUTION:
Veterinary Pathobiology.
SUBJECT: Johne's disease: mouse
model and host gene expression in resistant and susceptible mice.
NON-TECHNICAL SUMMARY: Mycobacterium avium ssp.
paratuberculosis (MAP) causes Johne's disease, a chronic wasting disease of
cattle and sheep. MAP is also one of the organisms that have been
implicated in Crohn’s's disease of humans. Recent studies show that
routine pasteurization does not kill the organism. The purpose of this
project is to determine which host defense genes are expressed differently in
mice that are resistant to MAP vs. those expressed in susceptible mice.
The differences in gene expression between the two mouse strains will
highlight which host defenses are preventing development of Johne's disease in
mice. This information can then be used to guide studies in cattle to
determine if similar host responses occur and ultimately to guide the
development of vaccines to prevent the disease in ruminants.
OBJECTIVES: Our
central hypothesis is that both nonspecific antibacterial defenses and adaptive
immune responses operative in the digestive tract comprise an integrated system
of cellular and noncellular components whose interactions with Mycobacterium
avium ssp. paratuberculosis (MAP) determine disease expression in
Johne's disease. Furthermore, this network can be directly analyzed by
global gene expression, and disease resistance can be categorically
differentiated from disease susceptibility. Effective vaccines will induce
alterations in gene expression that simulate patterns seen in animals that are
resistant to disease. The best way to test this hypothesis is to compare
global gene expression in a well-defined model system where parameters of
disease expression can be tightly controlled, yet experimentally manipulated.
Thus, our long range objectives are to (i) Characterize and standardize
MAP infections of resistant (C3H/HeN) and susceptible (C57BL/6) mice; (ii)
Contrast constitutive expression of immune response genes in the
gastrointestinal tracts of C3H/HeN and C57BL/6 mice; and (iii) Contrast global
expression of immune response genes between resistant and susceptible mice
following infection with MAP.
APPROACH: OBJECTIVE I. Standardization of
murine model. C3H/HeN mice are resistant, and C57BL/6 mice are susceptible
to MAP infection but differences between the two strains have not been
quantified. These experiments will characterize the relationships between
organism dose and disease progression. Mice will be given MAP by oral
gavage in a dose response study. Six mice from each experimental group
will be killed at various times PI and sections of the GI tracts, mesenteric
lymph nodes, spleen, and liver will be processed for histological assessment of
lesions and demonstration of organisms by acid fast stains. Lesions for
each organ will be scored by pathologists. Additional portions of these
tissues, plus fecal pellets, will be used to quantify the numbers of MAP.
The infectious dose 50%, gross lesion dose 50% and histologic lesion dose
50% will be calculated. OBJECTIVE II. Contrast Constitutive Expression of
Immune Response Genes Between Mouse Strains. These experiments will
identify the constitutive differences in the expression of immune response genes
in the GI tracts of susceptible and resistant strains of mice. Definition
of these differences in naive animals provides the background database upon
which the subsequent experiments are built. Naive mice of both genotypes
will be examined at 2 months, 8, 11, 14, and 17 months of age. Serum,
jejunum, ileum, cecum, and colon will be collected and processed for isolation
of mRNA for use with Affymetrix GeneChip mouse microarrays. This
experiment will also determine how gene expression profiles differ among
anatomical sites and at different ages. OBJECTIVE III. Contrast global
expression of immune response genes between resistant and susceptible mice
during infection with MAP. The experimental design concentrates on early
events in infection. Animals of both strains will be infected with MAP and
6 will be killed at various times PI. Three animals from each group will
be used for microarray analyses and three will be used for enumeration of MAP
numbers in tissues.
PROCEDURES. Mycobacteria. An oral vaccine candidate
developed by Infectious Diseases Inc. (IDI) will be contrasted with a clinical
MAP isolate. Quantitative cultures and real time quantitative PCR of MAP
from tissues will be done on tissues from the GI tract. Tissues will be
collected and processed for histology and stained using standard methods.
Each will be transected longitudinally, one half will be used for
histology, the other for cultures, quantitative PCR, and microarray analyses.
Samples will be processed as recommended for Affymetrix GeneChip mouse
microarrays. Data will be analyzed using Affymetrix GeneChip Software.
STATISTICS AND DATA INTERPRETATION. Nonparametric data will be analyzed by
the Kruskal-Wallis test. All parameteric data will be analyzed by ANOVA.
Microarray analyses will focus on testing the hypothesis that global gene
expression in the GI tracts of different strains of mice will be perturbed by
MAP infection, and that the expression of immune response genes will be related
to strain differences in susceptibility.
PROGRESS: 2004/10 TO 2005/09.
Although experiments have not begun on the project, progress in providing the
infrastructure necessary for the performance of the project has been completed.
We have secured approval for the project from the Animal Care and Use
Committee and obtained the required permits from the USDA that allow us to ship
and receive the isolates of Mycobacterium avium ssp
paratuberculosis that are required for the experimental infections.
The unexpected long delay in receiving this permit prevented starting the
experimental infections. The organisms were obtained in late September
2005 and are currently being grown to sufficient quantities for the experimental
infections and the necessary quality control experiments needed before we use
the organisms. Since these organisms take weeks to months to grow, we
anticipate infecting the mice in January 2006. We will perform the quality
control testing of the organisms to ensure their purity and other
characteristics while we are waiting on the large batches of cultures needed for
the experimental infections. The appropriate space and animal housing
materials for this project have been identified and where necessary, been
purchased so that the experimental infections can proceed quickly once the
inocula are obtained. We have consulted our collaborators for the best
methods to use for the completion of the microarray assays outlined in the
project description and have obtained the supplies for these assays. We
also have recruited a graduate student who will work on this project which will
facilitate many of the procedures we will use throughout the entire project.
Although not directly related to the project as outlined, another project
related to Johne's disease will interface with this current project. The
collaborators for this study are also proceeding with studies in cattle and Drs.
Davis and Davidson's laboratory is developing ELISPOT assays for use in cattle
and with the infected mice model for determination of antigen specific cytokine
production from circulating memory lymphocytes. The goals of these studies
are to determine the cytokine profile during different stages of Johne's disease
in cattle and at different time post infection in mice. These results will
be needed to compare the mouse model to the disease in cattle as well as the
efficacy of any vaccine candidates. Thus, these experiments will enhance
and supplement the findings from the proposed mouse models outlined in the
original proposal.
IMPACT: 2004/10 TO 2005/09. Johne's disease is a
serious disease of cattle and sheep which has striking similarities to Crohn’s's
disease of humans. There are problems with using farm animals simply
because they are large, expensive to maintain, and the progression of disease is
slow which severely hampers many studies. Fully developing and describing
a model of Johne's disease in mice would greatly facilitate study of this
disease. The purpose of this project is to fully develop a mouse model of
Johne's disease in mice and to determine which genes are responsible for
preventing Johne's disease in mice. Because the disease process is so
complex, we believe the best way to determine which host defense genes are
important in protection from disease is to contrast the overall gene expression
in mice which are susceptible to disease to the gene expression in mice which
are resistant to disease. Once we have identified the set of host defense
genes that differ between the mouse strains, we can use these results to
determine whether or not the same genes are involved in resistance to the
disease in cattle, and ultimately, to use this knowledge to help design vaccines
which will help prevent disease in cattle. In addition, development of the
mouse model will allow scientists to use this model to elucidate the progression
of the disease, the factors which exacerbate or ameliorate disease, and which
treatments are effective.
PUBLICATIONS: 2004/10 TO 2005/09
Schleig, PM,
Buergelt, CD, Davis, JK, Williams,E, Monif, GRG, and Davidson, MK. 2005
Attachment of Mycobacterium avium subspecies paratuberculosis
to bovine intestinal organ cultures: method development and strain
differences. Vet Microbiol. 108: 271-279.
PROJECT
CONTACT:
Name: Davis, J. K.
Phone: 765-494-1234. Fax: 765-496-7989
Email:
davis39@purdue.edu
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 JUL 2006 TERM: 30 JUN 2009
INVESTIGATOR: Raizman, E. A.; Wu, C. C.; Glickman, L.; Long, T.; Kenyon, S.
PERFORMING INSTITUTION: Veterinary Pathobiology.
SUBJECT:
Epidemiologic studies of Johne’s disease in dairy and beef
cattle.
NON-TECHNICAL SUMMARY: A- There is lack of knowledge about
the distribution of Map in the environment of beef cattle. B-
Environmental sampling has been used on dairy farms to determine herd infection
status, however, it is necessary to improve this method on targeted sampling in
cow alleyway and manure storage A. The project will examine the
effectiveness of environmental sampling to determine herd infection status on
beef operations, especially mother-calf systems. B. The project will try
to improve the current environmental sampling method using cow alley and manure
storage.
OBJECTIVES: 1) To
determine the prevalence and the distribution of Map in the environment of beef
cattle. The hypothesis for this objective is that there is an association
between Map herd prevalence and Map prevalence in the environment. 2)
Improve predictive value of environmental sampling for assessment of the
prevalence of Map on dairy farms using samples from cow alleyway and manure
storage. The hypothesis for this objective is that the Map prevalence
(bacteria load) and therefore the predictive value of the environmental
sampling, will vary among the different lactation groups in the herd (i.e.
early, mid, and late lactation).
APPROACH: Objective 1: A
cross-sectional study design will be conducted using approximately 40 beef herds
in
PROJECT
CONTACT:
Name: Raizman, E. A.
Phone: 765-494-7727. Fax: 765-494-9830
Email:
eraizman@purdue.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 15 JUN 2005 TERM: 30
SEP 2009 FY: 2005
INVESTIGATOR: Lelievre, S. A.
PERFORMING
INSTITUTION: Veterinary Basic Medical Science.
SUBJECT: Targeting apical polarity to control tissue
differentiation and bacterial infection.
NON-TECHNICAL SUMMARY:
Alterations in apical polarity, a cellular organization typical of
differentiated organs, are involved in the development of skin, renal,
pulmonary, and bowel pathologies. Apical polarity also influences
infection and/or spreading by many viruses and bacteria. Our goal is to
identify the genes that specifically control apical polarity and could be used
as therapeutic targets.
APPROACH: Goal 1.
Microarrays will be performed on polarized (control) and non-polarized
(hypomethylated by 5Aza treatment) mammary cells cultured in Matrigel using the
Affymetrix GeneChip Instrument System. Statistical analysis will be
performed in collaboration with Rebecca Doerge. Significant alterations in
gene expression will be confirmed by reverse transcription-PCR. It is
expected that genes that are controlled by DNA methylation will be upregulated
(hypomethylated) in 5Aza-treated cells. Goal 2. Inverted polarity
will be induced by culturing mammary cells within a collagen I-based
extracellular matrix (condition 1). In addition, the specific lack of
apical polarity will be reproduced by culturing a subline of mammary cells
(MCF10A-AP) (condition 2) that cannot form properly organized apical polarity in
Matrigel. Microarray analysis will be performed using three different
linear model-based statistical analyses that will accommodate the examination of
differential expression of each gene for each control/condition comparison, as
well as a comparison between the different conditions relative to the control
situation. This set of experiments will enable us to determine whether
alterations in the expression of potential polarity (CAP) genes identified in
Goal 1 accompany polarity disorders. Goal 3. DNA obtained from the
different cell samples studied in Goals 1 and 2 will be treated with bisulfite
to induce the conversion of non-methylated cytosines (DNA bases) into uracyl,
while methylated cytosines will remain unmodified. Primers will be
designed to selectively amplify non-methylated or methylated DNA. The
presence of a PCR product, following the use of methylated or non-methylated
primers, will indicate the methylation status of the gene of interest.
This step will be indispensable to confirm that alterations in the
expression of CAP genes observed in Goals 1 and 2 are linked to changes in their
methylation status. Goal 4. Mammary epithelial cells transfected with each
potential CAP gene will be cultured in Matrigel to induce acinar
differentiation. The effect on differentiation will be investigated by
looking at the location of the different polarity markers. Genes whose
over expression only affects apical polarity will be classified as CAP genes.
Similar experiments will be performed on canine kidney MDCK cells induced
to polarize on permeable filter supports and long-term culture of colon Caco-2
cells. These cell types are often used to investigate bacterial infection
and will be a good control for the preparation of Goal 5. Goal 5. Dr.
Ching-Ching Wu has been studying the mechanisms of infection of Mycobacterium
paratuberculosis in polarized epithelial cells. In collaboration with
Dr. Wu, we will investigate the infection of this bacterium in Caco-2 or MDCK
cells expressing the different CAP genes selected upon completion of Goal 4.
Infection efficiency will be measured as the ability and degree of
adherence and invasion of the bacteria to non-polarized and polarized cells.
We expect that specific alterations in apical polarity induced by the
expression CAP genes will affect the potency of, or even abrogate, bacterial
infection.
PROGRESS: 2005/06 TO
2005/09. Polarity is a hallmark of differentiated epithelial tissues and
refers to the asymmetrical internal organization of epithelial cells within
these tissues. Loss of apical polarity is an early event in
differentiation disorders including cancer, as well as diseases that impair the
well being of farm animals like skin, renal, pulmonary and bowel diseases.
In addition, apical polarity plays a critical role in the spreading of a
number of devastating viral and bacterial infections. The goal of our
project is to develop a novel approach to the study of genomic influence over
tissue polarity, and thus discover the genes that specifically control apical
polarity (CAP genes), by combining biochemical manipulation of DNA, 3D models of
tissue culture, and microarray analysis. Since the starting date of this
project, less than four months ago, we have recruited a graduate student to work
on certain aspects of the project. This student is currently testing the
location of a number of proteins known to be apical markers in non-mammalian
tissues and certain mammalian tissues in our three-dimensional (3D) mammary
culture system. This 3D culture system permits the production of polarized
mammary glandular structures. The proteins tested include different
claudins, PALS-1, Par 3, PATJ, and Grb-3. In addition, this student
recently identified protein dab-2 as a potentially important apical polarity
marker in the mammary epithelium. These markers will serve as controls for
the effect of CAP genes, that will be identified in this project, on tissue
polarity (Goal 4). A postdoctoral scientist in the laboratory has worked
on developing a reliable method for extracting total RNA from 35 mm diameter 3D
cultures of cells. 3D culture is performed in the presence of Matrigel (a
mixture of extracellular proteins) that may affect the RNA extraction procedure.
An important technical step has been to release glandular structures from
the Matrigel first, and then proceed with careful washes and centrifugations
before trizol-based extraction. Migration tests performed on microchips at
the microarray facility have shown that the RNA isolation technique used in the
laboratory gives RNA of high quality for microarray experiments. Within
the next two months, sets of samples corresponding to four separate biological
replicates will be prepared according to Goal 1 of the project. All
microarray analyses will be run at once. An NIH RO-3 grant related to this
research topic has been awarded in October 2005 and will help support the salary
of the postdoctoral scientist and the microarray analyses.
IMPACT: 2005/06 TO
2005/09 All functional epithelial tissues in the body are asymmetrically
organized, as shown by the segregation of different types of proteins between
the basal and apical poles of cells. We have started identifying a number
of apically localized proteins in our tissue model that will serve as readout
for functional tests needed in order to discover the genes that control apical
polarity. Our approach should lead to novel treatment strategies aiming at
altering polarity in infected cells or revert the loss of tissue polarity in
differentiation disorders, and thus help stop the progression of these diseases
and minimize tissue destruction and mortality, consequently suppressing the
financial burden linked to the development of a number of devastating diseases.
PUBLICATIONS: 2005/06 TO
2005/09
No publications reported
this period
PROJECT
CONTACT:
Name: Lelievre, S. A.
Phone: 765-496-7793 Fax: 765-494-7881
Email:
lelievre@purdue.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2001-35204-10170 PROPOSAL NO:
2000-02197
START: 01 DEC 2000 TERM: 30 NOV 2003 GRANT YR: 2001 GRANT AMT:
$210,000
INVESTIGATOR: Schorey, J. S.
PERFORMING INSTITUTION:
Biological sciences.
SUBJECT: Defining novel
diagnostic and vaccine targets to combat Johne’s
disease.
NON-TECHNICAL SUMMARY: Johne’s disease is a chronic
intestinal disorder particularly common among dairy cattle and it is estimated
that 24% of the dairy herds nationally are infected. By some estimates the
cost of Johne’s disease to dairy farmers exceeds 1.5 billion a year. This
disease is caused by Mycobacterium paratuberculosis, an intracellular
pathogen, whose other family members include M. tuberculosis and M.
leprae, the causative agents of tuberculosis and leprosy respectively.
Infected cattle shed high numbers of M. paratuberculosis through
their feces where it can spread to other members of the herd. A major
interest to dairy farmers is the development of diagnostic tools and vaccines
for Johne’s disease. However, we lack the required information on what
M. paratuberculosis proteins initiate an immune response in infected
cattle and which of these proteins, when used as a vaccine, would protect the
calf or cow from Johne’s disease. Nevertheless, studies with other
pathogenic mycobacteria have identified proteins which produce an immune
response in infected animals, including humans. Further, a number of these
proteins were shown to protect an animal host from an active mycobacterial
disease when used as a vaccine. We have chosen to clone the M.
paratuberculosis genes corresponding to these homologous proteins which
include GroES, fibronectin attachment protein (FAP), 85abc and the 16-KDa
a-crystallin homolog. The proteins corresponding to these genes will be
expressed and tested as diagnostic markers to distinguish M.
paratuberculosis infected from non-infected cattle. The proteins will
also [sic]?
APPROACH: To use PCR and
genetic library screening to clone Mycobacterium paratuberculosis genes
which we hypothesize to be immunogenic in infected cattle. The cloned
genes will be expressed as recombinant proteins and tested as diagnostic markers
for Johne’s diseased cattle. Specifically, serum from infected and control
cattle will be tested for antibodies to the recombinant proteins by Western
blot. We will also measure the T cell proliferative response to these
proteins using T cells isolated from infected and control cattle and the ability
of the isolated T cells to produce cytokines in response to these recombinant
proteins. To determine if these proteins would make useful vaccine
candidates, mice will be immunized with one or more of these antigens and then
challenged with M. paratuberculosis. A decrease in bacterial load
at different times post-infection would indicate a protective response
intitiated by the immunization. Additional diagnostic markers and vaccine
candidates will be defined by screening a M. paratuberculosis expression
library with serum from infected cattle. The recombinant proteins within
the expression library which show reactivity with antibodies from infected
cattle will be purified and tested in the T cell proliferation and cytokine
production assays as described above and as vaccine candidates. PROGRESS:
2001/10 TO 2002/09. Johne's disease is a chronic intestinal disorder
particularly common among dairy cattle and it is estimated that 24% of the dairy
herds nationally have infected cattle. This disease is caused by
Mycobacterium avium subsp. paratuberculosis (ParaTB).
Infected cattle shed high numbers of ParaTB through their feces where it
can spread to other members of the herd. A major interest to dairy farmers
is the development of diagnostic tools and vaccines for Johne's disease.
However, we lack critical information on which genes are specific to
ParaTB and not found in other mycobacterial species and which gene products are
involved in virulence. This is particularly important for the development
of diagnostic tools since M. avium and ParaTB are approximately 98%
identical at the DNA level. A comparison of these two subspecies is also
important from a clinical perspective since M. avium does not cause
disease in ruminates. Therefore, a better understanding of these two
subspecies at the genetic level and differences in how macrophages respond to an
M. avium compared to ParaTB infection will aid in the development of
diagnostic tools specific to ParaTB and the mechanism of ParaTB virulence.
Results: We have recently been focusing our research on glycopeptidolipids
(GPLs), a molecule found on the cell surface of many mycobacterial species
including M. avium. Interestingly, preliminary studies indicate
that ParaTB do not express GPLs. This is particularly relevant since GPLs
are known to have immune modulatory activity. Therefore, the lack of GPLs
may be very useful in distinguishing M. avium from ParaTB. More
importantly, if indeed the GPLs are lacking in ParaTB, this would represent a
major difference between these subspecies and may account, at least in part, for
the varied diseases caused by M. avium and ParaTB. Our initial
experiments characterized the genomic regions responsible for the synthesis of
GPLs and we have been successful in mapping the region involved in the synthesis
of the GPLs from various M. avium isolates. The results of these
experiments were recently published in Veterinary Microbiology. Using this
information we compared sequences, which were conserved in all M. avium
strains tested, with the available ParaTB sequence available through TIGR.
None of the conserved sequences were found in the ParaTB genome. We
also used the available GPL sequence to design PCR primers to amplify genes
within the GPL genomic cluster. All M. avium strains (14 total)
gave PCR products of the expected size while none of the 3 ParaTB strains tested
gave PCR products. These initial experiments indicate that GPLs are indeed
lacking in ParaTB. We have also initiated studies to evaluate the
macrophage response to ParaTB infection and to compare this with the macrophage
response to M. avium. Our previous studies have shown that mitogen
activated protein kinase (MAPK) activation in infected macrophages is required
for its production of important immune effector molecules. Further, we
found the extent of MAPK activation within infected macrophages was inversely
correlated with the virulence of the mycobacteria (Infection and Immunity, 70;
3040-52). Therefore, we sought to compare the MAPK activation profile in
macrophages infected with ParaTB or M. avium. Interestingly, we
observed minimal activation of the MAP kinases in macrophages infected with
three different strains of ParaTB compared to 2 strains of M. avium.
Not surprisingly, we also observed minimal production of TNF-a and NOS2 by
ParaTB infected macrophages. This indicates that macrophages respond
differently to M. avium and ParaTB infection and one of these differences
is the activation of the MAPK signaling cascade.
IMPACT: 2001/10 TO
2002/09. Our studies on Johne's disease has centered on defining
characteristics specific to M. paratuberculosis, the causative agent of
this disease, which can be used to develop diagnostic markers and to gain a
better understanding of what makes this mycobacteria pathogenic. Our data
indicates that M. paratuberculosis lacks many of the genes required to
produce a glycolipid (i.e. a lipid with sugars attached) which has been
implicated in promoting a host immune response. We believe that this may
be an important aspect of its pathogenesis and perhaps useful in some diagnostic
assays to distinguish M. avium from M. tuberculosis.
PUBLICATIONS: 2001/10 TO
2002/09
1. Roach, S.K. and
Schorey, J.S. (2002) Differential regulation of p38 mitogen activated protein
kinase phosphorylation in macrophages infected with Mycobacterium.
Infection and Immunity. 70; 3040-3052.
2. Krzywinska, E. and
Schorey, J.S. Characterization of genetic differences between the
Mycobacterium avium subsp. avium strains of diverse virulence with
a focus on the glycopeptidolipid biosynthesis cluster. Veterinary
Microbiology. In Press
PROJECT
CONTACT:
Name: Schorey, J. S. Phone:
219-631-3734 Fax: 219-631-7413
Email:
schorey.1@nd.edu
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: TERMINATED
START: 01 OCT 1995
TERM: 30 SEP 2000 FY: 2000
INVESTIGATOR: Stabel J R; Bannantine J P; Vacant;
Miller J M; Bolin C A
PERFORMING INSTITUTION: National Animal Disease
Ctr.
SUBJECT:
Diagnosis, pathogenesis, and immunology of paratuberculosis (Johne's
disease) in cattle.
APPROACH: Current
protocols for fecal culture of M. paratuberculosis and PCR/nucleic acid
probe detection of M. paratuberculosis in feces and tissues will be
modified for improved sensitivity of detection; SDS-PAGE, immunoblotting,
radioimmunoprecipitation assays will be used to identify immunodominant heat
shock proteins and their utility as antigens will be evaluated; correlation
between expression of BoLA class II antigens and resistance/ susceptibility to
M. paratuberculosis infection will be evaluated; using a small-scale
pasteurizer, optimal time and temperature conditions for killing M.
paratuberculosis in milk will be determined. IBC: NADC, Ames, IA NADC, Ames,
IA, BDLRU: Bldg2,A12/A3: #0092 Aprvd & #0117 Exempt to 09/20/00 Bldg2,A17;
Barn4G: #0238 Exempt to 08/22/00 Bldg2,A3: #0075 Exempt to 12/29/00 Bldg2,A17;
Barn4G: #0237 Exempt to 04/25/00
PROGRESS: 2000/10 TO
2001/091. What major problem or issue is being resolved and how are you
resolving it? Paratuberculosis (Johne's disease) is a chronic, progressive
enteric disease of ruminants caused by infection with Mycobacterium
paratuberculosis. Economic losses are estimated to be $200/infected
cow/year and are the result of animal culling, reduced milk production, poor
reproductive performance, and reduced carcass value. Research to develop
improved diagnostic tests for detection of this disease will provide tools for
reducing contamination of the environment with M. paratuberculosis and
the spread of infection in a herd. Research on the pathogenesis and
immunology of M. paratuberculosis infections of cattle is conducted to
allow design of more rational diagnostic and control procedures.
Sequencing the genome of M. paratuberculosis will lead to
identification of specific antigens for M. paratuberculosis and will
result in better diagnostic tests to allow early detection of subclinically
infected animals and reduce the incidence of disease in herds. 2. How
serious is the problem? Why does it matter? Johne's disease has
become a high priority disease in the cattle industry. Herd prevalence of
Johne's disease is estimated to be 22-40% as determined by a recent NAHMS survey
of dairy cattle. There are no adequate estimates of herd prevalence in
beef cattle in the
1. Bannantine, J.P.,
Stabel J.R. HspX is present within Mycobacterium
paratuberculosis-infected macrophage and is recognized by sera from some
infected cattle. Veterinary Microbiology. 2000. v. 76. p.
434-358.
2. Stabel, J.R.
Transitions in immune responses to Mycobacterium paratuberculosis.
Veterinary Microbiology. 2000. v. 77. p. 465-473.
3. Mwangi, S.M., Stabel,
J., Lee, E., Kehrli, M.E. Taylor, M.J., Expression and characterization of a
recombinant soluble form of bovine tumor necrosis factor receptor type I.
Veterinary Immunology and Immunopathology. 2000. v. 77. p.
233-241.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: TERMINATED
START: 24 JAN 2001
TERM: 30 SEP 2001 FY: 2001
INVESTIGATOR: STABEL J R
PERFORMING
INSTITUTION: National Animal Disease Ctr.
SUBJECT: Evaluation of sensitivity and specificity of a new
fecal PCR test for M. paratuberculosis.
APPROACH: Approximately
1,500 fecal samples will be collected from dairy herds across the state of
No publications reported
this period.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: TERMINATED
START: 01 OCT 2000
TERM: 06 NOV 2001 FY: 2001
INVESTIGATOR: Stabel J R; Vacant; Bannantine J P;
Miller J M; Vacant
PERFORMING INSTITUTION: National Animal Disease
Ctr.
SUBJECT:
Diagnosis, pathogenesis, and immunology of paratuberculosis (Johne's
disease) in cattle.
APPROACH: Current
protocols for fecal culture of M. paratuberculosis and PCR/nucleic acid
probe detection of M. paratuberculosis in feces and tissues will be
modified for improved sensitivity of detection; SDS -PAGE, immunoblotting,
radioimmunoprecipitation assays will be used to identify immunodominant heat
shock proteins and their utility as antigens will be evaluated; correlation
between expression of BoLA class II antigens and resistance/ susceptibility to
M. paratuberculosis infection will be evaluated; using a small-scale
pasteurizer, optimal time and temperature conditions for killing M.
paratuberculosis in milk will be determined. IBC: NADC,
1. Bannantine, J.P.,
Baechler, E., Zhang, Q., Li, L., Kapur, V. Genome scale comparison of
Mycobacterium avium subspecies paratuberculosis with
Mycobacterium avium subspecies avium reveals potential diagnostic
sequences. Journal of Clinical Microbiology. 2002. v. 40. p.
1303-1310.
2. Stabel, J.R., Wells,
S.J., Wagner, B.A. Relationships between fecal culture, ELISA, and bulk tank
milk test results for Johne's disease in US dairy herds. Journal of Dairy
Science. 2002. v. 85. p. 525-531.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: NEW
START: 07 NOV 2001 TERM: 06
NOV 2006 FY: 2005
INVESTIGATOR: Stabel J R; Bannantine J P; Robbe Austerman
S; Paustian M; Peterson Burch B D; Whipple D L
PERFORMING INSTITUTION:
Agricultural Research Service.
SUBJECT: Understanding host-pathogen interactions for the
diagnosis & control of paratuberculosis (Johne's).
PROGRESS: 2003/10 TO
2004/09 1. What major problem or issue is being resolved and how are you
resolving it (summarize project aims and objectives)? How serious is the
problem? What does it matter? Disease of ruminants caused by
infection with Mycobacterium avium subsp. paratuberculosis.
Economic losses are estimated to be $200/infected cow/year and are the
result of animal culling, reduced milk production, poor reproductive
performance, and reduced carcass value. Johne's disease has become a high
priority disease in the cattle industry. Herd prevalence of Johne's
disease is estimated to be 22-40% as determined by a recent National Animal
Health Monitoring Survey of dairy cattle. There are no adequate estimates
of herd prevalence in beef cattle in the
2. Stabel, J.R.,
Bosworth, T.L., Kirkbride, T.A., Forde, R.L., Whitlock, R.H. 2004. A simple,
rapid, and effective method for the extraction of Mycobacterium
paratuberculosis DNA from fecal samples for PCR. Journal of
Veterinary Diagnostic Investigation. 16:22-30.
3. Bannantine, J.P.,
Hansen, J.K., Paustian, M., Amonsin, A., Li, L.L., Stabel, J.R., Kapur, V. 2004.
Expression and immunogenicity of proteins encoded by sequences specific to
Mycobacterium avium subsp. paratuberculosis. Journal of
Clinical Microbiology. 42:106-114.
4. Stabel, J.R., Palmer,
M.V., Whitlock, R.H. 2003. Immune responses after oral inoculation of
weanling bison or beef calves with a bison or cattle strain of Mycobacterium
paratuberculosis. Journal of Wildlife Diseases.
39:545-555.
5. Paustian, M.,
Amonsin, A., Kapur, V., Bannantine, J.P. 2004. Charatetrization [sic]
of novel coding sequences specific to Mycobacterium avium subsp.
paratuberculosis: implications for diagnosis of Johne's disease.
Journal of Clinical Microbiology. 42:2675-2681.
6. Waters, W.R., Miller,
J.M., Palmer, M.V., Stabel, J.R., Jones, D.E., Koistinen, K.A., Steadham, E.M.,
Hamilton, M.J., Davis, W.C., Bannantine, J.P. 2003. Experimental
Mycobacterium avium subsp. paratuberculosis infection of calves:
early induction of a humoral and cellular immune response. Infection and
Immunity. 71:5130-5138.
7. Amonsin, A., Li, L.,
Zhang, Q., Bannantine, J.P., Motiwala, A., Sreevatsan, S., Kapur, V. 2004. A
multi-locus short sequence repeat sequencing approach for Mycobacterium
avium subspecies paratuberculosis stain differentiation.
Journal of Clinical Microbiology. 42:169-1702.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: TERMINATED
START: 01 MAY 2000
TERM: 31 DEC 2003 FY: 2004
INVESTIGATOR: Stabel, J.R.
PERFORMING INSTITUTION: Agricultural Research Service.
SUBJECT: Study of thermal inactivation
of Mycobacterium paratuberculosis in fluid milk.
FUNDED BY INTERNATIONAL
DAIRY FOODS ASSOCIATION PROGRESS: 2000/05 TO 2003/124. What were the most
significant accomplishments this past year? D. Progress Report. This
report serves to document research conducted under a trust agreement between ARS
and the Internationl Dairy Foods Association. Additional details of
research can be found in the report for the parent project 3625-32000-062-00D
Understanding Host Pathogen Interactions for the Diagnosis and Control of
Johne's Disease (Paratuberculosis). Experiments to evaluate 7 proposed
time/temperature combinations for heat treatment of milk inoculated with M.
paratuberculosis have been completed. These experiments have been
completed on both the slug flow and the HTST units, all three bacterial strains
at 2 inoculum levels have been tested. Culture work with both solid and
liquid mediums has been completed as well as verification of all suspect
positives by PCR, subculture and bacterial staining. Results suggest that
US pasteurization standards effectively destroy up to 100,000,000 M.
paratuberculosis organisms. The exception is the pasteurization of
milk for cheese production that was only effective in destroying 100,000
organisms. This work is important to the dairy industry and consumers so
they can be assured that pasteurization provides a safe, clean product.
PUBLICATIONS: 2000/05 TO
2003/12
No publications reported
this period.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: NEW
START: 01 SEP 2002 TERM: 31
AUG 2005 FY: 2005
INVESTIGATOR: Bannantine J P; Kapur V; Wells S J;
PERFORMING
INSTITUTION: Agricultural Research Service.
SUBJECT: Functional genomic analysis of
Mycobacterium paratuberculosis.
APPROACH: Computerized
DNA sequence alignments will be performed will the complete genome sequences of
M. paratuberculosis and the genetically similar M. avium genomes.
From these alignments, we will have a list of candidate sequences present
in M. paratuberculosis and not M. avium. These sequences
will then be checked, again by computerized alignment, against the complete
genomes of M. leprae and M. tuberculosis. Sequences specific
to only M. paratuberculosis will be further confirmed by PCR
amplification and DNA hybridization against genomic DNA from several
mycobacterial species. Those sequences that have passed these specificity
tests will be cloned and expressed in E. coli. The resulting
recombinant proteins will be evaluated for use in a variety of immunologic-based
tests aimed at detecting M. paratuberculosis within infected cattle.
Developed test(s) will be validated using blood and fecal samples from six
well-characterized cattle herds in
PUBLICATIONS: 2003/10 TO
2004/09
1. Paustian, M.,
Amonsin, A., Kapur, V., Bannantine, J.P. 2004. Charatetrization [sic]of
novel coding sequences specific to Mycobacterium avium subsp.
paratuberculosis: implications for diagnosis of Johne's disease.
Journal of Clinical Microbiology. 42:2675-2681.
2. Bannantine, J.P.,
Hansen, J.K., Paustian, M., Amonsin, A., Li, L.L., Stabel, J.R., Kapur, V. 2004.
Expression and immunogenicity of proteins encoded by sequences specific to
Mycobacterium avium subsp. paratuberculosis. Journal of
Clinical Microbiology. 42:106-114.
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 16 SEP
2004 TERM: 31 JUL 2007 FY: 2004
INVESTIGATOR: Stabel J R; Beiz D
PERFORMING INSTITUTION: Animal Science.
SUBJECT: Cellular activation in different stages of infection with
Mycobacterium avium subsp. paratuberculosis in cattle.
PROJ
TYPE:
USDA INHOUSE PROJ STATUS: NEW
START: 15 APR 2004 TERM: 14
APR 2006 FY: 2005
INVESTIGATOR: Bannantine J P; Stabel J R; Paustian M;
Robbe Austerman S
PERFORMING INSTITUTION: Agricultural Research
Service.
SUBJECT: Johne's
Disease Integrated Program in research, education, and extension.
APPROACH: The GAP core
will develop an oligonucleotide array representing all genes in M.
paratuberculosis (Map). This core will also produce a clone set of the
coding sequences in Map. It will also make available transposon mutants
for JD research. The AMF core will perform two specific tasks. (1)
Assemble and maintain a current listing of available BL-2 certified animal
facilities at various JDIP sponsored institutions and (2) establish
calf-challenge models for JD research including study of the immune response to
virulent Map and candidate vaccines. Biosafety certification pending.
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 2002-35204-12321 PROPOSAL NO:
2002-02228
START: 01 SEP 2002 TERM: 31 AUG 2005 FY: 2005 GRANT YR: 2002
GRANT AMT: $285,000
INVESTIGATOR: Bannantine, J. P.; Kapur, V.; Wells, S.
J.;
PERFORMING INSTITUTION: National Animal Disease Ctr.
SUBJECT: Functional Genomic Analysis of
Mycobacterium paratuberculosis.
NON-TECHNICAL SUMMARY: Johne's
disease is caused by the bacterium Mycobacterium paratuberculosis and is
responsible for the annual loss of more than $220 million dollars to animal
production in the
OBJECTIVES: Identify
all DNA sequences specific to Mycobacterium paratuberculosis.
Confirm specificity of these DNA sequences by PCR amplification with
several different species of mycobacteria. Produce and purify recombinant
proteins from these specific sequences to evaluate utility in a
serological-based test or other immunological assay. Validate resulting
developed tests for detection of cattle infected with M. paratuberculosis
in a whole herd setting.
APPROACH: Computerized DNA sequence alignments will
be performed will the complete genome sequences of M. paratuberculosis
and the genetically similar M. avium genomes. From these
alignments, we will have a list of candidate sequences present in M.
paratuberculosis and not M. avium. These sequences will then be
checked, again by computerized alignment, against the complete genomes of M.
leprae and M. tuberculosis. Sequences specific to only M.
paratuberculosis will be further confirmed by PCR amplification and DNA
hybridization against genomic DNA from several mycobacterial species.
Those sequences that have passed these specificity tests will be cloned
and expressed in E. coli. The resulting recombinant proteins will
be evaluated for use in a variety of immunologic-based tests aimed at detecting
M. paratuberculosis within infected cattle. Developed test(s) will
be validated using blood and fecal samples from six well-characterized cattle
herds in
PROGRESS:
2002/09 TO 2005/08 The goal of this proposal, entitled, Functional
genomic analysis of Mycobacterium paratuberculosis, is to identify coding
sequences (DNA that encodes for proteins) from the M. paratuberculosis
genome that are useful in diagnosis of Johne's disease. By combining a
comparative genomics approach with PCR amplification and microarray analysis, we
have identified a total of 39 genes that are present uniquely in M.
paratuberculosis. Those gene sequences that were successfully cloned
and expressed in E. coli were evaluated for immunogenicity using sera
from clinical cattle. Five to six solid candidate antigens have been
identified as a result of these studies. Novel antigens have already been
incorporated into a new diagnostic assay (involving flow cytometry) and the
validation in dairy cattle herds in
PUBLICATIONS: 2002/09 TO 2005/08
1. Eda, S., B.
Elliott, M. C. Scott, W. R. Waters, J. P. Bannantine, R. H. Whitlock, and C. A.
Speer. 2005. New method of serological testing for Mycobacterium avium
subsp. paratuberculosis (Johne's disease) by flow cytometry.
Foodborne Pathogens and Disease 2:250-262.
3. Li, L., J. P.
Bannantine, Q. Zhang, A. Amonsin, B. J. May, D. Alt, N. Banerji, S. Kanjilal,
and V. Kapur. 2005. The complete genome sequence of Mycobacterium
avium subspecies paratuberculosis. Proceedings of the
4. Huntley, J. F. J., J.
R. Stabel, and J. P. Bannantine. 2005. Immunoreactivity of the
Mycobacterium avium subsp. paratuberculosis 19-kDa
lipoprotein. BMC Microbiology 5:3.
5. Paustian, M. L., A.
Amonsin, V. Kapur, and J. P. Bannantine. 2004. Characterization of
novel coding sequences specific to Mycobacterium avium subsp.
paratuberculosis: implications for diagnosis of Johne's disease.
Journal of Clinical Microbiology 42:2675-2681.
6. Bannantine, J. P., J.
K. Hansen, M. L. Paustian, A. Amonsin, L. Li, J. R. Stabel, and V. Kapur. 2004.
Expression and immunogenicity of proteins encoded by sequences specific to
Mycobacterium avium subsp. paratuberculosis. Journal of
Clinical Microbiology 42:106-114.
7. Waters, W. R., B. J.
Nonnecke, M. V. Palmer, S. Robbe-Austermann, J. P. Bannantine, J. R. Stabel, D.
L. Whipple, J. B. Payeur, D. M. Estes, J. E. Pitzer, and F. C. Minion. 2004.
Use of recombinant ESAT-6:CFP-10 fusion protein for differentiation of
infections of cattle by Mycobacterium bovis and by M. avium subsp.
avium and M. avium subsp. paratuberculosis. Clinical
and Diagnostic Laboratory Immunology 11:729-735.
8. Bannantine, J. P., E.
Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome scale comparison of
Mycobacterium avium subspecies paratuberculosis with
Mycobacterium avium subspecies avium reveals potential diagnostic
sequences. Journal of Clinical Microbiology 40:1303-1310.
PROJECT
CONTACT:
Name: Bannantine, J. P. Phone:
515-663-7340. Fax: 515-663-7458
Email:
jbannant@nadc.ars.usda.gov
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JUL 2003 TERM: 30 JUN 2006
FY: 2005
INVESTIGATOR: Hostetter, J.; Jones, D.; Wannemuehler, M.
PERFORMING INSTITUTION: Veterinary Medicine.
SUBJECT: Comparison of bovine dendritic cell
stimulation of T cells isolated from Mycobacterium avium subspecies
paratuberculosis (M. a. ptb).
NON-TECHNICAL SUMMARY: Johne's
disease is an economically significant enteric disease of ruminants. A
major problem in the control of Johne's disease is the significant number of
clinically healthy, but infected animals, which escape detection through current
diagnostic methods. It is the pupose of this study to test the hypothesis
that a dendritic cell induced proliferation assay of peripheral blood T cells
can distinguish M. a. ptb infected from non-infected cattle.
PROJECT
CONTACT:
Name: Hostetter, J.
Phone: 515-294-0953
Email:
jesseh@iastate.edu
PROJ
TYPE: STATE PROJ
STATUS: TERMINATED
START: 01 JUL 2001 TERM: 30 JUN 2002 FY: 2001
INVESTIGATOR: Thoen, C. O.; Cheville, N. F.
PERFORMING INSTITUTION:
Veterinary Medicine.
SUBJECT:
Evaluation of a Mycobacterium avium ss ptb. purified protein derivative
for use in detecting subclinical Johne's disease in
cattle.
NON-TECHNICAL SUMMARY: Available information indicates
Johne's disease is present in 40% of the dairy herds and 22% of the cattle in
Iowa (NAHMS). Diagnostic tests are not suitable for monitoring young
replacement cattle for the presence of infection or for early detection of
infection in cattle in herds in which the disease persists. The purpose of
this project is to evaluate a PPD skin test for use in the diagnosis of
subclinical Johne's disease.
APPROACH:
Investigations will be conducted to obtain information on the sensitivity
of M. avium ss paratuberculosis PPD for use in the early diagnosis
of subclinical Johne's disease in cattle. Skin tests will be conducted on
cattle in herds in which Johne's disease has been diagnosed; tissues (ileocecal
value and adjacent lymph nodes) will be collected from animals that respond on
skin test for mycobacteriologic and immunohistochemical examinations. The
specificity of the test will be evaluated in cattle in herds in which Johne's
disease has not been diagnosed in the past 5 years and negative on laboratory
examinations (fecal culture and ELISA). The 2 year study is designed to
collect tissue specimens from 40 skin test positive cattle in 8 herds in which
Johne's disease has been diagnosed previously by an organism based test (culture
and/or polymerase chain reaction) and from 40 cows in 8 herds in which Johne's
disease has not been diagnosed during the past 5 years and which are negative on
culture and/or PCR of fecal specimens. Blood will be collected from
animals that respond on skin test for gamma interferon assay using M. avium
ptb PPD according to procedures described by Biocor. Tissues
(ileocecal valve and adjacent lymph nodes) will be collected from each cow for
mycobacterologic and immunohistochemical examination.
PROGRESS: 2001/07 TO
2002/06 Skin tests have been conducted in 865 cattle in 8 herds in which
Johne's disease was diagnosed previously by mycobacteriologic examinations.
Fecal specimens have been collected from each of the cows for
bacteriologic examinations. Enzyme linked immunosorbent assays (IDEXX and
ISU) have been conducted on serums collected from each of the cattle.
Tissues have been collected from each of 10 cows for PCR, cultural
examinations and histopathologic evaluation. Tissues from five of six cows
positive on skin test were culture positive. Positive skin tests were detected
as early as 1 year before positive ELISA results were obtained on sera, and/or
organisms were identified in feces.
IMPACT: 2001/07 TO
2002/06 Development of a sensitive diagnostic test such as the skin test
for detecting 2-3 year heifers and other herd additions is of principal
importance to cattle producers interested in purchasing animals for expanding
their cattle herds. Currently, available procedures are of little or no
value in detecting Ma ptb infected animals in the early stages of disease.
PUBLICATIONS: 2001/07 TO
2002/06
No publications reported
this period
PROJECT
CONTACT:
Name: Thoen, C. O.
Phone: 515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JUL 2000 TERM: 30
JUN 2003 FY: 2003
INVESTIGATOR: Thoen, C. O.; Cheville, N. F.
PERFORMING
INSTITUTION: Veterinary Medicine.
SUBJECT: Natural exposure of adult dairy cattle
to Mycobacterium avium ss paratuberculosis-infected cattle under field
conditions.
NON-TECHNICAL SUMMARY: No definitive information is
currently available on the susceptibility of adult dairy cattle to Johne's
disease on farm conditions. The results of this research will provide
useful information for herd owners in making decisions involving herd
replacements as well as additions to expand herds in which Johne's disease has
been diagnosed.
PROGRESS: 2000/07 TO
2003/06 Animals 2 years of age introduced into a herd in which Johne's
disease was present failed to develop clinical Johne's disease. Shedding
of Mycobacterium avium ss paratuberculosis in the feces was
detected in 1 animal after exposure for 3 years. M. avium ss
paratuberculosis was not isolated from tissues of any of the negative
additions at necropsy. IMPACT: 2000/07 TO 2003/06 Johne's disease causes
significant economic losses to dairy cattle producers. The information
obtained in this investigation suggest that only limited economic losses are
realized when 2 year old cattle are naturally exposed to M. avium ss
paratuberculosis.
PUBLICATIONS: 2000/07 TO 2003/06
No publications reported
this period
PROJECT
CONTACT:
Name: Thoen, C. O.
Phone: 515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JUL 2002 TERM: 30 JUN 2004
FY: 2005
INVESTIGATOR: O'Connor, A.; Robbe, S.; Evans, R.; Ensley, D.
PERFORMING INSTITUTION: Veterinary Medicine.
NON-TECHNICAL SUMMARY:
Once a producer's herd becomes infected with Johne's disease, it is very
difficult to develop an eradication program that is timely, reasonable in cost,
and effective. Recently, new statistical methods have been developed to
evaluate the performance of diagnostic tests using several populations of
animals with different prevalence of disease. This technique allows us to
evaluate newer and more sensitive tests in real productions systems at a
reasonable cost. OBJECTIVES: Johne's disease is a chronic bacterial
disease of ruminants caused by Mycobacterium avium subspecies
paratuberculosis. Once a producer's herd becomes infected with
Johne's disease, it is very difficult to develop an eradication program that is
timely, reasonable in cost, and effective. Therefore, developing and using
prevention programs is critical for producers. The majority of producer's
herds become infected by purchasing infected subclinical animals. The
diagnostic tests commercially available are not capable of accurately
identifying exposed or infected subclinical animals. New and developmental
tests that detect cell-mediated immune responses have the potential of improving
our ability to detect subclinically infected animals. However, one of the
difficult challenges researchers face when attempting to evaluate a new
diagnostic test is evaluating that test against a current gold standard.
Recently, new statistical methods have been developed to evaluate the
performance of diagnostic tests using several populations of animals with
different prevalence of disease. This technique allows us to evaluate
newer and more sensitive tests in real productions systems. Although these
methods will never replace experiments, they do allow us to evaluate diagnostic
tests, especially false positive rates within the context of the production
system and at a reasonable cost. The majority of the research concerning
Johne's disease has been done in dairy cattle, not in beef cattle.
Consequently we have extrapolated the performance of diagnostic tests from
dairy to beef and automatically have assumed the specificity and sensitivity of
the diagnostic tests are the same in extensive beef cattle operations and
intensive dairy operations. This may be a reasonable assumption, but the
population dynamics and stress levels are very different between beef cattle and
dairy cattle. For example, the average age of a beef cow is usually
between 7-8 years of age, the average age of a dairy cow is 3-4 years.
Consequently there is a critical need to evaluate these tests in beef
cattle. Our objective is to evaluate the following tests in beef cattle: 1.
Three commercial ELISA's: HerdChek by IDEXX, ParaChek by Biocor, and SERELISA by
Synbiotics; 2) The skin test with the new NVSL Johnin antigen, and compare the
results of the skin test against the gamma interferon; 3) The fecal culture on
HEY media. Once we collect the results of all the diagnostic tests, the
data will be entered into a Hui and Walter model. Sensitivities, specificities,
and prevalence of the populations will be estimated.
APPROACH: 1.) Identify 3
positive herds and 3 negative herds. These herds must have 100+ animals
and have had confirmed Johne's' disease. 2.) Draw blood using the tail
vein, collect feces, and inject 0.1 ml of Johnin in the caudal fold of the tail.
3.) Age of the animals and body condition scores will also be collected.
These samples will all be collected in the summer and fall of 2002.
4.) The skin test injection site will be read in 72 hours. 5.)
These results will be evaluated using Bayesian statistical methods and the
Hui and Walter model.
PROGRESS: 2002/01 TO
2002/12
New project: no progress
report at this time.
PUBLICATIONS: 2002/01 TO
2002/12
No publications reported
this period
PROJECT
CONTACT:
Name: O'Connor, A.
Phone: 515-294-5012. Fax: 515-294-1072
Email:
oconnor@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 SEP 2002 TERM: 31 AUG 2004
FY: 2005
INVESTIGATOR: Thoen, C. O.
PERFORMING INSTITUTION: Veterinary
Medicine.
NON-TECHNICAL SUMMARY: Johne's disease causes major economic losses
to the dairy and beef industry. Available information indicates Johne's
disease is present in 40 percent of the dairy herds in
APPROACH: Skin tests
will be conducted using M. avium ss ptb PPD on 400 cattle, 10-14
months of age and 400 cattle 20-24 months of are in 10 or more herds in which
Johne's disease has been diagnosed by mycobacteriologic examination and on 800
cattle of the same age in 10 herds in whch Johne's disease has not been
diagnosed for 5 years. Skin thickness will measured before injection of
Maptb PPD in skin of the mid-cervical region and at 72 hours following
injection. The difference in sin thickness will be determined, recorded,
and anlayzed. Gamma interferon assays will be conducted on blood of
animals that are positive on the skin test.
PROGRESS: 2003/01 TO
2003/12 Skin tests using the new PPD produced from ATCC 19698 (Neotype
Strain of Mycobacterium avium ss paratuberculosis) have been
conducted in cattle in 26 herds. Positive responses were observed in 15 of
494 cattle, 10 to 26 months of age originating 17 herds in which Johne's disease
had not been diagnosed. Based on these results the specificity of the new
PPD skin test is 97%. Skin tests were also conducted on 757 cattle in 9
herds in which Johne's disease had been diagnosed previously. Positive
responses were observed in 121 (16%) of the 757 animals tested. Most
important, positive responses were observed in 10 to 26 month-old cattle in 8 of
9 herds in which Johne's disease had been diagnosed. ELISA was positive in
only 6 cattle of the same age group in 2 of 9 herds.
IMPACT: 2003/01 TO
2003/12 Information indicates Johne's disease is present in 40% of the
dairy herds in
No publications reported
this period
PROJECT
CONTACT:
Name: Thoen, C. O. Phone:
515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 01 AUG 1980 TERM: 30 JUN
2004 FY: 2005
INVESTIGATOR: Thoen, C. O.
PERFORMING INSTITUTION:
Veterinary Medicine.
SUBJECT: Mycobacterial infections in animals.
IMPACT: 2003/01 TO
2003/12 The isolation of M. avium ss paratuberculosis is in
support of research to develop improved diagnostic tests for Johne's disease in
cattle. The disease is widespread in dairy herds in
PUBLICATIONS: 2003/01 TO 2003/12
PROJECT
CONTACT:
Name: Thoen, C. O. Phone:
515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 01 MAR 1998 TERM: 28 FEB
2004 FY: 2004
INVESTIGATOR: Reynolds, D. L.
PERFORMING INSTITUTION:
Veterinary Medicine.
SUBJECT: Merial Veterinary Scholars.
APPROACH: One approach
to encourage more veterinary medical students to consider animal health and
biomedical research as a career in academia and/or the pharmaceutical industry
is to provide them with practical research experiences and to expose them to
good role models. By provide a summer enrichment program we would continue
to strengthen our efforts by placing veterinary graduated in research careers.
Veterinary students participating in the program will be paired with
faculty and placed in a dynamic research setting. The students will gain
experience in research design, collection of data, statistical analysis, data
interpretation, and presentation of research results.
PROGRESS: 2001/01 TO
2001/12 For the summer 2001 program nine scholars were selected. Their
projects and mentors were as follows:
1. Carrie Berg.
Mycobacterium avium subspecies paratuberculosis infection in
Pygmy goats.
4. Erin Luxford. Role
of antigen presenting cells in the in vitro recall response of T cells to
specific Brachyspira hyodysenteriae antigen.
PUBLICATIONS: 2001/01 TO
2001/12
No publications reported
this period
PROJECT
CONTACT:
Name: Reynolds, D. L.
Phone: 515-294-9348. Fax: 515-294-8956
Email:
dlr@iastate.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 2001
TERM: 30 SEP 2004 FY: 2004
INVESTIGATOR: Jones, D. E.; Steadham, E.;
Hostetter, J.; Waters, R.
PERFORMING INSTITUTION: Veterinary
Medicine.
SUBJECT: Bovine
macrophage and T cell responses to Mycobacterium avium ssp. paratuberculosis
infection.
NON-TECHNICAL SUMMARY: Currently there is no vaccine
available to prevent or treat the cause of Johne's disease. Development of
a vaccine, or treatment, is likely to be impeded without an understanding of the
mechanisms that allow Map to survive in vivo. The purpose of this project
is to understand those mechanisms.
APPROACH: We will test
the hypothesis by assaying bacterial killing by macrophages when stimulated with
committed Th1 cells or cell products. Th1 cells will be produced in vitro
by culturing CD4+ T cells from naive animals with anti-CD3 and IL-12.
Infected macrophages will be cultured with the Th1 cells and/or their
supernatants. At various time points after infection the bacteria will be
recovered from the macrophages and their viability will be determined by
staining and CFU assay. We will also evaluate several other aspects of
macrophage activation under these conditions, specifically, the production of
reactive nitrogen and oxygen intermediates and phagosome maturation. We
will also determine the commitment of CD4+ cells to the Th1 phenotype by
repeatedly stimulating cells in vitro and assaying for proliferation and the
production of IFN-g. IL-12 receptor b1 and b2 levels will be assayed as an
additional indicator of Th1 phenotype. Receptor expression will be
determined by amplifying the mRNA from Th1 cells by PCR. We will also
determine the Th1 cell phenotype of Map-specific CD4+ T cells obtained from in
vivo Map infections. Their commitment to a Th1 phenotype will be tested by
repeated stimulation in vitro. These Th1 cells from Map infected animals
will be compared to the equivalent cell type from M. bovis-infected
animals. M. bovis infection of cattle results in a persistent Th1
type immune response and are used as a positive control. Evaluation of
these aspects of the immune response to Map will facilitate our understanding of
the immune response of cattle to Map infection and help in the evaluation of
vaccine candidates
PROGRESS: 2002/01 TO
2002/12 A method of experimentally infecting calves with Mycobacterium
avium subspecies paratuberculosis (Map) was developed. This has
allowed us to investigate the development of the infection through the first
eight months of exposure. Five months after intra-tonsilar inoculation
with the bacteria, calves developed an antibody and lymphocyte response to Map
antigens. The cells proliferating upon exposure to Map antigens, in vitro,
were evaluated by flow cytometry and found to be CD4+ T lymphocytes. In
addition, these cells were found to be the primary cell type producing
IFN-gamma. We have also titrated naive primary bovine monocyte-derived
macrophages for their response to IFN-gamma in vitro. We have developed
assays for evaluating reactive nitrogen intermediates, reactive oxygen
intermediates, and changes in the cellular morphology of macrophages in response
to IFN-gamma. This was a necessary first step in evaluating the ability of
Map antigen-specific T cells to activate Map-infected bovine macrophages by the
IFN-gamma secreted into their medium in vitro.
IMPACT: 2002/01 TO
2002/12 The inability to experimentally infect calves with Map has
retarded progress in studying Johne's disease. For the first time we are
able to describe the length of time required for an antibody response, as well
as a cell-mediated response, to develop. In addition, we will have a
reproducible and consistent source of antigen responsive T cells to use in
determining their ability to activate Map infected macrophages.
PUBLICATIONS: 2002/01 TO
2002/12
No publications reported
this period
PROJECT
CONTACT:
Name: Jones, D. E.
Phone: 515-294-4682. Fax: 515-294-5423
Email:
jonesdou@iastate.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 99-34362-7580-S PROPOSAL NO: 2000-04007-S
START: 01 JUN 2000 TERM: 14 JUN 2002 FY: 2002 GRANT YR: 2000 GRANT AMT:
$47,000
INVESTIGATOR: Thoen, C. O.; Cheville, N. F.
PERFORMING
INSTITUTION: Veterinary Medicine.
SUBJECT: Mycobacterium avium subspecies
paratuberculosis link to human Crohn’s's disease. NON-TECHNICAL SUMMARY:
In some studies, Mycobacterium avium ss paratuberculosis, the
causitive agent in Johne's disease in cattle, has been implicated in human
Crohn’s's disease even though reviews of Johne's disease and its connection to
human Crohn’s's have not established any connection. The purpose of this
research is to conduct a systematic investigation to determine the prevalence of
Crohn’s's disease in herd owners and their families and to determine if
Crohn’s's is more common in herd owners in which Johne's disease has been
diagnosed. The results will provide useful information on the occurrence
of Crohn’s's disease in dairy cattle owners.
IMPACT: 2000/06 TO
2002/06 The findings fail to provide information on the possible
association of Mycobacterium avium ss paratuberculosis in humans
that are exposed or responsible for the care of cattle in herds in which Johne's
disease has been diagnosed previously by mycobacteriologic examination of feces
or tissues or by humoral antibody assays and/or immunologic assays.
PUBLICATIONS: 2000/06 TO
2002/06
No publications reported
this period
PROJECT
CONTACT:
Name: Thoen, C. O.
Phone: 515-294-7609. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 99-34362-7555 PROPOSAL NO: 2000-04085
START: 15 JUN 1999 TERM: 14 JUN 2002 FY: 2002 GRANT YR: 2000 GRANT AMT:
$46,000
INVESTIGATOR: Cheville, N. F.; Thoen, C. O.; Daniels, L.; Steadham,
E. M.
PERFORMING INSTITUTION: Veterinary Medicine.
SUBJECT: Development and testing of deletion
mutant vaccines for Johne's disease.
NON-TECHNICAL SUMMARY: Johne's
disease is a leading cause of loss for the cattle industry. Vaccines hold
promise for prevention and control of Johne's disease but an efficacious
commercial vaccine is not available. By producing established mutant
vaccine strains of Mycobacterium avium subspecies paratuberculosis
and establishing that these strains are safe, efficacious and stable, will lead
to commercialization of an improved vaccine against Johne's disease. This
knowledge may permit analyses of genetic resistance in animals with improved
defense mechanisms.
APPROACH: Objectives
are: 1. Prepare genetic deletion mutants of Mycobacterium avium
subspecies paratuberculosis that lack capacity to make NADP-dependent
glucose-6-P dehydrogenase or F-dependent glucose-6-P dehydrogenase. We
have targeted oxidative stress agents and nitric oxide because they are produced
by macrophages and are believed to kill bacteria within intracellular macrophage
lysosomal systems. We will create M.ptb mutants that lack specific enzymes
that are likely to be important in protecting this bacterium from oxidative
agents and will test virulence of the strains in an animal model. 2.
Define uptake and intracellular trafficking and characteristics of genetic
deletion mutant in vitro. An in vitro invasion assay will be used to
evaluate the adherence and uptake of M.ptb in a mouse macrophage cell line MH-S
cultures. The model also facilitates experimentation with agents that
block receptor-mediated adherence and uptake or agents that interfere with
intracellular survival of the bacteria. 3. Define virulence factors and
pathogenesis of the vaccine strains of M.ptb in experimental animals is the
major factor in biosafety. Clinical signs of disease as a result of
vaccination will be monitored by daily clinical examination of vaccinated
animals. Particular attention will be directed to elevation of body
temperature, anorexia, lameness and anaphylaxis. Detection of vaccine
strains in the bloodstream, feces, nasal exudates, milk, tears, saliva and other
body secretions will be done.
PROGRESS: 1999/06 TO
2002/06 In vitro (in macrophages) and in vivo (in mice and calves) test
and assay protocols to establish the stability, biosafety and efficacy of
vaccine candidate strains of M. avium ss. paratuberculosis (M.ptb)
have been developed. Growth of M.ptb in macrophages was examined to define
characteristics of intracellular trafficking for exocytosis, replication, and
antigen presentation. Using immunocytochemical markers for light, confocal
and electron microscopy, we have defined pathway tropism based on data for
bacterial attachment, phagosomal acidification, phagolysosomal degradation and
apoptosis. Non-pathogenic strains of M.ptb were processed by exocytosis
and avirulent mutant strains appear to be degraded and have preference for
antigen processing pathways that involve transport vesicles bearing MHC2
antigens. Pathogenicity in a nude mouse model of intestinal infection
reveals lesion development and confirms pathway preferences of virulent strains
for bacteriophorous vacuole formation. Pathogenicity in newborn calves
after subcutaneous injection at sites simulating vaccination has led to major
studies of the role of interferon and interleukins in the immune response of
cattle to M.ptb; preliminary data indicates that there are marked changes in
development and release of interferon gamma in regional lymph nodes.
Mutants of M.ptb were prepared by using homologous recombination to create
mutants that cannot make NADP-dependent glucose-6-P dehydrogenase or
F420-dependent glucose-6-P dehydrogenase, both of which are expected to be
important in responses to oxidative stress. Both genes have been cloned
and sequenced and one has been inserted into plasmids for knockout vectors; the
mutants were produced by electrotransformation. The mutants produced to
date are unstable and studies are continuing to increase the stability of mutant
M.ptb.
IMPACT: 1999/06 TO
2002/06 In vitro and in vivo models for testing and evaluation of
avirulent (vaccine) strains of M.ptb have been developed. Growth in
macrophage cultures allows quantitation of intracellular traffiking through
endosomal and lyposomal pathways. Growth in mice using tissue morphology,
cytokine induction, and other host responses permits definition of virulence
characteristics. The mutants produced to date are unstable and studies are
continuing to increase the stability of mutant M.ptb.
PUBLICATIONS: 1999/06 TO
2002/06
1. Cheville NF,
Hostetter J, Thomsen BV, Simutis F, Vanloubbeeck Y, Steadham E.
Intracellular trafficking of Mycobacterium avium ss.
paratuberculosis in macrophages. Deutsch Tierarztl Wchnschr
108:236-243, 2001.
2. Thomsen
BV,
Steadham EM, Gallup JM, Ackermann, MR, Brees DJ,
4.
Hostetter JM, Steadham EM, Haynes JS, Bailey TB, Cheville NF. Phagosomal
maturation and intracellular survival of Mycobacterium avium subspecies
paratuberculosis in J774 cells. FEMS Immunol & Med
Microbiol (submitted 2002).
5. Hostetter JM,
Steadham EM, Haynes JS, Bailey TB, Cheville NF. Cytokine effects on
maturation of the phagosomes containing Mycobacterim avium subspecies
paratuberculosis in J774 cells. Comp Immunol, Microbiol & Inf
Dis (submitted 2002).
6. Hostetter JM,
Steadham EM, Haynes JS, Bailey TB, Cheville NF. Characterization of
acidification of phagosomes containing Mycobacterium avium subspecies
paratuberculosis in J774 cells. Clin Diagn Lab Immunol
(submitted 2002).
7. Simutis F, Moore DG,
PROJECT
CONTACT:
Name: Cheville, N. F.
Phone: 515-294-0877
Email:
nchevill@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JUL 2002 TERM: 31 MAR 2005
FY: 2005
INVESTIGATOR: Simutis, F. J.; Jones, D. E.; Cheville, N. F.
PERFORMING INSTITUTION: Veterinary Medicine.
SUBJECT: Gamma-delta T cell function in
mycobacterial infections.
NON-TECHNICAL SUMMARY: In search for more
effective vaccines against pathogenic mycobacteria, the roles of the different
lymphocyte subsets must be better understood in order to develop stimulatory
components which lead to the most effective response by requisite subsets and,
if necessary the downregulation of subsets which are ineffective or
counterproductive. The purpose of this research is to seek answers to the
fundamental question of whether or not gamma-delta T cells respond to
mycobacterial infection by activating infected macrophages.
APPROACH: For specific
aim 1: Preliminary data from our laboratoary regarding the immune response to
subcutaneous inoculation with Map suggests substantial gamma-delta T cell
proliferation with concomitant IFN-gamma production within the draining lymph
node at post-inoculation day (PID) 60. Although not ordinarily prominent
within lymph nodes, gamma-delta T cells from the lymph node draining the site of
local infection in half of the animals in our experiements proliferated more
extensively in vitro than either CD4+ or CD8+ alpha-beta T cells from the same
lymph node. In the experiments we will examine antigen-specific
gamma-delta T cell proliferation and IFN-gamma production in vitro using
three-color flow cytometry, and we will use 5-bromo-2'-deoxyuridine (BrdU)
incorporation as a marker of cellular proliferation for immunohistochemical
studies in order to correlate our in vitro data with in vivo lymphoid changes
within the draining lymph node. For specific aim 2: Although there are
reports of gamma-delta T cell-mediated increases in macrophage TNF-alpha
production during exposure to lipopolysaccharide (LPS) and gamma-delta T cell
regulation of nitric oxide production in experimental candidiasis, there are no
published reports of macrophage activation by gamma-delta T cells during
mycobacterial infection. The function of gamma-delt T cells in the
modulation of protective immunity against mycobacteria has not been established
as beneficial, redundant, or deleterious. In our model, bacteria are
cleared from inoculation sites and draining lymph nodes before PID 60, which
suggests that proliferating gamma-delta T cells activate macrophages to
eliminate Map during early infection. To test the hypothesis that
antigen-specific gamma-delta T cells activate macrophages to upregulate
mycobactericidal activity, we will compare the in vitro ability of gamma-delta T
cells from Map-sensitized calves to activate autologous infected macrophages
with the macrophage activation capability of thawed, cryopreserved autologous
gamma-delta T cells obtained prior to experimental infection.
PROGRESS: 2003/01 TO
2003/12 We used a series of assays to test the hypothesis that gamma-delta
T cells activate infected macrophages to kill intracellular Mycobacterium
avium subsp. paratuberculosis (Map). For these experiments,
purified gamma-delta T cells were incubated with autologous Map-infected
macrophages, bacterial killing was assessed, and macrophage activation was
determined by measuring the production of bactericidal substances (nitric oxide
and reactive oxygen species). In addition, IFN-gamma (a mediator of
macrophage activation produced by gamma-delta T cells) was quantified. (1)
Incubation of Map-infected macrophages with gamma-delta T cells reduces
bacterial viability. Bacterial viability was assessed by plating dilutions
of lysed macrophage:gamma-delta T cell co-cultures onto 7H10 agar for
mycobacteria. Cultures of Map-infected macrophages incubated with
unstimulated, autologous gamma-delta T cells or antigen-stimulated autologous
gamma-delta T cells for 24 hours yielded 53.1 +/- 3.9% (mean +/- SE) and 51.5
+/- 11.8% fewer viable bacteria, respectively, compared to infected macrophages
without added gamma-delta T cells. These decreases in bacterial viability
were statistically significant. In contrast, treatment of infected
macrophages with IFN-gamma and lipopolysaccharide, a combination known to
activate macrophages, was ineffective at reducing bacterial viability. (2)
Nitrite concentrations within culture supernatants are not increased at 24 hours
in Map-infected cultures containing gamma-delta T cells. To indirectly
test for nitric oxide production, we measured nitrite levels within supernatants
of cultures of infected macrophages with and without added gamma-delta T cells.
24 hours after gamma-delta T cell transfer there were no significant
increases in nitrites in infected cultures containing added gamma-delta T cells
compared to infected macrophages alone (despite marked bacterial killing).
This finding was true of cultures from calves which had been previously
exposed to Map and from control (uninfected) calves. (3) Production of
reactive oxygen species (ROS) by Map-infected macrophages is not induced by
gamma-delta T cells. Changes in nitroblue tetrazolium (NBT) reduction were
followed by assessing the absorbance at 550 nm immediately after addition of NBT
and again 18-24 hours later. We measured the fold increases in A550 for
macrophage cultures from four animals, and in all cases, there was no
significant increase in NBT reduction by infected macrophage cultures containing
added gamma-delta T cells compared to Map-infected macrophage cultures without
added T cells. (4) gamma-delta T cells upregulate IFN-gamma production when
cultured with Map-infected macrophages. At 48 hours post-T cell transfer,
infected macrophage cultures containing unstimulated gamma-delta T cells
produced significantly greater IFN-gamma compared to infected macrophage
cultures containing no added T cells. Co-cultures containing
antigen-stimulated gamma-delta T cells also produced increased IFN-gamma, but
this increase was not statistically significant. This production of
IFN-gamma was true of calves which had been previously exposed to Map and
control (uninfected) calves.
IMPACT: 2003/01 TO
2003/12 Purified gamma-delta T cells, whether rested for 7 days or
stimulated with Map protein for 7 days, and from control or Map-inoculated
calves, markedly reduced the viability of Map in macrophage cultures. This
finding is consistent with recent studies in which gamma-delta T cells have been
shown to be bactericidal to mycobacteria in other experimental systems.
Killing of Map by gamma-delta T cells appears to be independent of nitric
oxide and reactive oxygen species, known products of macrophage activation.
PUBLICATIONS: 2003/01 TO
2003/12
No publications reported
this period
PROJECT
CONTACT:
Name: Simutis, F. J. Phone:
515-294-3282. Fax: 515-294-5423
Email:
fsimutis@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JUL 2001 TERM: 30
JUN 2003 FY: 2003
INVESTIGATOR: Jones, D. E.; Simutis, F. J.; Haynes, J. S.;
Cheville, N. F.
PERFORMING INSTITUTION: Veterinary Medicine.
SUBJECT: Gamma delta T
cell-mediated macrophage activation in Mycobacterium avium subsp.
paratuberculosis infection in the neonatal calf model.
NON-TECHNICAL
SUMMARY: Johne's disease is a chronic enteric infection of ruminants caused by
intracellular infection of macrophages with Mycobacterium avium subsp.
paratuberculosis. The purpose of this research is to assess the
ability of gamma delta T cells to activate macrophage bactericidal mechanisms in
order to kill the bacteria.
APPROACH: While studies
in knockout mice are essential for determining the contribution of g-d T cells
to the overall immune response to mycobacterial disease, studies evaluating the
in vivo and in vitro functions of g-d T cells in mycobacterial infection could
best be accomplished using an animal that normally has large numbers of g-d T
cells present and is a natural host for the disease. The bovine calf is an
exceptional model for examining the responses of g-d T cells, as neonatal
ruminants have large numbers of circulating g-d T cells, comprising as much as
75% of circulating monocytes, and preliminary data from our laboratory suggests
a role for T cells in macrophage activation and bactericidal activity during
early infection of bovine calves with M. a. ptb. We plan to test this
hypothesis by infecting neonatal calves with a virulent stain of M. a. ptb.,
isolating g-d T cells from sites of local infection, and incubating these
lymphocytes with newly-infected macrophages in vitro. We will assess the
ability of these g-d T cells to activate infected macrophages to kill
intracellular M. a. ptb., and we predict that g-d T cells will be more effective
at activating macrophage bactericidal mechanisms than are other lymphocyte
subsets. Recent work with M. avium and M. a. ptb. using g-d T cell
receptor knockout mice suggests a role for g-d T cells in recruiting lymphocytes
and neutrophils to the site of infection and in granuloma formation and
organization. For objective 2: To test this hypothesis, we will compare
the in vitro ability of g-d T cells from M. a. ptb.-sensitized calves to
activate autologous infected macrophages with the ability of naive g-d T to
activate autologous infected macrophages. We will examine antigen-specific
g-d T cell proliferation and interferon-gamma (IFN-gamma) production in vitro
using three-color flow cytometry. Previous work with this model has shown
that g-d T cell proliferation correlates with clearance of the organism from
inoculation sites and draining lymph nodes before post-inoculation day
60.
PROGRESS: 2001/07 TO
2003/06 Proliferation and IFN-gamma studies. At post-inoculation day
(PID) 60, Mycobacterium avium subsp. paratuberculosis
(Map)-inoculated calves, but not control calves, had antigen-specific lymph node
mononuclear cell (LNMC) proliferation with a trend towards increased
antigen-specific proliferation of CD4+, CD8+, and gamma-delta T cells compared
to control animals. Differences between Map-inoculated and control calves
were not statistically significant at PID 0, 7, or 14. No
statistically-significant differences in IFN-gamma production by LNMC were
detected between Map-inoculated and control calves. Macrophage function in
the presence of gamma-delta T cells. We measured different aspects of
macrophage function in order to assess their activation state in the presence
and absence of gamma-delta T cells. Macrophages were purified from
peripheral blood based on the selective adherence of monocytes to plastic
cultures plates. Gamma-delta T cells were sorted from cultures of
surgically excised lymph nodes (PID 0 and PID 60) using a magnetic-based cell
separation system. We evaluated three aspects of macrophage activation:
production of reactive oxygen species (ROS), production of reactive nitrogen
intermediates (RNI), and bactericidal activity. Nitroblue tetrazolium
(NBT) assay for ROS. In the presence of ROS, NBT is reduced to formazan, which
forms an insoluble blue deposit. Cultured macrophages in 96-well plates
are incubated in a solution containing NBT, and the change in light absorbance
at 550 nm is measured over time. Phorbol ester-activated macrophage
cultures have increased formazan deposition, and non-activated cultures have
essentially no detectable formazan conversion. In contrast to phorbol
ester-stimulated control macrophage cultures, which had rapid formazan
production within three hours, infected macrophage cultures containing
PPD-stimulated or unstimulated gamma-delta T cells did not have detectible
formazan production during the same time period. Detection of nitrites in
culture supernatants for indirect assessment of RNI. Culture supernatants
are mixed with an azo dye and a measurable color change results, the intensity
of which is proportional to the amount of nitrite present. Map-infected
macrophage cultures containing purified gamma-delta T cells do not produce
increased amounts of nitrites compared to infected macrophage cultures lacking
gamma-delta T cells. When co-cultured with uninfected macrophages,
cultures containing purified gamma-delta T cells did not produce detectible
nitrites. Bacterial viability assay. Following co-culture of
infected macrophages and gamma-delta T cells, cultures were washed in 0.1%
deoxycholate to lyse macrophages and release intracellular bacteria, diluted in
sterile saline, and plated onto 7H10 agar plates. We have observed marked
decreases (50-90%) in the number of viable Map recovered from macrophage
cultures containing gamma-delta T cells (both PPD-stimulated and unstimulated
and from Map- and saline-inoculated calves), compared to unactivated macrophage
cultures or macrophage cultures activated with IFN-gamma/LPS.
IMPACT: 2001/07 TO
2003/06 These studies support the hypothesis that gamma-delta T cell
subtypes play a role during infection of cattle with Mycobacterium avium
subsp. paratuberculosis. Results of this work contribute to our
understanding of the immune response of cattle to M. a. paratuberculosis
infection and may aid in the design of future vaccines and diagnostic protocols
for Johne's disease.
PUBLICATIONS: 2001/07 TO
2003/06
No publications reported
this period
PROJECT
CONTACT:
Name: Jones, D. E.
Phone: 515-294-4682. Fax: 515-294-5423
Email:
jonesdou@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JUL 2001 TERM: 30
JUN 2003 FY: 2001
INVESTIGATOR: Thoen, C. O.; Nilsen-Hamilton, M.
PERFORMING INSTITUTION: Veterinary Medicine.
SUBJECT: Developing a new assay for detecting
early stages of Johne's disease in cattle.
NON-TECHNICAL SUMMARY:
As of yet, there is no diagnostic test that will identify the existence of
Johne's disease before clinical signs are evident. The purpose of this
study is to develop a new assay for early detection of this disease.
APPROACH: Total RNA will
be isolated from a clinically diagnosed inflamed section of intestine of an
animal with Johne's disease. The RNA will be copied using reverse
transcriptase and a poly T primer to make cDNA. The cDNA will be amplified
by PCR using partially degenerate primers that represent segments of the NGAL
mRNA that is conserved over the species of human, mouse, rat and chicken.
The amplified fragment will be sequenced and used as a probe for
interrogating a cDNA library from inflamed bovine gut. Bovine cDNA clones
that are about 70% or more identical to the other NGALs will be compared with
each other to determine identity. Once we have obtained and verified the
sequence of the bovine NGAL cDNA, we will than develop a bacterial expression
vector for this protein. Based on these studies with the mouse, we expect
to obtain high yields of bovine NGAL that can be easily purified for the purpose
of producing antibodies.
PROGRESS: 2001/07 TO
2003/06 The investigations conducted failed to provide definitive
information for identifying infection in the tissues. However, research
findings suggest further systematic investigations are necessary to elucidate
the importance of changes detected in tissues examined.
IMPACT: 2001/07 TO
2003/06 Impact Johne's disease causes significant economic losses to
cattle producers. Early detection of cattle infected with Mycobacterium
avium ss paratuberculosis is essential to control the spread of
disease under natural condition.
PUBLICATIONS: 2001/07 TO
2003/06
No publications reported
this period
PROJECT
CONTACT:
Name: Thoen, C. O.
Phone: 515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 30 SEP 2005 TERM: 29 SEP 2006
INVESTIGATOR: Hostetter, J. M.
PERFORMING INSTITUTION: Veterinary
Medicine.
SUBJECT:
Development of flowmetrics assay.
NON-TECHNICAL SUMMARY:
Situation: Currently our ablility to accurately diagnose Johne's disease in
cattle is limited. Effective implementation of Johne’s disease control
programs will rely on more accurate diagnostic tools. Purpose: This
project will use a novel serologic assay for detection of M.
paratuberculosis infected cattle at different stages of disease. This
assay would allow differentiation of cattle infection with M.
paratuberculosis from other Mycobacterial species. OBJECTIVES: The overall
purpose of this project is to develop a sensitive, reproducible, and rapid assay
for the detection of M. paratuberculosis infection. The objective
of this proposal is to begin testing of a novel serological assay currently
under development in our laboratory. The assay we are developing utilizes
recombinant proteins cloned from either M. bovis or M. avium
paratuberculosis. Significant advantages of this approach include the
ability to multiplex the assay, the small volume of sample required, and the
ability to evaluate large numbers of samples in a short period of time.
One of the critical aspects in controlling the impact of Johne’s disease
in a herd is the ability to effectively detect infected animals and to
accurately differentiate affected animals from those exposed to other
mycobacterial species. The potential of this assay to incorporate a panel
of proteins unique for M. paratuberculosis as well as other mycobacterial
pathogens, including M. bovis and M. avium, provides the
opportunity to use serum antibodies to effectively screen cattle for exposure to
these agents. Recently, serum antibodies to M. paratuberculosis
antigens have been detected as early as two weeks post infection.
These findings demonstrate that generation of serum antibodies to M.
paratuberculosis is not limited to late in the disease course, and may have
broad diagnostic potential (25). We have two desired results from this
proposal. First, that we will be able to successfully detect M.
paratuberculosis infection in the experimentally infected animals despite
failure of commercial serum ELISA kits to detect circulating M.
paratuberculosis antibody. Second, that we will able to discriminate
M. paratuberculosis infected cattle from M. bovis infected cattle.
The outcome of this project would be the basis for a novel diagnostic
approach with increased sensitivity and specificity. The utility of this
fluorescent-based technology will allow for the simultaneous detection of as
many as 50 different antigens in a single reaction tube by use of the Luminex
100 system. The assay can be adapted to test for the presence of the agent
or host antibody to specific antigens. Because the assay can be performed
in a microtiter plate format, hundreds to thousands of samples could be
performed in a single day. We expect that such an assay would greatly
facilitate implementation of the VBJDCP through high versatility, increased
confidence of test results, and ease of testing.
PROJECT
CONTACT:
Name: Hostetter, J. M.
Phone: 515-294-3282. Fax: 515-294-5423
Email:
jesseh@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JUL 2006 TERM: 30 JUN 2007
INVESTIGATOR: Hostetter, J. M.
PERFORMING INSTITUTION: Veterinary
Medicine.
SUBJECT: Antigen
discovery: screening for immunogenic potencial of recombinant proteins derived
from Mycobacterium avium subspecies paratuberculosis.
NON-TECHNICAL SUMMARY: One of the problems in the prevention
of Johne's disease is that until a vaccine is designed that leads to reliable
protection without compromising the specificity of tuberculosis and
paratuberculosis skin testing; the use of immunization on a broad scale will
likely remain impractical. The currently approved vaccine is available
only on a limited basis and has the potential to interfere with tuberculosis and
paratuberculosis skin testing, thereby hindering its widespread application.
Implementation of an effective immunization strategy against
Mycobacterium avium subspecies paratuberculosis (M. a. ptb) in
combination with reliable diagnostic techniques would greatly enhance our
ability to control and ultimately eradicate Johne's disease.
APPROACH: Dendritic
cells are one of the initial cell types to interact with antigens at vaccination
sites and their function is essential to development of protective immune
responses. Therefore, in this objective we will screen for immunogenic
recombinant M. a. ptb proteins by identifying those that induce Th-1 polarizing
DC function. Our key approach will be to compare the ability of
recombinant M. a. ptb protein pools with a whole bacterial sonicate to induce DC
maturation and antigen presentation. Initially two overlapping protein
pools each consisting of 100 known proteins will be tested. The first pool
is composed of proteins derived from M. a. ptb surface membrane and the second
composed of proteins that are unique to M. a. ptb. Protein uptake will be
confirmed by conjugating proteins with FITC and measuring FTIC positive DC by
flow cytometry. We will determine DC maturation phenotype by measuring
expression of MHCI and MHCII by immunofluorescent labeling and flow cytometry.
We will measure gene expression of the co-stimulatory molecules CD40 and
CD80 by Q-RT-PCR. To determine cytokine profiles we will measure IL-10,
IL-12 and TNF-a production in DC culture supernatants. Using a mixed
lymphocyte reaction (MLR), we will measure DC allostimulatory activity (T cell
proliferation and IFN-. and/or IL-4 production) as a measure of antigen
presentation ability. We will measure DC allostimulatory activity (T cell
proliferation and IFN-. and/or IL. We will define Th-1 polarizing activity as DC
maturation (high CD40, CD80, MHCI, and MCHII), production of IL-12 and TNF-a,
and induction of T cell proliferation and IFN-production. With detection
of immunogenicity, individual proteins will be serially subtracted from the
pool. In this fashion it will be possible to identify individual or groups
of proteins that are strongly immunogenic. Data evaluation and controls:
For each parameter comparisons will be made for M. a. ptb recombinant protein
pools with the whole bacterial sonicate. Uptake of FITC labeled proteins
and surface marker expression (MHCI, MHCII) will be expressed as mean
fluorescent intensity of DC within gated regions. Relative mRNA
quantification (CD40, CD80) will be determined by calculating a ratio between
target mRNA in DC to medium treated DC (calibrator). The internal
reference will be beta-actin mRNA. The following calculation will be used
to determine mRNA values: Fold change = Efficiency target.Ct (calibrator -
target) / Efficiency reference.Ct (calibrator - target). All samples will
be run in triplicate. Cytokine production (IL-10, IL-12, TNF-a, IFN-.) will be
expressed as ug/ml culture supernatant. T cell proliferation will be
expressed as a proliferation index as determined by Modfit software.
Negative controls will consist of DC incubated in medium alone.
Positive controls will consist of DC infected with live M. a. ptb then
activated with LPS. It is our experience that this combination strongly
induces DC maturation and antigen presentation. Statistical analysis:
Normality and variance of the data will be assessed. PROJECT
CONTACT:
Name: Hostetter, J. M.
Phone: 515-294-3282. Fax: 515-294-5423
Email:
jesseh@iastate.edu
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JUL 2006 TERM: 30 JUN 2007
INVESTIGATOR: Thoen, C. O.
PERFORMING INSTITUTION: Veterinary
Medicine.
SUBJECT:
Evaluation of reduced dosege [sic] of Mycopar (Mycobacterium
paratuberculosis-heat killed cells in oil) for use to vaccinate calves in John
[sic] Johne’s.
NON-TECHNICAL SUMMARY: Johne's disease is
widespread in dairy and beef herds in the
PROJECT
CONTACT:
Name: Thoen, C. O. Phone:
515-294-7608. Fax: 515-294-8500
Email:
cthoen@iastate.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 2001
TERM: 30 SEP 2002 FY: 2002
INVESTIGATOR: Elzer, P. H.; Snider, T. R.;
Enright, F. M.; Hoyt, P. G.; Roberts, C. S.
PERFORMING INSTITUTION:
PATHOBIOLOGICAL SCIENCES.
SUBJECT: Development of Johne's disease in
cattle.
NON-TECHNICAL SUMMARY: When cattle are
experimentally exposed to M. avium paratuberculosis, it may take from
five months to ten years (most often two to three years) before the clinical
symptoms associated with Johne's Disease are observed. The goal of this
project is to develop a research model for Johne's Disease in newborn calves.
APPROACH: Twenty-one
pregnant cattle will be obtained from a Johne's Disease-free herd. The
pregnant adults will be monitored until parturition. Within 12 to 18 hours after
birth (prior to closure of intestine), the calves will be weighed and orally
inoculated with 15-25 x 10e9 colony forming units (CFUs) of virulent
Mycobacterium avium paratuberculosis or 1ml of sterile saline.
Following inoculation, the animals will be monitored daily for evidence of
lethargy, diarrhea, anorexia, or any other clinical abnormalities. Once a
week, rectal temperature and weights will be recorded. When clinical symptoms
develop, rectal temperature will be taken on a daily basis. Fecal samples
will also be collected weekly for bacterial culture for the first month and then
monthly afterwards. A group of seven animals, five infected and two controls,
will be humanely euthanized at nine, 12 and 18 months post-inoculation. A
complete necropsy will be performed and samples obtained from the stomach,
duodenum, jejunum, ilieum, cecum, colon, mesenteric lymph nodes, internal iliac
lymph nodes, liver, spleen, heart, lung, and brain. Blood will also be
collected at the time of necropsy. Samples from the gastrointestinal tract and
mesenteric lymph nodes will be submitted for bacterial culture and polymerase
chain reaction (PCR) analysis. Sections from each organ will be fixed in
10% buffered formalin for histopathologic and ultrastructural
evaluation.
PROGRESS: 2001/10 TO
2002/09 Mycobacterium avium paratuberculosis (MAP) is the causative
agent of Johne's Disease in cattle. The purpose of this project was to
infect newborn calves with MAP imediately after birth (prior to closure) to
facilitate infection of the calves. Previous studies to date have used
calves between 3-30 days of age and have had negative results (no detectable
infection). Another novel variable added to this experiment is that some
of the groups received mycobactin, a compound which enhances the growth of MAP
at the time of infection. Presently 5 calves are infected with MAP alone,
4 with MAP + mycobactin and 3 with saline. At 2, 4 and 6 months post
infection, the calves will be necopsied and tissues will be collected for MAP
culture and confirmation via histopahtology.
IMPACT: 2001/10 TO
2002/09 Once a research model for Johne's Disease in newborn Bovidae is
established, the model can be used to test various vaccine canidates.
These vaccine candidates can be used to enhance herd health immunity
against M. avium paratuberculosis, the causitive agent in Johne's Disease in
cattle.
PUBLICATIONS: 2001/10 TO
2002/09
No publications reported
this period
PROJECT
CONTACT:
Name: Elzer, P. H.
Phone: 225-578-4763. Fax: 225-578-4890
Email:
pelzer@agctr.lsu.edu
PROJ
TYPE:
SMALL BUSINESS GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2001-33610-10347 PROPOSAL NO:
2001-00161
START: 15 MAY 2001 TERM: 30 NOV 2002 GRANT YR: 2001 GRANT AMT:
$70,000
INVESTIGATOR: Crabb, J. H.
PERFORMING INSTITUTION:
Immuncell Corporation.
SUBJECT: Immunomagnetic separation assay for
Mycobacterium paratuberculosis.
NON-TECHNICAL SUMMARY: Current
testing for M. paratuberculosis in stool samples requires extensive
sample preparation, including disinfection steps that reduce the sensitivity of
culture. PCR testing of stool samples is hampered by inhibitors of the reaction
present in stool. The proposed IMS sample preparation method would provide
increased sample throughput as well as enhanced sensitivity of detection by
replacing the harsh sample preparation steps with a gentle, immune capture step
to isolate the bacteria prior to culture or PCR.
APPROACH: See
Objectives.
PROJECT
CONTACT:
Name: Crabb, J. H.
Phone: 207-878-2770. Fax: 207-878-2117
Email:
jhcrabb@aol.com
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 01 AUG 2003 TERM: 31
DEC 2005 FY: 2005
INVESTIGATOR: Coussens, P. M.; Grooms, D.; Bolin, C.;
Bolin, S.; Kuipel, M.;
PERFORMING INSTITUTION: Animal Science. Michigan State Univ.
East Lansing,
NON-TECHNICAL SUMMARY: Johne's disease is a major
concern in the
OBJECTIVES: Our
long-term objective relevant to the current project is to elucidate the complex
interplay of immune cells and modulators that lead to peripheral and local
immune responses in cattle infected with Mycobacterium avium
subspecies paratuberculosis (MAP), the causative agent of Johne's disease
in cattle. Based on existing literature and preliminary results, one of
our primary hypotheses is that MAP-specific and general immune suppression
observed in clinically infected animals is at least partly due to specific
suppressor cell populations that arise during the long subclinical phase of
infection. Specific Objectives (1) Correlate MAP stimulated changes in
immune cell gene expression with immune cell population profiles using
peripheral blood mononuclear cells (PBMCs) from cattle representing subclinical
and clinical stages of MAP infection. (2) Test the hypothesis that
specific immune cell types are responsible for repressed gene expression in
PBMCs from clinical Johne's disease cows in response to MAP. (3) Correlate
and contrast observations from peripheral immune cells with infected intestinal
tissue and mesenteric lymph nodes from the same animals used in Objectives 1 and
2. (4) Investigate interactions between MAP and bovine macrophages that
lead to presistence of MAP in a cell designed to kill invading pathogens.
APPROACH: One hypothesis
to explain gene expression differences between immune cells from Johne’s disease
positive and control cows is that immune cell populations in infected and
control cows are initially different. A second, equally valid hypothesis
is that MAP induces apoptosis in specific immune cell subsets thus leading to
lower gene expression relative to controls. To test and distinguish
between these hypotheses, we will conduct a series of experiments comparing
responses of PBMCs from infected and control cows to MAP, in which gene
expression profiles are linked to cell distribution, measures of apoptosis, and
immune cell proliferation. We will also address the hypothesis that a
particular immune cell type is responsible for quenching a rapid and vigorous
response to MAP. To test this hypothesis, we will use immunomagnetic
separation with cell-type specific antibodies, removing specific cell types from
PBMCs. We will focus on the use of quantitative reverse transcriptase
real-time polymerase chain reaction (Q-RT-PCR). We will also examine
differences between intestinal tissues and mesenteric lymph nodes from Johne's
disease positive cows and similar tissues from control uninfected cows.
One specific hypothesis is that overexpression of IL-1 and TRAF 1 in
clinical Johne’s disease has allowed cells in the intestinal lumen and
mesenteric lymph nodes to adopt a survival phenotype by preventing apoptosis.
A second hypothesis to be tested is that, despite an apparent Th 2-like
peripheral response in clinical cows, local sites and nodes from infected
tissues retain a strong pro-inflammatory pattern of gene expression. Data
needed to test our specific hypotheses will be acquired using both Q-RT-PCR and
cDNA microarray analysis. We will extend our preliminary results to a
larger pool of Johne’s disease positive cows and compare expression of key genes
between control, subclinical, and clinical infected animals. In addition,
we will add a comparison of expression in mesenteric lymph nodes, not included
in our original analysis. Inhibition of phagosome-lysosome fusion by
Mycobacteria appears to have two main components. These components are: 1)
preventing the phagosome from maturing into a phagolysosome through interruption
of protein expression and/or trafficking and 2) avoidance of normal signaling
through the Toll-like receptor (TLR) pathway. Specific Objective 4 will
address the first component by directly examining phagosomes in macrophages
following phagocytosis of latex beads and E. coli and two
Mycobacterium species. Resting macrophages are used as a control in
these studies, allowing us to also identify changes in gene expression and
protein trafficking during the general processes of phagocytosis and
activation.
PROGRESS: 2003/08 TO
2005/12 Our work during the past 12 months has focused on examining the
effects of M. paratuberculosis on cultured bovine macrophages.
These studies were initiated because of prior results that showed M.
paratuberculosis infected macrophages at sites of infection have
dramatically enhanced levels of IL-1alpha and TRAF1 protein expression.
TRAF1 is a member of a protein family that is intricately involved in
intracellular signaling, including activation of macrophages following contact
with cytokines or activated T cells. One hypothesis is that high levels of
TRAF1 would inhibit signaling through TNF receptor superfamily members,
including TNFR1, Fas, and TNFR2. We have now demonstrated that in cultured
macrophages, infection of cells with M. paratuberculosis indeed
upregulates IL-1alpha and TRAF1 expression and that TRAF1 expression is
dependent upon continued release of IL-1alpha. These results suggest that
drives high expression of TRAF1 in lesions from cattle with Johne’s disease is
likely driven by IL-1alpha. Importantly, uninfected macrophages newly
recruited to sites of infection would be exposed to high levels of IL-1alpha and
may thus be deficient in activation and signaling of T cells. These
studies will be continued under a recently warded USDA-NRI grant and designated
as project number MICLO8369.
IMPACT: 2003/08 TO
2005/12 Results from this project suggested that M. paratuberculosis
has profound effects on gene expression and possibly on intracellular
signaling in infected macrophages. In addition, our results provided a
foundation for understanding how M. paratuberculosis might interfere with
the ability of macrophages to interact with T cells and to become activated
following these interactons.
PUBLICATIONS: 2003/08 TO
2005/12
1. Aho, A.D., McNulty,
A.M., and P.M. Coussens. (2003). Enhanced Expression of IL-1? and TRAF 1 in
ileal tissues of cattle infected with Mycobacterium
paratuberculosis. Infection and
Immunity, 71(11), 6479-6486.
2. Coussens, P.M.,
4. Coussens, P.M. 2004.
A model for immune responses to Mycobacterium paratuberculosis.
Infection and Immunity (Mini reviews), 72: 3089-3096.
PROJECT
CONTACT:
Name: Coussens, P. M.
Phone: 517-353-3158. Fax: 517-353-1699
Email:
coussens@msu.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 DEC 1998 TERM: 30
NOV 2003 FY: 2005
INVESTIGATOR: Lloyd, J.; Peterson, C.; Harsh, S.
PERFORMING INSTITUTION: Agricultural Economics. Michigan State
Univ. East Lansing,
SUBJECT:
Strategic management in agribusiness using key performance indicators.
OBJECTIVES: The
objectives of this research are: 1)to define the awareness of, attitudes toward,
and levels of adoption for formal strategic management in both the Michigan
dairy industry and the veterinary profession, and 2) to identify the key
performance indicators (KPI's) that are most useful for managing dairy farms and
veterinary practices in a strategic management framework, based on firm-specific
goals and objectives.
APPROACH: Preliminary
data on both strategic management and KPIs will be collected through individual
focus group meetings for dairy producers and practicing veterinarians.
Case studies of individual dairy farms and veterinary practices will also
be employed to provide descriptive information on how to implement various
strategic managment practices in real time. Subsequently, surveys will be
conducted to quantify the findings from the focus groups for both dairy
producers and practicing veterinarians. Collaborations will be developed
with ongoing studies of both the dairy industry and the veternary profession to
determine the strength of any potential correlation between strategic management
and firm performance. Beyond these econometric studies, computer models
will be developed for both dairy farms and veterinary practices to evaluate
potential changes in tactics for their possible impact on the KPIs of individual
agribusinesses.
PROGRESS: 1998/12 TO
2003/11 The objectives of this research project were: 1) to define the
awareness of attitudes toward, and levels of adoption for formal strategic
management in both the Michigan dairy industry and the veterinary profession,
and 2) to identify the key performance indicators (KPIs) that are most useful
for managing dairy farms and veterinary practices in a strategic management
framework, based on firm-specific goals and objectives. As this project
evolved over the course of its lifetime, the scope of work changed somewhat from
the original intent. During early consideration of strategic management in
both the
PUBLICATIONS: 1998/12 TO
2003/11
No publications reported
this period
PROJ
TYPE:
STATE PROJ STATUS: REVISED
START: 01 OCT 2005 TERM: 30 SEP
2010 FY: 2005
INVESTIGATOR: Coussens, P. M.; Kuipel, M.
PERFORMING
INSTITUTION: Animal Science. Michigan State Univ.
SUBJECT: Immune modulation and
gene expression signatures associated with infection of cattle with M.
partuberculosis.
NON-TECHNICAL SUMMARY: A. Johne's disease, caused
by M. paratuberculosis, is one of the most costly infectious disease
problems in the
PROGRESS: 2005/01 TO
2005/12 We have completed running 15 BOTL-5 microarrays where gene
expression patterns in total leukocytes of cattle infected with M.
paratuberculosis (MAP) are compared to patterns from total leukocytes from
control healthy cattle. This data has been normalized and analyzed to
reveal an initial gene expression pattern or signature associated with MAP
infection. Portions of this study have been published by our laboratory
and by our Danish collaborators. We have identified 5 dairy herds where
the MAP infection status of each cow is known and have begun collecting samples
from these cows. In each case, serum ELISA and IFN-gamma response is
re-checked and tracked along with any fecal culture results obtained previously.
Samples are coded by herd and animal number for future reference and
correlation estimates. For each cow, RNA has been prepared from
approximately 5 X 10E9 total leukocytes and has been stored prior to Q-RT-PCR
analysis. For signature validation, we have selected 45 genes from the
microarray results and 3 control genes (beta-actin, GAPDH, and RPL-19).
Primers have been desined fo ra subset of these and primer validation is
in progress. Ultimately, we will use 150 infected cows and 50 controls in
the validation study.
IMPACT: 2005/01 TO
2005/12 Results of this project will provide a host (cattle) gene
expression signature diagnostic for infection with M. paratuberculosis
(Johne’s disease). It will be possible to design a simple and rapid test
based on quantitative real time PCR of total blood leukocytes diagnostic for
M. paratuberculosis infection. Additional knowkledge about the
immune response to M. paratuberculosis infection in cattle will aid
vaccine development efforts.
PUBLICATIONS: 2005/01 TO
2005/12
1. Coussens, P.M., C. B.
Pudrith, X. Ren, S. P. Suchyta, J. R. Stabel, K. Skovgaard, and P. M.H.
Heegaard. 2005. Johne’s disease in cattle is associated with enhanced
expression of genes encoding IL-5, GATA-3, tissue inhibitors of matrix
metalloproteinases 1 and 2, and factors promoting apoptosis in peripheral blood
mononuclear cells. Veterinary Immunology and Immunopathology. 105:
221-234.
2. K. Skovgaard, C.B.
Pudrith, P.M.H. Heegaard, S. Nedergaard-Grell, G. Jungersen1, and P.M. Coussens.
2005. Differential expression of genes encoding CD30L and P-selectin in
cattle with Johne’s disease: Progress toward a diagnostic gene expression
signature. Veterinary Immunology and Immunopathology, In
Press.
PROJECT
CONTACT:
Name: Coussens, P. M.
Phone: 517-353-3158. Fax: 517-353-1699
Email:
coussens@msu.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 2000
TERM: 30 SEP 2005 FY: 2005
INVESTIGATOR: Coussens, P.;
PERFORMING INSTITUTION: Animal
Science. Michigan State Univ. East Lansing,
SUBJECT: Dynamics of immune responses
to Johne's disease in infected and vaccinated calves.
NON-TECHNICAL
SUMMARY: Johne's disease is a chronic infection in cattle that is untreatable
with conventional antibiotics and ultimately leads to death. The immune
response to M. paratuberculosis, the causative agent of Johne's disease,
is poorly understood, though recent progress has begun to define parameters that
might affect the susceptability of various animals to disease. This
project will help to further define the response of cattle to infection with
M. paratuberculosis. This information [sic] is critical to control
programs and development of successful vaccines.
APPROACH:
PUBLICATIONS: 2000/10 TO
2005/09
1. Coussens, P. M.,
(2001). Interactions between Mycobacterium paratuberculosis and the
bovine immune system, Animal Health Research Reviews 2,
141-161.
2.
4. Coussens, P.M., C.J.
Colvin, K. Wiersma, A. Abouzied, and S. Sipkovsky (2002). Gene expression
rofiling of peripheral blood mononuclear cells from cattle infected with M.
paratuberculosis. Infection and Immunity 70:
5494-5502.
5. Coussens, P.M,
Colvin, C.H.,
7. Coussens, P.M., A.
Jeffers, and C.J. Colvin. (2003). Rapid and transient activation of gene
expression in peripheral blood mononuclear cells of Johne’s disease positive
cows exposed to Mycobacterium paratuberculosis in vitro. Microbial
Pathogenesis. 36(2):93-108
8. Coussens, P.M.,
10. Coussens, P.M., C.
B. Pudrith, X. Ren, S. P. Suchyta, J. R. Stabel, K. Skovgaard, and P. M.H.
Heegaard. 2005. Johne’s disease in cattle is associated with enhanced
expression of genes encoding IL-5, GATA-3, tissue inhibitors of matrix
metalloproteinases 1 and 2, and factors promoting apoptosis in peripheral blood
mononuclear cells. Veterinary Immunology and Immunopathology. 105:
221-234.
PROJECT
CONTACT:
Name: Coussens, P. M.
Phone: 517-353-3158. Fax: 517-353-1699
Email:
coussens@msu.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 2001-34427-10444 PROPOSAL NO: 2001-03570
START: 01 JUL 2001 TERM: 30 JUN 2004 FY: 2004 GRANT YR: 2001 GRANT AMT:
$303,339
INVESTIGATOR: Kaneene, J. B.; Fitzgerald, S. D.; Bartlett, P. C.;
Griffore, F.; Bolin, S.; Bolin, C.
PERFORMING INSTITUTION:
SUBJECT: Epidemiology and risk analysis of
Mycobacterium bovis in wild and domestic animals in
NON-TECHNICAL SUMMARY: Bovine
tuberculosis (TB) in
APPROACH: Objective 1: A
retrospective epidemiological study will examine the association between M.
bovis infection and physical landscape factors. Environmental samples
will be taken from livestock operations with confirmed M. bovis
infections and processed for bacterial isolation, identification, and typing.
A cross-sectional study will identify different wildlife species with
bovine TB, determine the most likely routes of infection for each species, and
estimate the potential of each species to be hosts for M. bovis by
describing pathogenicity and assessing the possibility of shedding through
different routes. A retrospective epidemiological analysis will be
conducted to examine the association between the occurrence of M. bovis
on farms with M. bovis in deer, deer-related supplemental feeding, and
physical landscape factors. Objective 2: A stochastic simulation model,
using cattle herd factors, deer factors, deer feeding factors, and land use
factors, will be developed to estimate the risk of a dairy or beef cattle herd
developing TB infection in a year. Objective 3: From dairy herds in the
Michigan Johne's Control Program, three herds will be selected: one high
prevalence herd (> 15%); one low prevalence herd (< 2%); and one
Johne's-free herd. Each animal will receive a bovine TB caudal fold test,
comparative cervical test, and gamma-interferon tests, and TB test results will
be compared by Johne's disease status. Objective 4: A database and data
entry template for infected
1. Dunn, J.R., Kaneene,
J.B., Grooms, D.L., Bolin, S.R., Bolin, C.A., Bruning-Fann, C.S. Testing
positive for Mycobacterium avium subsp. paratuberculosis and the
lack of significant effect on the caudal fold tuberculin (CFT) and gamma
interferon tests for bovine tuberculosis. Am J Vet Res, accepted for
publication 2004.
2. Fitzgerald, S.D.,
Boland, K.G., Clarke, K.R., Wismer, A., Kaneene, J.B., Berry, D.E., Church,
S.V., Hattey, J.A., C.A. Bolin. Experimental inoculation of mallard ducks
(Anas platyrhynchos) with Mycobacterium bovis. Avian
Dis. submitted 2004.
3. Griffore, R.,
Phenice, L. The impact of bovine TB on the farm family ecosystem. In
preparation for submission to Family Relations, 2004.
4. Griffore, R.,
Phenice, L; Kaneene, J.B. Veterinarians: A complex role of mediation
between the state and farm families. In preparation for submission to
Journal of the American Veterinary Medical Association,
2004.
5.
Miller, R., Kaneene, J.B., Schmitt, S.M., Lusch, D.P., Fitzgerald, S.D.
Geographic distribution and spatial analysis of Mycobacterium bovis
infection in white-tailed deer (Odocoileus virginianus) in Michigan.
Prev Vet Med. accepted 2004.
6. Norby, B., Bartlett,
P.C., Fitzgerald, S.D., Granger, L., Bruning-Fann, C., Whipple, D.L., J.B.
Payeur. The sensitivity of gross necropsy, caudal fold and comparative
cervical tests for the diagnosis of bovine tuberculosis. J Vet Diagn
Invest. 16:126-131, 2004.
7. Norby, B., Bartlett,
P.C., Grooms, D.L., Kaneene, J.B., Bruning-Fann, C.S. Herd-level sensitivity,
specificity, and predictive values of bovine tuberculosis skin tests in
Michigan. Am J Vet Res. submitted 2004.
8. Norby, B. Tempelman,
R.J., Hansonc, T.E., Kaneene, J.B., Bartlett, P.C. Estimation of sensitivity
and specificity of bovine tuberculosis skin tests in Michigan when a perfect
reference test is not available. Prev Vet Med. submitted
2004.
9.
O'Brien, D.J., Schmitt, S.M., Berry, D.E., Fitzgerald, S.D., Vanneste, J.R.,
Lyon, T.J., Church, S.V., Fierke, J.S., Schooley, A.M., Cooley, T.M., Magsig,
D., Zwick, L., and B.V. Thomsen: Estimating the true prevalence of M.
bovis in hunter-harvested white-tailed deer in Michigan. J Wildl
Dis. 40:42-52, 2004.
PROJECT
CONTACT:
Name: Kaneene, J. B.
Phone: 517-353-5941. Fax: 517-432-0976
Email:
kaneene@cvm.msu.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 2002-34427-11829 PROPOSAL NO:
2002-06051
START: 01 SEP 2002 TERM: 31 AUG 2004 FY: 2005 GRANT YR: 2002
GRANT AMT: $297,445
INVESTIGATOR: Kaneene, J. B.; Fitzgerald, D. D.; Bolin,
S. R.; Bartlett, P. C.; Bolin, C. A.
PERFORMING INSTITUTION:
SUBJECT: Bovine tuberculosis:
epidemiology, diagnosis, and pathogenesis.
NON-TECHNICAL SUMMARY:
Since bovine TB control programs for livestock have significant costs, there is
a need to improve the performance of these programs. The proposed research
will evaluate the costs of current TB control programs, the reliability of TB
tests being used, and factors that influence the effectiveness of these
programs. In addition, the study will try to identify new, more efficient
methods of identifying bovine TB in cattle.
OBJECTIVES: There are six
projects with specific objectives: Project 1 Objective: to develop a predictive
risk assessment model, combining epidemiological and economic risk factors, for
the effects of bovine TB infection on the Michigan cattle industry; Project 2
Objectives: 1) determine the sensitivity, specificity and predictive values and
reliability of the CFT and the gamma-interferon blood test in Johne's-positive
cattle herds, using the comparative cervical skin test (CCT) and mycobacterial
culture for validation; 2) compare results of the CFT from Johne's-positive
cattle with results from Johne's-negative cattle, using the CCT and
mycobacterial culture for validation; and 3) to determine if cattle with
advanced Johne's Disease are immunologically competent to respond appropriately
to M. bovis antigens; Project 3 Objectives: 1) study the relative
susceptibility of wild-type rodents to oral inoculation with M. bovis; 2)
attempt to isolate M. bovis from inoculated rodents through fecal culture
at multiple times post-inoculation, and from various organs at necropsy; 3)
evaluate various tissues microscopically at multiple times post-inoculation to
understand the pathogenesis of M. bovis in these rodents; and 4) evaluate
rodents for the threat they pose in re-introduction of M. bovis to cattle
farms, and their potential as sentinel species for infection on farms; Project 4
Objectives: 1) construct probability distributions of the prevalence of bovine
TB in different sub-populations of Michigan domestic ruminants; 2) construct
probability distributions of the false and true positives and false and true
negatives resulting from the current serial testing (CFT/CCT) program in
Michigan; and 3) estimate the rates of human injuries and deaths suffered during
the bovine TB testing program in Michigan; Project 5 Objectives: 1) identify
altered gene expression for bovine cytokines in cattle sensitized to M.
bovis, using lymphocytes stimulated in vitro with purified protein
derivative (PPD) from M. bovis or M. avium; and 2) identify
additional genes from bovine lymphocytes that show altered expression
attributable to exposure with M. bovis, using a cDNA microarray made from
bovine lymphocytes and mRNA from lymphocytes stimulated in vitro with PPD from
M. bovis or M. avium.
APPROACH: Project 1: Herd-based risk
assessment models and models of TB in wild white-tailed deer in northeastern
Michigan will be used to develop industry-level predictive models of levels of
TB and its economic consequences to the state's cattle industry, so that the
impact of herd-level or industry-level TB control measures, and their attendant
costs, can be projected over periods of time and be used to determine which
measures would be most efficient and cost-effective for the industry.
Project 2: Objectives 1 & 2: To test effect of Johne's Disease (JD) on
the caudal fold and comparative cervical skin tests and the gamma-interferon
test for Mycobacterium bovis, cattle from dairy herds with no/low/high
levels of JD will have TB skin tests administered. Blood and fecal samples
will be collected to compare animal JD status (by fecal culture, ELISA and
gamma-interferon for M. paratuberculosis) with results of TB skin tests
and gamma-interferon testing. Objective 3: TB-negative cattle with and
without JD will be injected with killed M. bovis antigen in a dose
response study to compare the immune response of cattle with and without JD to
respond to the M. bovis antigen. Project 3:
PROGRESS: 2002/09 TO 2004/08 Project 1: A stochastic risk
assessment model for herd TB status was developed, based on results from a
case-control study to identify herd management factors and environmental
conditions associated with TB status. A method to examine trade-offs
between expected benefits and expected costs of biosecurity management practices
and investments was developed. The model is being updated with additional
data from over 10 new TB-positive herds, and is being implemented in a form for
on-farm use. Project 2: A prospective study was designed to determine if
cattle infected with Mycobacterium avium subsp. paratuberculosis
(JD) have a higher proportion of false positive caudal fold tuberculin test
(CFT) results for TB when compared to uninfected cattle. Blood and fecal
samples from 1043 cattle were subjected to M. bovis and M. avium
gamma-interferon (INF-gamma) and JD antibody ELISA testing, and fecal culture.
The overall false positive rate on the CFT was 17%. The high
(>15%) and low (<15%) prevalence herds averaged 21 and 14% positive on the
CFT, respectively, and 32 and 19% of JD positive (+) cows from high and low
prevalence herds, respectively, were CFT positive. These results indicate
an association between JD disease and false positive CFT. Project 3: The
experimental infection study of wild house mice was completed, and mice were
found to be highly susceptible to M. bovis and may pose a real threat to
infected farms that are depopulated and later repopulated. The final
analysis, combining results of several studies, shows that voles were the most
susceptible to infection, mice were highly susceptible, and rats being highly
resistant to both infection and shedding. A manuscript for publication
comparing and summarizing these findings is in preparation. Project 4:
The sensitivities of the CFT, CFT and comparative cervical tests (CCT) in
series, and gross necropsy were 93, 88, and 86%, respectively.
Sensitivities of skin tests were slightly higher when at least 2 lesions
were found at gross necropsy. If 1 TB+ animal is enough to declare a herd
TB+ and the tests used to classify a single animal as TB+ has a specificity of
1.0, the herd level performance of the TB skin tests in
IMPACT: 2002/09 TO 2004/08 Control and eradication of TB from
the Michigan livestock industry requires an understanding of the disease and how
it spreads, efficient disease detection methods, and the development of tools
for control of the disease at the farm level. Risk assessment models can
be used to develop sound, cost-effective disease control programs. The
reliability of the caudal fold skin test, used for TB testing in livestock, may
be affected by an animal's disease or vaccination status. These factors
should be taken into consideration when interpreting TB skin test results, or
designing a TB surveillance program. Current TB tests require great time,
effort and expense, and false results are common with existing skin and blood
tests. Even with TB lesions, many times associated with acid-fast bacilli,
bacteria cannot be cultured because of poor samples, freeze-thaw, or lack of
available fresh tissues. New DNA-based testing methods (cDNA microarray
analysis of gene expression and laser-capture microscopy for isolating DNA for
PCR) have the potential to become rapid, sensitive methods to identify TB in
tissue samples in an efficient and reliable way. Determining what wildlife
species can serve as reservoirs of M. bovis is fundamental to
understanding the epidemiology of TB, which is necessary to develop effective
disease eradication programs
PUBLICATIONS: 2002/09 TO
2004/08
PROJECT
CONTACT:
Name: Kaneene, J. B.
Phone: 517-353-5941. Fax: 517-432-0976
Email:
kaneene@cvm.msu.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT
NO: 2003-34427-13292 PROPOSAL NO: 2003-06030
START: 01 JUL 2003 TERM: 30 JUN
2006 FY: 2005 GRANT YR: 2003 GRANT AMT: $323,193
INVESTIGATOR: Kaneene, J.
B.; Fitzgerald, S. D.; Grooms, D.; Bolin, S. R.; Bolin, C. A.; Wolf, C. A.;
Fine, A.
PERFORMING INSTITUTION: Large Animal Clinical Sciences.
Michigan State Univ.
SUBJECT: Bovine tuberculosis: epidemiology, diagnosis, and
pathogenesis.
NON-TECHNICAL SUMMARY: Since bovine TB control
programs for livestock have significant costs, there is a need to improve the
performance of these programs. The proposed research will evaluate the
costs of current TB control programs, the reliability of TB tests being used,
and factors that influence the effectiveness of these programs. In
addition, the study will try to identify new, more efficient methods of
identifying bovine TB in cattle.
PROGRESS: 2005/01 TO
2005/12 Project 1: The test version of a user-friendly software package to
predict herd risk for TB, identify conditions on the farm associated with
increasing TB risk, and estimate the economic costs associated with changing
management practices identified as contributing to the herd risk for TB for
on-farm use has been completed and is undergoing field-testing. A
predictive risk assessment model for a cattle herd becoming reinfected with TB
after depopulation is being developed. Project 2: Field work for this
project was completed in August 2005. 2 groups of 20 cattle were injected with
sensitinogen, and then vaccinated with commercially available modified
live-virus (BVDV, bovine herpesvirus 1, BRSV, parainfluenza virus) or
inactivated Leptospira interrogans serovar hardjo vaccines. At 72 hrs
post-vaccination, the CFT test was administered and blood obtained for the whole
blood gamma interferon assay. Results indicate that CFT response was
reduced but not eliminated after vaccination. The gamma interferon
response was reduced but not eliminated if blood was stimulated within 2 hrs of
collection. Shipping conditions and time had a negative effect on the
gamma interferon response. Project 3: Results of cDNA microarray analysis
on white blood cells from cattle infected with M. avium ssp.
paratuberculosis were used to guide selection of gene targets for
quantitative PCR. Blood was obtained from 5 CCT suspect/reactor cattle, 2
TB+ cattle, and 1 cow sensitized to M. bovis. Considerable
variation in altered gene expression was noted following stimulation with
antigen, and work is continuing. DNA extraction and PCR techniques for
detection of mycobacteria in known TB+ animal tissues have been standardized and
were used on formalin-fixed paraffin-embedded tissues from 198 cattle.
These techniques were successful for mycobacteria that have established
methods (M. avium, M. avium ssp. paratuberculosis), and
methods for M. bovis are currently being developed. Project 4:
Methods for processing environmental samples for M. bovis isolation have
been established and validation studies indicate that these methods are capable
of detecting small numbers of M. bovis. M. bovis was not
widely distributed or present in large numbers in environmental substrates
collected on TB-affected cattle farms, and has not be isolated from any samples
(soil, water, feed) collected from 11 TB-affected cattle farms and 4 wildlife
areas with known TB. Molecular techniques are planned to study any
isolates found. Preliminary data from a study designed to determine the
effect of substrate type (water, soil, hay, grain) and environmental conditions
(humidity, temperature, sunlight) on the persistence of viable M. bovis
bacteria in the environment suggest that viable M. bovis can persist for
4 weeks. Data indicate that M. bovis can survive in environmental
substrates for sufficient lengths of time to serve as a source of infection for
cattle and/or wild deer. Mallard ducks are highly resistant to oral
infection with TB, and do not shed the organism in feces. This continues a
series of experimental studies in wild birds, and papers covering this research
have been published.
IMPACT: 2005/01 TO
2005/12 Control and eradication of TB from the Michigan livestock industry
requires an understanding of the disease and how it spreads, efficient disease
detection methods, and the development of tools for control of the disease at
the farm level. Risk assessment models can be used to develop sound,
cost-effective disease control programs. The reliability of the caudal
fold skin test, used for TB testing in livestock, may be affected by animal
disease or vaccination status. These factors should be taken into
consideration when interpreting TB skin test results, or designing a TB
surveillance program. Current TB tests require great time, effort and
expense, and false results are common with existing skin and blood tests.
Even with TB lesions, many times associated with acid-fast bacilli,
bacteria cannot be cultured because of poor samples, freeze-thaw, or lack of
available fresh tissues. New DNA-based testing methods (cDNA microarray
analysis of gene expression and laser-capture microscopy for isolating DNA for
PCR) have the potential to become rapid, sensitive methods to identify TB in
tissue samples in an efficient and reliable way. Determining where in the
environment and ecosystem M. bovis exists, and the length of time it
survives and remains infective, is fundamental to understanding the epidemiology
of TB, which is necessary to develop effective disease eradication programs.
Experiments have shown that some wild bird species may contribution to the
maintenance and spread of TB in wildlife and livestock.
PUBLICATIONS: 2005/01 TO
2005/12
Fitzgerald,
Name: Kaneene, J. B.
Phone: 517-353-5941. Fax: 517-432-0976
Email:
kaneene@cvm.msu.edu
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO:
2004-34427-14585 PROPOSAL NO: 2004-06033
START: 01 SEP 2004 TERM: 31 AUG
2006 FY: 2005 GRANT YR: 2004 GRANT AMT: $288,804
INVESTIGATOR: Kaneene, J.
B.; Fitzgerald, S. D.; Bolin, S. R.; Grooms, D. L.; Bolin, C. A.
PERFORMING
INSTITUTION: Large Animal Clinical Sciences. Michigan State Univ.
SUBJECT:
Bovine tuberculosis: epidemiology, diagnosis, and pathogenesis.
NON-TECHNICAL SUMMARY: Since bovine TB control and prevention
programs for livestock have significant costs, there is a need to improve the
performance of these programs. The proposed research will evaluate current
TB control and prevention programs, the reliability of TB tests being used,
factors that influence the effectiveness of these tests and programs, and the
efficacy of two TB vaccines for animals.
PROGRESS: 2005/01 TO
2005/12 Project 1: Data for assessment of spatial relationships between
risk for reacquiring TB and proximity to other herds affected by TB, deer
habitat, surface water features, and other ecological features in the region
have been updated and incorporated into the predictive risk assessment model for
a cattle herd becoming reinfected with TB. Updated information on data
from newly infected cattle herds (biosecurity, cattle movement to and from
affected herds, cattle feeding practices, cattle housing, and wildlife access to
livestock and livestock feed) and additional retrospective data collection are
being used to refine the existing predictive model. Project 2: Dairy
cattle with Johne's disease (n = 7) and age matched healthy controls (n = 9)
were administered Sensitinogen and tested for tuberculosis using the caudal fold
skin test and the whole blood gamma interferon assay. This study started
in 2005 and will continue through 2006. The number of cattle in the study
to date is small, but the data suggests that Johne’s Disease may diminish the
caudal fold response and cause false negative results in the whole blood gamma
interferon assay. Project 3: Whole blood was harvested from 9 cattle
that were false positive reactors in the caudal fold skin test and the whole
blood gamma interferon assay, and from 4 cattle that had bovine tuberculosis.
The whole cell RNA was extracted from partially purified white blood
cells, processed to remove contaminants, and used in microarray experiments to
evaluate effect of stimulation of blood with purified protein derivative from
Mycobacterium bovis or with phosphate buffered saline solution. The
effects of stimulation was assessed by monitoring changes in expression of
greater than 1,000 genes associated with white blood cells of cattle. The
data has been normalized and is ready for statistical evaluation. This
work will be assigned to a graduate student as part of a Ph.D. project.
Project 4: BALBc mice were vaccinated twice with one of two vaccines,
including standard BCG vaccine, and a new recombinant vaccine, then challenged
intranasally with live M. bovis. All twelve unvaccinated control
mice lost weight, became moribund, and were sacrificed within 4 weeks of
challenge; results were similar with the recombinant vaccine mice.
BCG-vaccinated mice maintained activity and body weight, and only two of
twelve mice needed to be sacrificed seven weeks post challenge. The
subunit vaccine showed marked reduction in mortality, gross and microscopic
lesions compared to unvaccinated mice, which shows good promise for future
development of a deer or cattle vaccine that will not interfere with current
testing methods. IMPACT: 2005/01 TO 2005/12 Infection of cattle with
Johne's disease does not appear to have major influence on the rate of false
positive skin TB tests in
1. Norby, B., Tempelman,
R.J., Hanson, T.E., Kaneene, J.B., Bartlett, P.C. Estimation of sensitivity
and specificity of bovine tuberculosis skin tests in Michigan when a perfect
reference test is not available. Prev. Vet. Med. (in-press,
2005).
2. Norby, B., Bartlett,
P.C., Grooms, D.L., Kaneene, J.B., Bruning-Fann, C.S. Use of simulation
modeling to estimate herd-level sensitivity, specificity, and predictive values
of diagnostic tests for detection of tuberculosis in cattle. AJVR
(accepted, 2005).
3. Miller, R., Kaneene,
J.B., Schmitt, S.M., Lusch, D.P.,
PROJECT
CONTACT:
Name: Kaneene, J. B.
Phone: 517-353-5941. Fax: 517-432-0976
Email:
kaneene@cvm.msu.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2005-35204-16474 PROPOSAL NO:
2005-01809
START: 01 SEP 2005 TERM: 31 AUG 2008 FY: 2005 GRANT YR: 2005
GRANT AMT: $350,000
INVESTIGATOR: Coussens, P. M.; Kiupel, M.;
PERFORMING INSTITUTION:
Animal Science. Michigan State Univ.
SUBJECT: Immune moduation in bovine
paratuberculosis: macrophage-T cell interactions.
NON-TECHNICAL
SUMMARY: Johne’s disease is caused by M. paratuberculosis and is a
devastating problem in the
OBJECTIVES: 1) We will examine the relationship
between Mycobacterium paratuberculosis (MAP) infection and expression of
IL-1alpha, TRAF1, and TRAF2 in cultured monocyte derived macrophages (MDM).
These studies follow up a previous observation that MAP infected
intestinal tissues have enhanced levels of IL-1alpha and TRAF 1. 2) The
effect of Mycobacterium paratuberculosis (MAP) infection and IL-1alpha
treatment on CD40-CD154 and TNFalpha signaling in MDM will be investigated.
These studies are designed to determine if MAP or IL-1alpha interfere with
normal activation of macrophages. 3) The effect of Mycobacterium
paratuberculosis infection on interactions between MDM and autologous
activated T cells will be examined to determine if MAP interfres with normal
macrophage-T cell signaling. 4) Investigate the effect of MAP infection on
susceptibility/resistance to apoptosis in MDM. These studies will
determine if MAP promotes cell death or cell survival in infected macrophages.
APPROACH: Monocyte derived macrophages (MDM) will be used to investigate the
effects of infection with M. paratuberculosis (MAP) on macrophage
activation, signaling, interactions with T cells, and apoptosis. 1) MAP
infected and uninfected MDM will be collected at various times post-infection,
including: 0 (no MAP treatment), 1, 3, 6, 12, 24, and 48 hours. Cultures
will be harvested for DNA, RNA, and protein at each time point. DNA will
be used to confirm infection and survival of MAP by quantitative IS900 PCR.
TRAF1, TRAF2, and IL-alpha mRNA expression at each time point will be
assessed by Q-RT-PCR. TRAF1 and TRAF2 protein expression will be assayed
by western blot analysis. Relative amounts of TRAF1 and TRAF2 will be
determined. IL-1alpha protein in culture supernatants will be measured by ELISA.
We will thus identify optimal times for TRAF1 and IL-1alpha mRNA and
protein upregulation in MAP infected MDM. We also expect to confirm that
TRAF1 and IL-1alpha mRNA and protein upregulation occurs coincidentally.
2) TRAF1 is overexpressed in intestinal lesions of MAP infected cows,
relative to tissues from healthy cows. Signaling through CD40, TNFR1, and
TNFR2 depends upon the balance of TRAF1 and TRAF2 cells. We will test the
hypothesis that enhanced TRAF1 expression increases non-signaling TRAF1
homotrimers and (TRAF1)2-(TRAF2)1 heterotrimeric complexes within MDM, using a
combination of immune precipitation and western blotting. 3) The effect of
enhanced TRAF1 expression on CD40 signaling will be assayed by measuring
activation of NFkappaB in MDM by electrophoretic mobility shift assay (EMSA).
The ratio of phosphorylated (activated) to non-phosphorylated (inactive)
NFkappaB p65 subunit will also be determined. Finally, activation of
IkappaKinase in treated cultures will be measured. We will monitor mRNA
levels for expression of IL-10, IL-12p35, IL-12p40, TNFalpha, MIP-1alpha and
production of nitric oxide in MAP infected and IL-1alpha treated MDM in response
to soluble CD154. 4) Engagement of the T cell receptor (TCR) with MHC II +
antigen on macrophages and binding of other co-stimulatory factors are of
paramount importance in macrophage T cell interactions. To monitor these
interactions, fresh PBMCs will be prepared and stimulated with MAP antigens in
vitro, for 24 hours. Following stimulation, autologous T cells
corresponding to each MDM culture will be isolated using magnetic cell sorting.
Isolated T cells will be fixed and applied to infected or control MDM and
allowed to interact for 4 to 24 hours. Macrophage activation parameters to
be assayed include production of IFNgamma, IL-10, IL-12p35, IL-12p40, TNFalpha,
MIP-1alpha, and IL-1alpha mRNA by Q-RT-PCR. 5) The large numbers of
macrophages found at sites of MAP infection suggest that infected macrophages
have become resistant to normal clearance mechanisms, including apoptosis.
The ability of two common apoptosis-inducing ligands to signal apoptosis
in MAP infected and control uninfected MDM will be investigated. Apoptosis will
be measured flow-cytometrically using annexin V staining and propidium iodide
(PI).
PROJECT
CONTACT:
Name: Coussens, P.
Phone: 517-353-3158 Fax: 517-353-1699
Email: coussens@msu.edu
URL:
http://www.cafg.msu.edu
PROJ. TYPE: COOPERATIVE
AGREEMENT PROJ STATUS: TERMINATED CONTRACT/GRANT/AGREEMENT NO: 58-3625-0-137
START: 07 SEP 2000 TERM: 28 FEB 2004 FY: 2002 GRANT YR: 2000 GRANT AMT:
$146,000
INVESTIGATOR: Bannantine J P; Stabel J R; Kapur V
PERFORMING
INSTITUTION: Veterinary Pathobiology. Univ of
SUBJECT: Genome sequencing of Mycobacterium
paratuberculosis.
APPROACH: The genome
sequence of one isolate of M. paratuberculosis will be analyzed to find
sequences which differentiate between M. paratuberculosis and other
closely related mycobacteria. The genome will also be searched to detect
sequences coding for potential virulence factors and factors critical for
survival of the bacterium within the host. Gene expression inside
macrophages will be determined using DNA microarrays.
PROGRESS: 2000/09 TO
2004/024. What were the most significant accomplishments this past year?
D. Progress Report. This report serves to document research conducted
under a specific cooperative agreement between ARS and the
No publications reported
this period.
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 04
JUN 2003 TERM: 31 AUG 2005 FY: 2003
INVESTIGATOR: Bannantine J P; Kapur V;
Wells S
PERFORMING INSTITUTION: Univ of
SUBJECT:
Functional genomic analysis of Mycobacterium paratuberculosis (
APPROACH: The genome
sequence of a bovine isolate of M. paratuberculosis will be analyzed to
find DNA sequences which differentiate between M. paratuberculosis and
other closely related mycobacteria. Efforts will then be made to clone,
express and purify proteins from these novel M. paratuberculosis
sequences. These purified proteins will be evaluated in a variety of
immunological assays to determine which ones are best for diagnostic test
development. The test will be optimized and used in whole-herd field tests
of known and unknown infection status.
PROGRESS: 2003/10 TO
2004/094. What were the most significant accomplishments this past year?
D. Progress Report. This report serves to a document research conducted
under a specific copperative agreement between ARS and the
No publications reported
this period.
PROJ
TYPE:
HATCH PROJ STATUS: REVISED
START: 01 OCT 2002 TERM: 30 SEP
2007 FY: 2005
INVESTIGATOR: Feirtag, J. M.
PERFORMING INSTITUTION: Food
Science & Nutrition. Univ of
SUBJECT: Application of chemiluminescent antibiotics as platform
technology for development of rapid pathogen detection.
NON-TECHNICAL
SUMMARY: There is a great need for sensitive "real-time" analysis of food
environments and products for the presence of pathogenic microorganisms.
The positive economic and food safety issues that would be addressed if
this type of technology is made available would have a great impact on the food
industry. This technology would be extremely useful in the application of
microbiological verification and validation of HACCP (Hazard Analysis Critical
Control Point) systems that are mandatory in much of the food industry.
APPROACH: 1. Commercial
antibodies for the specific pathogens are bound to tubes. Chemiluminogenic
derivatives of nisin are prepared, from which a nisin-cobalt complex is
prepared. The bacterial culture or environmental sample is placed into the
tubes containing the specific bound antibodies for pathogen of choice.
After incubation, the tubes are washed and the nisin-cobalt probe added.
The complex probe/pathogen is detected using the luminol-hydrogen peroxide
system. Antibiotic/metal probes will also be developed for the
gram-negative pathogens. The rapid, single tube assay will be optimized.
2. Data analysis will be done by subtraction of a sterile background
control from the raw sample signal, divided by the sterile control signal.
The value is the background corrected signal to background ratio.
Chemiluminescent signals will be obtained from serial dilutions of stock
cell suspensions and correlated to the enumeration data obtained from plate
counts of the dilutions. 3. Environmental samples will be collected from
actual food processing facilities and the assays will be conducted in addition
to the traditional methods to correlate the results of the chemiluminescent
probe to the traditional methods now being used. 4. Potential substrates
that might interfere with the optical assay could include, strong alkaline
materials, oxidizers and redox-active metals. Unknown salts, soils and
heavy metals could potentially contribute to measurement error, these factors
need to be examined with authentic samples of various origins. 5. Several
food processing facilties will be used to beta test the probes developed in the
field.
PROGRESS: 2005/01 TO
2005/12 New government mandates in the ready-to-eat foods industry require
testing for Listeria on a regular basis. It is essential that these
facilities have a rapid method to determine if the pathogen is present in their
environment in order to control its presence in the food products.
Research to date: 1) AOAC approval has been granted for a 30 h
Listeria assay (PDX-LIB) which detects down to 10 Listeria cells;
2) a 90 minute immuno-magnetic chemiluminescent (IMC) assay for the detection of
Listeria in environmental samples has also been developed and submitted
for AOAC approval and is being adopted by the food industry; 3) additional
research is currently being conducted to enhance the recovery of injured
listeria cells and suppress the presence/growth of other organisms to shorten
the 30 h to 12-24 h. The above assays are being utilized in the food
industry at this time. In addition, work is being conducted on the
development of an assay for E. coli O157:H7 and Salmonella that
would provide a rapid and sensitive test.
IMPACT: 2005/01 TO
2005/12 The development and implementation of these "real-time" assays for
food pathogens will greatly enhance the food industry in controlling potential
foodborne outbreaks associated with these pathogens and help the industry meet
the regulatory requirements in microbiological testing, both economically and
efficiently.
PUBLICATIONS: 2005/01 TO
2005/12
Godden, S.M., Fetrow,
J.R., Feirtag, J.M., Green, L.R. and Wells, S.J. 2005. Economic analysis of
feeding milk replacer to dairy calves. JAVMA,
226(9):1547-1554.
PROJECT
CONTACT:
Name: Feirtag, J. M.
Phone: 612-624-3629 Fax: 612-625-5272
Email:
jfeirtag@umn.eduItem
PROJ
TYPE: NRI COMPETITIVE
GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO:
2004-35605-14243 PROPOSAL NO: 2003-05165
START: 15 APR 2004 TERM: 14 APR
2007 GRANT YR: 2004 GRANT AMT: $1,500,000
INVESTIGATOR: Kapur, V.; Wells, S.
PERFORMING INSTITUTION:
SUBJECT: JDIP:
Johne's Disease Integrated Program in research, education, and
extension.
NON-TECHNICAL SUMMARY: Johne's disease is a disease which
results in lost productivity in dairy herds and potential mobidity/mortality.
There is also some concern that the bacterium itself is related to the
onset of Crohn’s's disease in humans. The JDIP program aims to control,
and potentially eliminate, Johne's through a combination of research projects on
how to manage the disease, and potentially eliminate it. This is being
done through a broad collaboration of research universities and USDA groups,
with the collaboration and support of the impacted private sector.
OBJECTIVES: To establish an integrated program in Johne's disease research
with a focus on developing a strong translational pipeline of new diagnostic
tests, vaccine candidates and strategies to manage, prevent and control the
disease.
APPROACH: The above noted objectives will be accomplished via
thematic research units on: Johne's disease epidemiology; diagnostic test
development including strain differentiation; M. paratuberculosis basic
biology and pathogenesis; and strategies for enchancing T and B cell immune
response to M. paratuberculosis. These research units will be
supported by scientific support cores in: Biostatics and Epidemiology;
Diagnostics and Strain Differentiation; Gene and Protein Expression; and Animal
Experimentation. In addition, an Administrative Core will provide support
for both research units and the scientific cores while a Communications and
Extension Core will facilitate communication within the overall JDIP as well as
translating the outcomes from the research into educational information for the
broadly affected Johne's community. An external advisory board, chosen
from public and private stakeholder, will provide guidance to the JDIP team in
pursuit of the overall objectives.
PROGRESS: 2005/01 TO 2005/12 Core 1
offered a course in test evaluation and application at the 8th ICP in
IMPACT: 2005/01 TO
2005/12 Johne's disease (JD) is a serious economic and animal health
problem in domesticated ruminants (primarily dairy and beef cattle, sheep, and
goats) throughout the world. JD in wildlife species is also of great
concern since it may limit opportunities to control or eradicate JD from
domesticated animals. JDIP, through its projects and cores, develops
science-based solutions to enhance animal biosecurity to limit the spread of JD
within herds and prevent its introduction into previously uninfected herds.
We have assembled a strong scientific team with an outstanding record of
accomplishments who are working together under the auspices of JDIP to help
develop and implement a comprehensive plan to enhance animal biosecurity through
the targeted development of rational methods for the diagnosis, prevention, and
control of Johne's disease.
1. Berghaus, R.
D., J. E. Lombard,
3. Corn, J. L., E. J.
Manning, S. Sreevatsan, and J. R. Fischer. 2005. Isolation of
Mycobacterium avium subsp. paratuberculosis from free-ranging
birds and mammals on livestock premises. Appl Environ Microbiol
71:6963-7.
4. Coussens, P. M., C.
B. Pudrith, K. Skovgaard, X. Ren, S. P. Suchyta, J. R. Stabel, and P. M.
Heegaard. 2005. Johne's disease in cattle is associated with enhanced
expression of genes encoding IL-5, GATA-3, tissue inhibitors of matrix
metalloproteinases 1 and 2, and factors promoting apoptosis in peripheral blood
mononuclear cells. Vet Immunol Immunopathol 105:221-34.
5. Crossley, B. M., F.
J. Zagmutt-Vergara, T. L. Fyock, R. H. Whitlock, and
7. Ellingson, J. L., J.
R. Stabel, R. P. Radcliff, R. H. Whitlock, and J. M. Miller. 2005. Detection
of Mycobacterium avium subspecies paratuberculosis in free-ranging bison
(Bison bison) by PCR. Mol Cell Probes 19:219-25.
8. Georgiadis, M. P., W.
O. Johnson, and
10. Harris, N. B., S.
Robbe-Austerman, and J. B. Payeur. 2005. Effect of egg yolk on the detection
of Mycobacterium avium subsp. paratuberculosis using the ESP II
liquid culture system. J Vet Diagn Invest
17:554-60.11.
11. Huntley, J. F., J.
R. Stabel, and J. P. Bannantine. 2005. Immunoreactivity of the
Mycobacterium avium subsp. paratuberculosis 19-kDa
lipoprotein. BMC Microbiol 5:3.
12. Huntley, J. F., J.
R. Stabel, M. L. Paustian, T. A. Reinhardt, and J. P. Bannantine. 2005.
Expression library immunization confers protection against
Mycobacterium avium subsp. paratuberculosis infection.
Infect Immun 73:6877-84.
13. Huntley, J. F., R.
H. Whitlock, J. P. Bannantine, and J. R. Stabel. 2005. Comparison of
diagnostic detection methods for Mycobacterium avium subsp.
paratuberculosis in North American bison. Vet Pathol
42:42-51.
14. Kiehnbaum, L. A., A.
Amonsin, S. J. Wells, and V. Kapur. 2005. Amplified fragment length
polymorphism to detect clonal diversity and distribution of Mycobacterium
avium subspecies paratuberculosis in selected
15. Koo, H. C., Y. H.
Park, J. Ahn, W. R. Waters, M. V. Palmer, M. J. Hamilton, G. Barrington, A. A.
Mosaad, K. T. Park, W. K. Jung, I. Y. Hwang, S. N. Cho, S. J. Shin, and W. C.
Davis. 2005. Use of rMPB70 protein and ESAT-6 peptide as antigens for
comparison of the enzyme-linked immunosorbent, immunochromatographic, and latex
bead agglutination assays for serodiagnosis of bovine tuberculosis. J
Clin Microbiol 43:4498-506.
16. Li, L., J. P.
Bannantine, Q. Zhang, A. Amonsin, B. J. May, D. Alt, N. Banerji, S. Kanjilal,
and V. Kapur. 2005. The complete genome sequence of Mycobacterium
avium subspecies paratuberculosis. Proc Natl Acad Sci U S
A 102:12344-9.
17. Miltner, E., K.
Daroogheh, P. K. Mehta, S. L. Cirillo, J. D. Cirillo, and L. E. Bermudez. 2005.
Identification of Mycobacterium avium genes that affect invasion of
the intestinal epithelium. Infect Immun 73:4214-21.
18. Motiwala, A. S., M.
Strother, N. E. Theus, R. W. Stich, B. Byrum, W. P. Shulaw, V. Kapur, and S.
Sreevatsan. 2005. Rapid detection and typing of strains of Mycobacterium
avium subsp. paratuberculosis from broth cultures. J Clin
Microbiol 43:2111-7.
19. Naser, S. A., and M.
T. Collins. 2005. Debate on the lack of evidence of Mycobacterium
avium subsp. paratuberculosis in Crohn’s's disease. Inflamm
Bowel Dis 11:1123.
20. Palmer, M. V., W. C.
Stoffregen, J. G. Carpenter, and J. R. Stabel. 2005. Isolation of
Mycobacterium avium subsp paratuberculosis (Map) from feral cats
on a dairy farm with Map-infected cattle. J Wildl Dis
41:629-35.
21. Paustian, M. L., V.
Kapur, and J. P. Bannantine. 2005. Comparative genomic hybridizations reveal
genetic regions within the Mycobacterium avium complex that are divergent
from Mycobacterium avium subsp. paratuberculosis isolates.
J Bacteriol 187:2406-15.
22. Raizman, E. A., S.
J. Wells, P. A. Jordan, G. D. DelGiudice, and R. R. Bey. 2005.
Mycobacterium avium subsp. paratuberculosis from free-ranging
deer and rabbits surrounding
23. Rajeev, S., Y.
Zhang,
25. Salgado, M., E. J.
Manning, and M. T. Collins. 2005. Performance of a Johne's disease
enzyme-linked immunosorbent assay adapted for milk samples from goats. J
Vet Diagn Invest 17:350-4.
26. Sevilla, I., S. V.
Singh, J. M. Garrido, G. Aduriz, S. Rodriguez, M. V. Geijo, R. J. Whittington,
V. Saunders, R. H. Whitlock, and R. A. Juste. 2005. Molecular typing of
Mycobacterium avium subspecies paratuberculosis strains from
different hosts and regions. Rev Sci Tech 24:1061-6.
27. Shin, S. J., C. F.
Chang, C. D. Chang, S. P. McDonough, B. Thompson, H. S. Yoo, and Y. F. Chang.
2005. In vitro cellular immune responses to recombinant antigens of
Mycobacterium avium subsp. paratuberculosis. Infect
Immun 73:5074-85.
28. Stabel, J. R., and
J. P. Bannantine. 2005. Development of a nested PCR method targeting a unique
multicopy element, ISMap02, for detection of Mycobacterium avium subsp.
paratuberculosis in fecal samples. J Clin Microbiol
43:4744-50.
29. van Schaik, G., S.
M. Stehman, R. H. Jacobson, Y. H. Schukken, S. J. Shin, and D. H. Lein. 2005.
Cow-level evaluation of a kinetics ELISA with multiple cutoff values to detect
fecal shedding of Mycobacterium avium subspecies paratuberculosis
in
PROJECT
CONTACT:
Name: Kapur, V. Phone:
612-625-7712 Fax: 612-626-0623
Email:
vkapur@umn.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2004-35204-14756 PROPOSAL NO: 2004-01413
START: 01 AUG 2004 TERM: 31 JUL 2008 GRANT YR: 2004 GRANT AMT: $454,506
INVESTIGATOR: Godden, S.
PERFORMING INSTITUTION: Veterinary Population
Medicine Univ of Minnesota St Paul,
SUBJECT: Evaluation of critical control
points in youngstock and adult dairy cow management to reduce transmission of
Mycobacterium avium subspecies.
NON-TECHNICAL SUMMARY: The modes
of transmission of Mycobacterium paratuberculosis (Map) are inadequately
understood, and the efficacy and cost-effectiveness of current recommended
control programs have not been formally evaluated. This project will
critically evaluate the efficacy, magnitude of impact, and cost-effectiveness of
several commonly recommended practices surrounding youngstock management, for
reducing the transmission of Map in infected dairy herds. OBJECTIVES: The
long-term goal of this proposal is to complete a series of prospective
controlled field studies designed to critically evaluate the efficacy, magnitude
of impact, and cost-effectiveness of several commonly recommended practices
surrounding the management of youngstock and adult dairy cattle, for reducing
the transmission of M. paratuberculosis in infected dairy herds.
This goal will be achieved through the following five objectives: 1.
Evaluate the Effect of Maternity Pen Management on Transmission Mycobacterium
avium subspecies paratuberculosis in Newborn Calves. 2.
Evaluate the Effect of Off-Site Heifer Rearing on Transmission of
Mycobacterium avium subspecies paratuberculosis in Youngstock. 3.
Evaluate the Effect of Feeding of Bovine Colostrum (vs. a Commercial Colostrum
Substitute) on the Risk for Transmission of Mycobacterium avium subspecies
paratuberculosis in Newborn Calves. 4. Evaluate the Effect of
Feeding Pasteurized Waste Milk (vs. Commercial Milk Replacer) to Control
Transmission of Mycobacterium avium subsp. paratuberculosis in Dairy Calves.
5. Evaluate the Effect of Delaying Exposure to Mycobacterium avium
subspecies paratuberculosis until Adulthood on the Development of New
Infections in Adult Dairy Cows.
PUBLICATIONS: 2005/01 TO 2005/12
No publications reported
this period
PROJECT
CONTACT:
Name: Godden, S. Phone:
612-625-8177 Fax: 612-625-6241
Email:
godde002@umn.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2005-35204-16106 PROPOSAL NO:
2005-01426
START: 01 AUG 2005 TERM: 31 JUL 2008 GRANT YR: 2005 GRANT AMT:
$350,000
INVESTIGATOR: Sreevatsan, S.
PERFORMING INSTITUTION: Veterinary
Population Medicine. Univ of
NON-TECHNICAL SUMMARY: The
proposed studies attempt to improve animal health and prevent disease caused by
MAP through a program of fundamental research that will enable the development
of superior diagnostic reagents, vaccines and antimicrobial agents.
OBJECTIVES: Johne's
disease (JD), a chronic inflammatory disease caused by infection with
Mycobacterium avium subsp. paratuberculosis (MAP), is one of the
most prevalent and costly diseases of cattle and sheep worldwide. Our
long-term objective is to provide a comprehensive understanding of bacterial
population genetics and host-pathogen interactions in MAP infections. Our
preliminary studies have revealed substantial differences in survival among
genotypically distinct MAP strains in bovine macrophages and strain-specific
variation in transcript profiles. Thus, we hypothesize that genetically
distinct subtypes of MAP differ in their effect on host macrophage and dendritic
cells and these differences play a major role in determining the character of
infection. In the current application, we propose to study the
differential gene expression by the host and MAP strains in a peripheral blood
monocyte derived macrophage and dendritic cell models. Toward this end,
the following objectives are proposed: (1) Establish baseline, early and late
post macrophage and dendritic cell-exposure gene expression profiles in
genetically distinct and identical MAP strains isolated in the United States
from a variety of host species. We propose to use a well-established
enrichment approach termed, Selective Capture of Transcribed Sequences (SCOTS)
to compare and contrast the differentially expressed genes from the
genotypically distinct strains of MAP and (2) Establish baseline and post
MAP-exposure cytokine and gene expression profiles in bovine macrophages and
dendritic cells at the transcript and protein levels using well-established
bovine total leukocyte microarrays and ELISAs, respectively. The proposed
studies attempt to improve animal health and prevent disease caused by MAP
through a program of fundamental research that will enable the development of
superior diagnostic reagents, vaccines and antimicrobial agents.
APPROACH: We propose to
use a well-established enrichment approach termed, Selective Capture of
Transcribed Sequences (SCOTS) to compare and contrast the differentially
expressed genes from the genotypically distinct strains of MAP and
well-established bovine total leukocyte microarrays to interrogate host gene
expression profiles.
PROJECT
CONTACT:
Name: Sreevatsan, S.
Phone: 612-625-3769 Fax: 612-624-4906
Email:
sreev001@umn.eduItem
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2005-35204-16198 PROPOSAL NO: 2005-01447
START: 01 AUG 2005 TERM: 31 JUL 2008 GRANT YR: 2005 GRANT AMT: $350,000
INVESTIGATOR: Weiss, D.; Rutherford, M.
PERFORMING INSTITUTION:
Veterinary Biomedical Sciences. Univ of
SUBJECT: Bovine mucosal immune response to mycobaterial
infection: role of interleukin-10 and CD10 and CD25 T-cells.
NON-TECHNICAL SUMMARY: Results of recent studies have established
that Johne's disease is one of the most prevalent and costly diseases of
ruminants worldwide. It has been estimated that 35% of
APPROACH: We will use
both in vitro and in vivo approaches to study the pathogenesis of Johne's
disease. In the invitro studies, we will evaluate cell signaling pathways
that are involved in attenuating inflammatory and immune responses when
macrophages ingest M. a. ptb organisms. Our preliminary studies
have identified interleukin-10 (IL-10) as a critical factor in attenuating
inflammatory and immune responses and indicate that M. a. ptb-induced
IL-10 production is primarily mediated by the p38 mitogen-activated protein
kinase pathway. In the in vivo studies, we will infect calves with M.
a. ptb organisms and investigate the role of IL-10 and CD25+ regulatory T
cells in preventing an effective immune response to the
organism.
PROJECT
CONTACT:
Name: Weiss, D. Phone:
612-625-9242. Fax: 612-625-5203
Email:
weiss005@umn.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 00-35201-9200 PROPOSAL NO: 2000-02215
START: 01 SEP 2000 TERM: 31 AUG 2002 FY: 2003 GRANT YR: 2000 GRANT AMT:
$575,000
INVESTIGATOR: Kapur, V.; Bannantine, J. P.; Bolin, C. A.; Stabel,
J. R.
PERFORMING INSTITUTION: Veterinary Pathobiology. Univ of
SUBJECT: Genome sequencing and
analysis of Mycobacterium paratuberculosis.
NON-TECHNICAL SUMMARY:
Mycobacterium paratuberculosis is the bacterium that causes Johne's
disease in cattle and other small ruminants. This disease has a major
economic and animal health impact in the
PROGRESS: 2001/01 TO
2001/12 Excellent progress has been made towards completion of the
program. The shotgun sequencing phase has been completed and closure of
the genome is progressing well. The analysis has already identified
numerous potential "unique genes" as targets for diagnostic test development and
the follow-up of these targets is proceeding very well.
IMPACT: 2001/01 TO
2001/12 1. The project is expected to identify the complete repertoire of
genes in Mycobacterium paratuberculsosis, the causative agent of bovine
Johne's disease. 2. The project is expected to identify potential
genes that will enable the development of superior diagnostic tests for Johnse's
disease.
PUBLICATIONS: 2001/01 TO
2001/12
Bannantine, J.P., E.
Baechler, Q. Zhang, L-L Li, and V. Kapur. 2002. Genome scale comparison of
Mycobacterium avium subsp. paratuberculosis with Mycobacterium
avium subsp. avium reveals potential diagnostic sequences. J.
Clin. Microbiol. In press
PROJECT
CONTACT:
Name: Kapur, V. Phone:
612-625-7712 Fax: 612-625-5203
Email:
vkapur@tc.umn.edu
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 01 OCT 1983 TERM: 30 JUN
2008 FY: 2004
INVESTIGATOR: Collins, J. E.; Goyal, S.
PERFORMING
INSTITUTION: Veterinary Diagnostic Medicine. Univ of
SUBJECT: Animal disease diagnostic
laboratory.
PROGRESS: 2005/01 TO
2005/12 The number of cases submitted to the Minnesota Veterinary
Diagnostic Laboratory (MVDL) increased from 64,055 in 2004 to 66,801 in 2005.
The number of procedures also increased from 1,220,685 in 2004 to
1,364,618 in 2005. Paratuberculosis (Johne's disease), bovine viral
diarrhea, and enteritis by rotavirus, coronavirus, and Salmonella were
the major problems. Tuberculosis was also detected in five
PUBLICATIONS: 2005/01 TO
2005/12
1. Chander Y, Kumar K,
Gupta SC, and Goyal SM. 2005 Evaluation of CHROMagar Salmonella medium
for the isolation of Salmonella from animal manure. Internat. J.
Appl. Res.Vet. Med. 3:35-39.
2. Chander Y, Kumar K,
Goyal SM, and Gupta SC. 2005 Antimicrobial activity of soil bound
antibiotics. J. Environ. Qual. 34:1952-1957.
3. Collins MT, Wells SJ,
Petrini KR, Collins JE, Schultz RD, Whitlock RH. Evaluation of five antibody
detection tests for diagnosis of bovine paratuberculosis. Clin. Diagn.
Lab. Immunol. 2005. 12:685-692.
4. Dee SA, Deen J,
Jacobson L, Rossow KD, Mahlum C, Pijoan C. 2005 Laboratory model to evaluate
the role of aerosols in the transport of porcine reproductive and respiratory
syndrome virus. Vet. Rec. 156:501-504.
5. Herman M, Haugerud S,
Malik YS, and Goyal SM. 2005 Improved in vitro cultivation of swine influenza
virus. Internat. J. Appl. Res. Vet. Med. 3:124-128.
6. Maherchandani S,
Patnayak DP, Lauer D, and Goyal SM. 2005 Evaluation of five different
antigens in enzyme-linked immunosorbent assay for the detection of avian
pneumovirus antibodies. J. Vet. Diagn. Invest.
17:16-22.
7. Malik YS, Chander Y,
Gupta SC, and Goyal SM. 2005 A retrospective study on antimicrobial
resistance in Mannheimia (Pasteurella) haemolytica,
Escherichia coli, Salmonella spp., and Bordetella avium
from chickens in Minnesota. J. Appl. Poultry Res.
14:506-511.
8. Malik YS,
Maherchandani S, Allwood PB, and Goyal SM. 2005 Evaluation of animal origin
cell cultures for in vitro cultivation of Noroviruses. J. Appl. Res.
Clin. Expt. Therapeutics. 5:312-317.
9. Patnayak DP, Tiwari
A, and Goyal SM. 2005 Growth of vaccine strains of avian pneumovirus in
different cell lines. Avian Pathol. 34:123-126.
10. Goyal, S.M. and
Ridpath, J.F. (Eds). 2005. BVD - Diagnosis, Management, and
Control. Blackwell Scientific,
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 58-1940-0-008
START: 01 MAR 2000 TERM: 28
FEB 2005 FY: 2001 GRANT YR: 2000 GRANT AMT: $1,266,886
INVESTIGATOR: Rock D
L; Mcintosh M; Riley L
PERFORMING INSTITUTION:
SUBJECT:
Program for prevention of animal infections and advanced technologies for
vaccines and diagnostics.
APPROACH: Conduct
collaborative research on development of vaccine materials and diagnostics for
economically important pathogens of livestock.
PROGRESS: 2003/10 TO
2004/09 1. What major problem or issue is being resolved and how are you
resolving it (summarize project aims and objectives)? How serious is the
problem? What does it matter? The infectious agents under study
cause significant production losses to domestic food animals and include agents
of foreign animal diseases that threaten a key segment of the agricultural
economy. We are developing strategies for improved diagnostics and vaccine
approaches to meet this challenge. Mycoplasmas, mycobacteria, PRRSV and
other viruses, and nematodes cause serious animal health problems in the
3. Endsley, J. E.
2004. Characterization of a bovine homologue of granulysin and NK-lysin with
broad spectrum antimicrobial activity. 7th International Veterinary
Immunology Symposium,
5. Hvinden, M. L., T.
Mutangadura, K. S. Wise, and M. J. Calcutt. 2004. Identification of three
chromosomal loci in Mycoplasma bovine group 7 that contain genes encoding
phase-variable lipoproteins. Abstr. 15th International Congress of the
International Organization for Mycoplasmology, Abstract 233, p.
139.
6.
Hvinden, M. L., T. Mutangadura, K. S. Wise, and M. J. Calcutt. 2004.
Identification of a gene family of phase variable lipoproteins in
Mycoplasma bovine serogroup 7. Abstr. 104th Gen. Mtg. Amer. Soc.
Microbiol., G-021.
7. Kent, B. N. and M. J.
Calcutt. 2004. Towards an expansion of the Mycoplasma genetic tool
box. Abstr. 15th International Congress of the International Organization
for Mycoplasmology, Abstract 243, pp. 144-145.
8. Lee, S-M.,
Kleiboeker, S.B. 2004. Porcine arterivirus modulates NF-KB activation in
vitro. American Society for Virology XXIIIth Annual
Meeting.
9. Lee, S M, SK
Schommer, S.K., Burke, C.E. Kleiboeker, S.B. 2003. IFN sensitivity and
inducing capability differ among PRRSV field isolates which suppress IFN induced
by other viruses. American Society for Virology XXIIth Annual
Meeting.
10. March, J. B., J. R.
Clark, C. D. Jepson, M. Totsika, and M. J. Calcutt. 2004. Bacteriophage
mediated DNA vaccination against Mycoplasma mycoides subsp.
mycoides SC. Abstr. 15th International Congress of the International
Organization for Mycoplasmology, Abstract 5, p. 46.
11. Martin, T.,
13. Röske, K., M. J.
Calcutt, M. F. Foecking, J. I. Glass, and K. S. Wise. 2004. Iterative use of
a versatile protein motif distributed in diverse surface proteins of the M.
mycoides phylogenic cluster. Abstr. 15th International Congress of
the International Organization for Mycoplasmology, Abstract 54, pp.
73-74.
14. Röske, K., M. J.
Calcutt, J. I. Glass, A. Persson, J. Westberg, and K. S. Wise. 2004.
Comparative genomic analysis of two species in the Mycoplasma mycoides
phylogenetic cluster. Abstr. 104th Gen. Mtg. Amer. Soc. Microbiol.,
G-027.
15. Waters, W.R., B.J.
Nonnecke, M.V. Palmer, S. Robbe-Austermann, J.P. Bannatine, J.R. Stabel, D.L.
Whipple, J.B. Payeur, D.M. Estes, J.E. Pitzer, and F.C. Minion. 2004.
Differentiation of Mycobacterium bovis infection of cattle from M.
avium subsp. avium and M. avium subsp. paratuberculosis
infection using a recombinant ESAT-6:CFP-10 fusion protein. Clin. Diagn.
Lab. Immunol. 11:729-35.
16. Carter D.B., Lai,
L., Park, K.W., Samuel, M., Lattimer, J.C.,
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 OCT 2005 TERM: 30
SEP 2006
INVESTIGATOR: Schultz, L.; Nagy, D. W.
PERFORMING INSTITUTION:
Veterinary Medicine & Surgery.
SUBJECT: Specificity of serology
in the diagnosis of Johne's disease in endemic herds.
NON-TECHNICAL SUMMARY: Reported specificity of the Johne's ELISA is 95 to
100 percent. The documented performance of this test is much higher than
we perceive clinically. A lower specificity is supported by our
preliminary data set. The proposed research will provide a more accurate
assessment of the specificity of serologic tests for Mycobacterium avium
paratuberculosis. OBJECTIVES: The scientific objectives of the project are
to: 1) characterize the specificity of the ELISA test in herds with infected
cattle, and 2) evaluate the utility of expanded tessting protocols in
seroogically positive dairy cows.
PROJECT
CONTACT:
Name: Dusty Nagy Phone:
573-882-6857 Fax: 573-884-5444
Email:
NagyD@missouri.eduItem
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO: 00-35208-9192 PROPOSAL NO: 2000-01238
START: 01 SEP 2000 TERM: 31 AUG 2003 GRANT YR: 2000 GRANT AMT: $75,000
INVESTIGATOR: Hall-Stoodley, L.
PERFORMING INSTITUTION: Center for
Biofilms
SUBJECT:
Mycobacterium paratuberculosis survival in
biofilm.
NON-TECHNICAL SUMMARY: Mycobacterium paratuberculosis
causes paratuberculosis or Johne's disease in wild and domestic ruminants.
Paratuberculosis is responsible for significant economic losses in the
APPROACH: M.
paratuberculosis will be grown in standard laboratory medium and subjected
to treatment regimes designed to reduce bacterial aggregation. Following
treatment, cells will be allowed to settle due to gravity (single cells remain
in the top 2-3 mls, while larger clumps settle quickly to the bottom).
After separation single and clumped cells will be examined for viability
and susceptibility/resistance to temperature, chemical and nutrient stress.
M. paratuberculosis will be evaluated for surface attachment and
biofilm formation under flow conditions on a variety of surfaces using
microscopic techniques. Attachment and growth will be monitored over time
and quantitatively assessed using light microscopy. Three-dimensional
structural heterogeneity of M. paratuberculosis biofilms will be further
characterized using scanning electron microscopy and confocal microscopy.
Fluorescent in situ hybridiztion (FISH) probes will be developed using
ribosomal RNA sequences and labeled with appropriate fluorochromes. These
probes will be used to develop a protocol for monitoring the organism in situ
using fluorescent and confocal scanning microscopy.
PROJECT
CONTACT:
Name: Hall-Stoodley, L.
Phone: 406-994-7382. Fax: 406-994-6098
Email:
luanne_h@erc.montana.edu
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 28 FEB
2003 TERM: 01 JAN 2005
INVESTIGATOR: Bannantine J P;
PERFORMING INSTITUTION:
SUBJECT:
Functional genomic analysis of Mycobacterium paratuberculosis
(
APPROACH: The genome
sequence of a bovine isolate of M. paratuberculosis will be analyzed to
find DNA sequences which differentiate between M. paratuberculosis and
other closely related mycobacteria. Efforts will then be made to clone,
express and purify proteins from these novel M. paratuberculosis
sequences. Because of the potential for 50 or more genes to be evaluated
by these labor intensive methods, purification of proteins encoded by unique
genes must be split between both parties. The resulting purified proteins
will be evaluated in a variety of immunological assays to determine which ones
are best for diagnostic test development. The test will be optimized and
used in whole-herd field tests of known and unknown infection
status.
PROGRESS: 2003/10 TO
2004/094. What were the most significant accomplishments this past year?
D. Progress Report. This report serves to document research conducted
under a specific cooperative agreement between ARS and the
No publications reported
this period.
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 13 DEC 1990 TERM: 31 DEC
2020 FY: 2005
INVESTIGATOR: Schmitz, J. A.; Doster, A. R.; Johnson, J. L.
PERFORMING INSTITUTION: Veterinary and Biomedical Sciences.
SUBJECT:
Vet diagnostic lab system: diagnostic surveillance & disease
investigation in NE livestock & poultry.
NON-TECHNICAL SUMMARY:
Diagnosis of animal diseases requires sophisticated technology, equipment and
trained personnel. This project provides personnel expertise equipment and
facilities for disease investigation and diagnosis.
PROGRESS: 2004/10 TO
2005/09 The lab received 15,330 requests for diagnostic assistance from
producers. Foreign animal diseases are included in the differentials and
excluded based on laboratory examination or clinical data. We assist state
health officials with monitoring programs for M paratuberculosis, avian
influenza,
1. Perez S., M. Inman, A.
Doster, C. Jones. The bovine herpesvirus 1 latency gene stimulates growth and
pathogenesis in tonsils of acutely infected calves. 2005. Accepted.
The Journal of Clinical Microbiology. J. Series #143152.
2.
Kelling, C.
L. Hunsaker, B.D., Steffen, D.J. Characterization of protection in
experimentally-infected calves from systemic infection or disease by vaccination
with modified-live noncytopathic bovine viral diarrhea virus type 1. 2005.
The Journal of Veterinary Research. J Series #14376
PROJECT
CONTACT:
Name: Schmitz, J. A.
Phone: 402-472-2952. Fax: 402-472-9690
Email:
JSchmitz@unl.edu
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 06 OCT 1998 TERM: 30
SEP 2003 FY: 2003
INVESTIGATOR: Smith, D. R.
PERFORMING INSTITUTION:
Veterinary Biomedical Science.
SUBJECT: Strategic plan for an
IANMR Disease Research Program at the Dept of Vet. & Biomedical
Sciences.
PROGRESS: 1998/10 TO
2003/09 The Field Disease Research Program uses a team approach to solve
problems of animal or human health related to livestock production systems.
Previous work model diagnostic strategies for classifying herds by Johne’s
disease status has resulted in a USDA funded study to use serial testing (ELISA
serology confirmed by fecal culture) to determine the prevalence of
Mycobacterium avium spp. paratuberculosis-infected beef herds and
to validate a herd-risk-assessment instrument. Deterministic models were
used to show that pre-purchase testing for BVDV-persistent infection using
microscopic examination of immunohistochemistry-stained skin biopsies could
effectively prevent the introduction of cattle that serve as the reservoir of
BVDV and the primary source of transmission of the virus. The benefits of
pre-purchase testing are greater as the number of head within a lot increases
since the probability of introducing at least one BVDV-PI animal increases.
Multi-year intervention trials are currently underway in a commercial
cow-calf operation to test the use of two population-based testing strategies.
One strategy is microscopic examination of immunohistochemistry-stained
skin biopsies to detect and remove calves born persistently infected with BVDV.
The second test strategy is the use of serology among unvaccinated
sentinel calves to detect evidence of virus exposure during the period when
their dams are carrying fetuses susceptible to BVDV infection and subsequent
development of the PI state. IMPACT: 1998/10 TO 2003/09 BVDV is an
economically important viral disease of cattle. Computer models and field
studies are being used to validate the use of population-based diagnostic
strategies for BVDV biocontainment and biosecurity.
PUBLICATIONS: 1998/10 TO
2003/09
Smith DR. Grotelueschen,
D. 2004. Biosecurity and biocontainment of BVDV. Vet Clin N Am Food
Animal Pract., 20(1), in press
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 99-35204-7789 PROPOSAL NO: 1999-02316
START: 01 SEP 1999 TERM: 31 AUG 2002 FY: 2002 GRANT YR: 1999 GRANT AMT:
$210,000
INVESTIGATOR:
PERFORMING INSTITUTION: Veterinary and Biomedical Sciences.
SUBJECT:
Identification of Mycobacterium paratuberculosis virulence
determinants.
NON-TECHNICAL SUMMARY: Paratuberculosis, or Johne's
disease, is a granulomatous enteritis of ruminants which is prevalent in those
areas of the
APPROACH: Bovine
macrophages will be infected with M. paratuberculosis transposon mutants
with pools of 10 to 20 mutant strains at a time, using a multiplicity of
infection of 10:1. Infected macrophages will be incubated at 39 degree C
in the presence or absence of the
IMPACT:
1999/09 TO 2002/08 Paratuberculosis causes an estimated $1.5 billion
annual loss to the
PUBLICATIONS: 1999/09 TO 2002/08
Harris, N.B., D.K.
Zinniel, M.-K. Hsieh, J.D. Cirillo, R.G. Barletta. 2002. Cell sorting
of formalin-treated pathogenic Mycobacterium avium paratuberculosis
expressing GFP. Biotechniques 32:522-527
PROJECT
CONTACT:
Name: Barletta, R. G.
Phone: 402-472-8543 Fax: 402-472-9690
Email:
braul@crcvms.unl.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 OCT 1999
TERM: 30 SEP 2005 FY: 2005 INVESTIGATOR:
PERFORMING INSTITUTION: Veterinary and Biomedical
Sciences.
SUBJECT: Molecular genetic analysis of Mycobacterium
paratuberculosis and related mycobacterial pathogens.
NON-TECHNICAL
SUMMARY: Mycobacterium paratuberculosis is the etiologic agent of Johne's
disease, an infectious disease affecting all ruminants, characterized by
diarrhea, weight loss, and ultimately death. The purpose of this study is
to learn more about the mechanisms of pathogenesis with the goals of developing
more effective disease control strategies.
APPROACH: Herein is
proposed a novel methodology to select for mutants with reduced ability to
survive and multiply in bovine macrophages from a transposon mutant bank.
A fluoroquinolone will be used to kill intracellularly growing bacteria
and select for mutants unable to replicate in bovine macrophages. For
mutants that demonstrate an attenuated phenotype in their interaction with
bovine macrophages, the patterns of gene expression in intracellular and
extracellular conditions will be compared and the virulence of candidate
attenuated mutants will be tested in beige mice. To test the role of
superoxide dismutase and alkylhydroperoxidase, the corresponding genes will be
subcloned into E. coli expression vectors and purified in large amounts.
The purified antigens will be used in assays for humoral and cellular
immunity. To identify drugs or drug combinations effective against M.
paratuberculosis, a variety of M. paratuberculosis strains isolated
from cattle and Crohn’s's disease patients will be tested for drug
susceptibility. M. paratuberculosis strains will be grown and transformed
with plasmids carrying either the firefly luciferase or the green fluorescent
protein reporter genes. The minimal inhibitory concentrations of
individual drugs or pair-wise drug combinations will be determined in broth
culture or M. paratuberculosis infected macrophages. For drug
combination experiments, isobolograms will be constructed to determine if the
drug interaction is indifferent, synergistic, or antagonistic.
PROGRESS: 1999/10 TO
2005/09 Johne’s disease is a chronic enteritis with worldwide distribution
and a significant impact on the world economy. In the
PUBLICATIONS: 1999/10 TO 2005/09
PROJECT
CONTACT:
Name: Barletta, R. G.
Phone: 402-472-8543 Fax: 402-472-9690
Email:
RBarletta@unl.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO: 2004-35204-14231 PROPOSAL NO:
2003-02206
START: 01 FEB 2004 TERM: 31 JAN 2007 FY: 2005 GRANT YR: 2004
GRANT AMT: $270,000
INVESTIGATOR:
PERFORMING INSTITUTION:
Veterinary and Biomedical Sciences.
SUBJECT: Molecular analysis of a
Mycobacterium paratuberculosis colony-morphology attenuated
mutant.
NON-TECHNICAL SUMMARY: Mycobacterium paratuberculosis is
the etiologic agent of Johne's disease, a chronic infectious disease of
ruminants, characterized by diarrhea, weight loss, and ultimately death.
The purpose of this study is to further characterize at the cellular,
genetic and biochemical levels a colony-morphology mutant strain of the
infectious agent shown to be attenuated by in virto assays.
APPROACH: In the first
objective, PCR and Southern blotting analyses will be used to confirm the
location of the transposition insertion within the suspected DNA sequence,
located adjacent to a gene encoding one of the proline-rich proteins of M.
paratuberculosis. The wild-type allele of the candidate ppe gene will
be introduced back into the mutant strain. Bovine macrophage survival
assays will be used to confirm the restoration of the virulent wild-type
phenotype. Wild type and mutant strains will be grown on both low and high
iron media, as well as intracellularly within macrophages. Gene expression
under these conditions will be monitored at the transcriptional level by
Northern and primer extension analyses, RT-PCR and transcriptional fusions to
the firefly luciferase gene. Further biochemical characterization will
involve the over-expression and purification of the wild-type gene product from
recombinant E. coli. Using the purified product, monospecific
polyclonal antibodies will be produced. In the second objective, a recombinant
version of the mutant strain expressing the green-fluorescence protein will be
used to assess their ability to survive and co-localize within lysosomes.
To determine survival, both unstimulated and interferon-gamma stimulated
macrophages will be infected with the wild-type and mutant strains of M.
paratuberculosis and monitored for both its ability to infect macrophages
and persist intracellularly over time. Confocal microscopy will be used
for co-localization studies of bacteria-containing phagosomes with lysosomes.
PROGRESS: 2004/02 TO 2007/01 Mycobacterium avium subsp.
paratuberculosis (MAP) is the etiological agent of a severe gastroenteritis
in ruminants, known as Johne’s disease. In the
IMPACT: 2004/02 TO
2007/01 Paratuberculosis and related mycobacterioses cause an estimated
one billion dollars in annual losses to
PUBLICATIONS: 2004/02 TO 2007/01
S.-R. Woo, J. Sotos, A.P. Hart, R.G.
Barletta and C.J. Czuprynski. E-Pub. 2005. Phagocytosis and intracellular
survival of Mycobacterium avium subsp. paratuberculosis in bovine
monocytes and a macrophage cell line. Veterinary Immunology and
Immunopathology. (ARD J. Series No. 14971)
PROJECT CONTACT:
Name: Barletta, R. G.
Phone: 402-472-8543 Fax: 402-472-9690
Email:
rbarletta@unl.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 OCT 2005 TERM: 30
SEP 2010
INVESTIGATOR:
PERFORMING INSTITUTION: Veterinary And Biomedical
SUBJECT:
Molecular genetic analysis of Mycobacterium avium subsp. paratuberculosis
(MAP) and related mycobacterial pathogens.
NON-TECHNICAL SUMMARY:
MAP is the etiologic agent of Johne's disease, an infectious disease affecting
all ruminants, characterized by diarrhea, weight loss, and ultimately death.
The purpose of this study is to use a genetic approach to study MAP
virulence determinants and related pathogens. We expect to identify and
characterize attenuated MAP mutants that could serve as candidate vaccine
strains.
APPROACH: Objective 1)
We propose to screen a MAP signature tagged transposon bank that will be used to
infect Madin-Darby bovine kidney (MDBK) cells in vitro to identify genes or
virulence determinants in MAP encoding for proteins (or enzymes involved in the
synthesis of lipids or carbohydrates) that participate in the process of binding
and invasion of the intestinal mucosa. Once a deficiency in invasion is
established, the clones will be sequenced and searched against the MAP genome.
Methods will include screening MDBK epithelial cells for MAP invasion and
complementation analysis to confirm that a phenotype observed is due to a
specific gene inactivation. Objective 2) DNA microarrays will be used to
identify genes exclusively expressed within macrophages and defined targeted MAP
mutants will be constructed and evaluated for replication and survival in bovine
macrophages. We will use whole MAP genome oligonucleotide DNA microarrays
to profile the transcription level of each encoded gene. Next, MAP
isogenic mutants will be constructed to inactivate the gene of interest.
Finally, we will test the virulence of selected MAP mutants to survive and
replicate in bovine macrophages. Objective 3) We will use peripheral blood
monocytes and the BoMac cell line to test whether MAP mutants have a diminished
ability to prevent the fusion of phagosomal compartments. This will
include confocal microscope studies with recombinant GFP-expressing mutant
strains ability to survive and co-localize within lysosomes. In addition,
we will test the ability of MAP mutant and wild-type strains ability to survive
in stimulated and nonstimulated bovine macrophages. Objective 4) We will
focus on identifying and characterizing drug targets in the D-alanine branch of
peptidoglycan biosynthesis to develop novel drugs for the therapy of M.
tuberculosis and M. avium subsp. avium infections in humans,
Johne's disease or bovine tuberculosis in animals, and Crohn’s's disease in
humans. We will need to determine the essentiality of a given target gene
by constructing merodiploid strains using the putative wild-type gene in an
integrating vector. Next we will overproduce and purify the recombinant
target proteins. D-alanine racemase activity will be assayed in the direction of
the conversion of L-alanine into D-alanine by a modification of the
coupled-spectrophotometric method while D-alanine:D-alanine ligase assays will
be carried out by a modified thin layer chromatography based method.
Lastly, methods will be developed to screen a large number of chemical
compounds for inhibitors of the purified enzymes.
PROJECT CONTACT:
Name: Barletta, R. G.
Phone: 402-472-8543 Fax: 402-472-9690
Email:
rbarletta1@unl.edu
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 01 SEP
2003 TERM: 31 AUG 2008
INVESTIGATOR: Karns J S; Van Kessel J S; Schukken Y H
PERFORMING INSTITUTION: Veterinary Preventive Medicine.
SUBJECT: Pilot study of factors
affecting maintenance of Mycobacterium, Salmonella, E. coli and Listeria on
dairy farms.
PROGRESS: 2003/10 TO
2004/094. What were the most significant accomplishments this past year?
4D. This report serves to document research conducted under a Specific
Cooperative Agreement between ARS and
No publications reported
this period.
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 01 OCT 2002 TERM: 30
SEP 2005 FY: 2005
INVESTIGATOR: Thonney, M. L.; Smith, M. C.; Stehman, S. M.
PERFORMING INSTITUTION: Animal Science.
NON-TECHNICAL SUMMARY: Paratuberculosis (Johne's Disease) causes
early death and poor reproductive performance in sheep and dairy flocks.
This project tests the efficacy of vaccination to help control
paratuberculosis in sheep.
OBJECTIVES: The overall
objective of this proposal is to evaluate the effectiveness of vaccination
against Johne's Disease in sheep. Correlated objectives are to improve the
control of Johne's disease in sheep flocks to increase production efficiency and
to eradicate the disease from the Cornell Dorset flock, which is one of the only
flocks in the world intensely selected for out of season breeding. A
successful vaccination program would make the Cornell aseasonal genotype
available to
APPROACH: One-hundred
control ewes and 100 ewes vaccinated as lambs with Mycopar are in an experiment
started in 1999. The presence and size of granulomas was monitored in the
vaccinated lambs. The ewes in the vaccination trial are managed with the
other ewes in our flock. At 2, 3, 4, and 5 years of age, about one-fourth
of the control ewes and one-fourth of the vaccinated ewes are being slaughtered
so that the intestinal tracts can be examined by histopathology to determine if
they are infected. The reason for the serial slaughter is to determine if
there is a difference between the control and vaccinated groups in severity of
pathology with age if some ewes in the vaccinated group become infected.
The ewes are randomly sampled as they finish a lambing/lactation period.
Prior to slaughter, samples of blood and feces are obtained for
development of fecal culture methodology and correlation of AGID results with
histopathology data. At slaughter, the intestinal tracts are retrieved and
returned on ice to the
IMPACT: 2002/10 TO
2005/09 Vaccination against Johne's Disease (Mycobacterium avium
subsp. paratuberculosis) using Mycopar(R) will reduce the incidence of
infection and help to control the disease in sheep flocks. This will
reduce mortality in breeding flocks, improving efficiency of production to make
sheep farming more profitable and encourage the expansion of
environmentally-sustainable sheep farms.
PUBLICATIONS: 2002/10 TO
2005/09
No publications reported
this period
PROJECT CONTACT:
Name: Decker, D. J.
Phone: 607-255-2224. Fax: 607-255-9499
Email:
cuaes@cornell.edu
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 OCT 2003 TERM: 30 SEP 2006
FY: 2005
INVESTIGATOR: Gavalchin, J.; Thonney, M. L.; Stehman, S. M.; Smith,
M. C.
PERFORMING INSTITUTION: Animal Science.
SUBJECT:
Identification of protective immune responses in sheep after vaccination
with the mycopar vaccine for paratuberculosis.
NON-TECHNICAL
SUMMARY: Johne's Disease is widely distributed in cattle, sheep and goats.
The pathogenesis of Johne's is not understood, and its diagnosis is
difficult in live animals. No vaccine for Johne's is approved for use in
sheep in the
APPROACH: There are 184
sheep remaining in the original Mycopar vaccination trial; 88 were vaccinated
with Mycopar at weaning either in July 1999, September 1999, May 2000, and July
2000, and there are 96 age-matched unvaccinated controls. In each of the 3
years of this grant, the immune responses to MAP will be determined, in order to
correlate specific immune responses with disease kinetics and clinical stages.
Objective 1: We will first define the stages of infection in the flock by
assaying sera for levels of interferon gamma, which is a biomarker for early
disease, and MAP-specific antibodies which appear in late disease. Skin
testing with Johnin will also be done. The results of these tests, and
fecal organism load, will be used to characterize each animal with regard to MAP
exposure/infection. Approach: Ten mls of blood will be collected from each
ewe. Serum will be obtained by centrifugation. Fecal samples will be
collected for determination of organism load by PCR. DTH to Johnin and TB will
be conducted by an accredited veterinarian (Mary Smith, DVM). Gamma
interferon levels will be determined by the Bovigam assay. The Cornell
Veterinary Diagnostic Lab will perform the AGID assay for antibodies to Johnin.
Johnin-specific antibodies will also be quantitated using the Parachek
test (Biocor). DNA will be isolated from feces using the QIAamp DNA Stool
Mini Kit. Enzymatic amplification of MAP DNA will be performed using PCR
primers MP3 (5'-CTGGCTACCAAACTCCCGA-3') and MP4 (5'-GAACTCAGCGCCCAGGAT-3').
The results of the individual assays will be analyzed by Student's T-test.
The data analysis program SPSS will be used to perform logistic
regressions, correlations, cluster centers, and cross tabulations to identify
correlated immune responses and stages of infection. Objective 2: We will
further define the immune cell phenotypes and functions that are modulated in
MAP infection and Mycopar vaccination by in vitro methods. The results of
these studies will identify additional biomarkers for immune responses to MAP.
Approach: Peripheral blood mononuclear cells (PBMC) will be isolated and
analyzed by flow cytometry for the proportion of T lymphocytes (CD4, CD8), B
lymphocytes (anti-ovine IgG), monocytes (CD14), and neutrophils, as well as
expression of activation markers. Cells will be cultured in vitro with Con
A to determine the overall proliferative responses, and with Johnin, to
determine the MAP-specific responses. Immunoglobulin production will be
measured by ELISA. Johnin-specific cytokine production will be evaluated by
culture of PBMC with either Con A or Johnin, and will include interleukin (IL)-2
and interferon- gamma to measure the Th-1-type response and IL-4 and IL-10 to
measure to the Th2-type response. IL-1 and TNF alpha levels will also be
measured. Data will be analyzed by Student's T-test.
PROGRESS: 2005/01 TO
2005/12 We are continuing our studies related to defining the
immunological events in response to natural infection with MAP, as well as
Mycopar vaccine. Data from the second set of sheep were analyzed in the past
year of funding. We found that there was about a nine-fold increase (p
less than 0.001) in concentrations of MAP-specific Ab for vaccinated compared
with control ewes indicating that vaccination mounted a humoral immune response,
while vaccination status had no effect on IFN-g suggesting that if there had
been a cell-mediated response to vaccination accompanied by IFN-a production,
this indication of a cell-mediated response had subsided three years
post-vaccination. The AGID assay, which is currently used for pre-clinical
Johne's disease identification, was positive only for one ewe that happened to
be in the control group and had neither high IFN-g (0.24 OD unit) nor high
MAP-specific Ab (0.21 OD unit) values. Thus, vaccination apparently did
not interfere with this assay. Because many of the control ewes were
expected to be infected, these data support the contention that infected ewes
not showing signs of clinical symptoms likely will not be detected by AGID, thus
this test is specific but not very sensitive. Furthermore, AGID apparently
does not detect the MAP-specific Ab measured in this experiment. The
scatter plot of g-IFN against MAP-specific Ab provided an indication of the
variation in these OD values among the ewes. None of the control ewes had
MAP-specific Ab values higher than the lowest values for vaccinated ewes and
only three of the vaccinated ewes had MAP-specific Ab values sufficiently low
that they approached the highest values for control ewes. Thus, it is
obvious that this MAP-specific Ab can identify ewes that have been vaccinated
with Mycopar. Three of the control ewes had g-IFN values above 0.4 OD
units that appeared to be outliers. These and four vaccinated ewes that
had low MAP-specific values but relatively high g-IFN values in the 0.3 to 0.4
range will be studied for additional immune responses to determine if they are
infected. Our previous data also supported skin testing to the Johnin Ag
as a predictive measure of reactivity since all of the vaccinated animals had
larger reactions than the non-vaccinated animals. The significance of our
results to date will be determined when the organism load of each ewe is known
and is correlated with our assay results, which is currently underway.
During 2006, we will validate and expand upon our findings by correlating
the in vitro and in vivo responses of sheep that are infected by MAP as
determined by AGID, that were not part of the vaccination study, to Johnen.
Infected animals include 4 aged 21 months, 4 aged 3 years, 10 aged 4
years, 5 aged 7 years and 5 aged 10 years, and age-matched uninfected controls
are available for each group. Hopefully, we will be able to use the
results of this study to establish a set of biomarkers that correlate with the
stage of infection.
IMPACT: 2005/01 TO
2005/12 Johne's Disease, caused by Mycobacterium avium
paratuberculosis (MAP), is widely distributed in cattle, sheep and goats. In
the
PUBLICATIONS: 2005/01 TO
2005/12
No publications reported
this period
PROJECT CONTACT:
Name: Decker, D. J.
Phone: 607-255-2224. Fax: 607-255-9499
Email:
cuaes@cornell.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 99-35201-8039 PROPOSAL NO: 1999-02859
START: 01 OCT 1999 TERM: 30 SEP 2002 FY: 2002 GRANT YR: 1999 GRANT AMT:
$87,784
INVESTIGATOR: Sasahara, K. C.
PERFORMING INSTITUTION: Food
science.
SUBJECT: Novel strategies for determining thermal destruction of
Mycobacterium tuberculosis.
NON-TECHNICAL SUMMARY: Heat treatment
procedures that reliably destroy M. paratuberculosis have not been
established. The purpose of this study is to test the effectiveness of
light production by engineered M. paratuberculosis as a rapid and
sensitive method for viable M. paratuberculosis.
PROGRESS: 1999/10 TO
2002/09 Mycobacterium avium subsp. paratuberculosis (MAP) is
the causative agent of Johne's disease in dairy cows. This organism, which
is excreted in feces and milk, is not easily inactivated by thermal treatments.
Our current understanding of MAP inactivation kinetics during heat
treatment processes is limited largely due to a lack of rapid and sensitive
methods for detection of viable cells. To provide tools for measuring MAP
survival, we created multiple MAP strains harboring pYUB180, which is a plasmid
bearing a constitutively expressed firefly luciferase gene, FFlux, under the
control of a mycobacterial heat shock protein promoter. Luminescence is
constitutively produced in viable cells and serves as a presence or absence
indicator of MAP viability. MAP transformants were screened for their
ability to stably express luciferase over multiple generations. Of the
numerous transformants obtained, two produced high levels of luminescence, and
therefore, were suitable for further use in thermal resistance experiments.
These two strains were inoculated into media that was either heated
statically in glass capillary tubes or non-statically in a pasteurizer with a
turbulent flow holding tube. Static test conditions in capillary tubes
were performed at one temperature (72 C) with varying heating times of between
15 and 120 seconds in three test solutions: milk, Middlebrook 7H9 broth, or
colostrum. Heated cultures were enriched in Middlebrook 7H9 broth with
mycobactin J for 1, 2, or 4 weeks at 37 C, and plated onto Herrold's Egg Yolk
(HEY) slants. Both strains grew on HEY slants from all heat treatments.
Luminescence did not always correlate to observed growth on HEY slants.
In other instances, there was no detectable luminescence despite colony
appearance on HEY slants. Neither strain grew on HEY slants after passage
through a 72 or 75 C turbulent flow holding tube, however, the corresponding
cultures produced various levels of luminescence suggesting the presence of
viable MAP cells in the heat-treated samples. Both strains that had been
heated to 65 C formed colonies on HEY slants and produced various levels of
luminescence. Positive control non-heat treated inoculated milk showed
both various levels of growth on HEY slants and luminescence. Although 72
and 75 C thermal treatments did not yield viable cells on HEY slants, sporadic
luciferase activity in the treated samples suggests the presence of low levels
of viable cells in the milk samples. Mycobacterial luciferase reporter
phages (phGS18, phAE40, and phAE85) were tested for the ability to infect MAP
isolates and to be used as a rapid method for detection of the presence of
viable MAP in dairy products. To varying degrees, all three phages
infected and produced luminescence in 18 MAP isolates growing in Middlebrook 7H9
broth within 24-96 hours at 37 C. Attempts to test the ability of these
phages to detect viable MAP in milk samples were unsuccessful.
IMPACT: 1999/10 TO
2002/09 Despite development of effective tools for detection of low levels
of viable M. avium subsp. paratuberculosis in various media, we do
not have definitive evidence of the destruction of this organism by current
pasteurization strategies. Luminescence is effective as a rapid detection
method for the presence of this organism, but many intrinsic mycobacterial
characteristics hinder the definitive determination of whether MAP survives
pasteurization. PUBLICATIONS: 1999/10 TO 2002/09
Kyle C. Sasahara, Sang
J. Shin, and Kathryn J. Boor. 2003. Detection of viable Mycobacterium
avium subsp. paratuberculosis using luciferase reporter systems.
In preparation.
PROJECT CONTACT:
Name: Coffman, W. R.
Phone: 607-255-2224. Fax: 607-255-9499
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 01 OCT 2000 TERM: 30
SEP 2003 FY: 2004
INVESTIGATOR: Wiedmann, M.; Scarlett, J.; Worobo, R.
PERFORMING INSTITUTION: Food Science.
SUBJECT:
Improved tools for predicting the pathogenic potential of foodborne
microorganisms.
NON-TECHNICAL SUMMARY: Foodborne diseases cause an
estimated 76 million illnesses and 5000 deaths annually in the
APPROACH: Objective 1:
Human, food, and animal isolates of E. coli O157:H7, St.
agalactiae, and M. paratuberculosis will be collected in
collaboration with the NYS Veterinary Diagnostic Laboratory, the Dept. of
Argriculture and Markets, and the Dept. of Health. All isolates will be
characterized by DNA subtyping methods including Southern blotting, ribotyping
and sequencing of selected virulence genes. Objective 2: Bacterial subtype
distribution among human, food, and animal isolates will be statistically
analyzed to identify specific subgroups linked to human infections.
Objective 3: Selected subgroups differing in human and animal host
specificities will be used to infect appropriate tissue culture cell lines to
determine differences in their pathogenic potentials.
PROGRESS: 2000/10 TO
2003/09 Most food safety regulations regarding bacterial foodborne
pathogens specify action limits for the presence of specific bacterial species.
These classical taxonomic definitions of bacterial species often do not
correlate to the ability of a group of bacteria to cause human disease.
Rather, somewhat related bacteria that may differ in their abilities to
cause human and/or animal disease may be grouped together into the same species.
This project is designed to develop a phylogenetic and population genetics
framework to allow the specific definition of bacterial clonal groups with human
pathogenic potential. Our work specifically focused on Streptococcus
agalactiae, which is not only a major cause of mastitis in cattle, but is
also responsible for severe invasive disease in adult and neonate humans, as
well as asymptomatic infections in women. To probe the population genetics
and the interspecies transmission potential of this species, we used molecular
subtyping and phenotypic methods to characterize temporally matched bovine milk
and clinical human invasive isolates (52 each) collected in
No publications reported
this period
PROJECT CONTACT:
Name: Coffman, W. R.
Phone: 607-255-2224. Fax: 607-255-9499
Email: ded7@cornell.edu
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 OCT 2004 TERM: 30 SEP 2007
FY: 2005
INVESTIGATOR: Chang, Y. F.; Baeummer, A. J.; Shin, S. J.; Stehman,
S.; Nydam, D. V. PERFORMING INSTITUTION: Vet Population Medicine &
Diagnostic Science.
NON-TECHNICAL SUMMARY: Paratuberculosis (Johne's
disease) occurs worldwide as a chronic granulomatous enteritis of domestic and
wild animals. A sensitive and rapid test is urgently needed. The
purpose of this study is: 1) improve the sensitivity of the PCR test directly
from fecal samples, milk, and colostrum or liquid media culture system by using
a novel laser-induced cell lysis technique to prepare the DNA extracts and (2)
develop a rapid, inexpensive, and sensitive biosensor for detection of MAP based
on RNA detection.
OBJECTIVES: Molecular
techniques for the diagnosis of Johne's disease based on nucleic acid
amplification (regular PCR and/or real-time PCR) have been widely used in animal
health diagnostic laboratories. However, the sensitivity of the PCR-based
test directly from fecal samples, especially from the low shedders, is still
very low. Furthermore, PCR detection in milk and colostrum cannot
distinguish between viable and non-viable organisms. Thus, in order to
have sufficient material, very long cell culture incubation times are required
until a definite answer can be found using PCR. Therefore, we propose to
improve the PCR based test by using a novel cell lysis technique, the
laser-lysis technology, to improve the yield of DNA extract preparation.
The immensely thick lipid layer of MAP is the main obstacle for current
lysis methods. Since the laser-lysis technique is based on the local and
specific increase of intracellular water molecules, we postulate that it will
not be hindered by the presence of the thick lipid layer but will successfully
lyse cells without any damage to DNA, RNA and intracellular protein molecules.
Our central hypothesis is that the use of the laser lysis technique will
increase the template DNA recovery, and therefore, it will increase the
sensitivity of PCR test directly from fecal samples, which results in a
significantly shorter cell incubation time as required currently. At the
same time, biosensor technology will enable us to simplify the detection system
and make it inexpensive and even more rapid while keeping its high specificity
for the detection of Johne's disease.
APPROACH: 1. The use of
laser lysis technique will increase the DNA template recovery from fecal sample
preparation; thus, it will increase the sensitivity of PCR tests from either
fecal sample directly and/or from Trek culture system. If this technique
is successful, then, it may be applied to fecal samples directly and/or early
detection of Trek liquid culture system. 2. The RNA biosensor based on
liposome technology is a rapid, inexpensive and sensitive system to detect the
MAP directly from fecal samples and/or Trek culture system. The antibody
biosensor is also a rapid, inexpensive and sensitive system to detect the
Mycobacterium avium subsp. paratuberculosis (MAP) directly from
fecal samples and/or Trek culture system. To accomplish the objective of
this study, we will apply two approaches: (1) Increase the PCR sensitivity by
the improvement of cell lysis and thus DNA extraction using laser-induced cell
lysis. (2) Apply RNA Biosensor for MAP diagnosis. PROGRESS: 2005/01 TO
2005/12 NASBA analysis: Nucleic acid sequence based amplification (NASBA)
reactions were carried out for ISMav2 and IS900 genes of MAP. Five
microliters of amplified NASBA products were analysed by electrophoresis on 2
percent agarose gels, containing 0.5 ug/ml of ethidium bromide. Gels were
run at 100 V for 30 min in TAE buffer. NASBA products were visualized using a UV
illuminator and photographed using photodocumentation system. Biosensor assay:
Probes ands primers were derived from both ISMav2 and IS900. The
biosensor assay was carried out by mixing 5 ul of Master mix (containing 20
percent Formamide, 4X SSC, 0.2M sucrose and 0.2 percent Ficoll type 400), 1 ul
of reporter probe (2pmol/ ul), 1 ul of capture probe (1pmol/ul)
and 1 ul of amplified target RNA in a glass tube. Initially, the samples
were incubated at 65C for 5 min to open up the secondary structures of RNA and 2
ul of liposomes tagged with reporter probe were added and incubated at 41C for
20 min. After the membrane had absorbed all of the solution by capillary
action, 35ul of running buffer (40 percent Formamide, 8X SSC, 0.2M sucrose and
0.2 percent Ficoll type 400) was added to the bottom of the test tube to flush
the solution up the membrane. After 10 min, when the running buffer had
run the length of the strip, the signal at the capture zone was analyzed with a
reflectometer. Biosensor assay for ISMav2 with NASBA product: The
probes (capture and reporter probe) and the target along with the master mix
were incubated at 65C for 5 min to open up the secondary structures of amplified
target RNA. No signals were noticed at the capture zone.
Subsequently the probes and the target were denatured at 94C for 5 min and
hybridization was carried out at 41C for 20 min. Weak signals were
detected at the capture zone when the target was denatured at 94C.
Biosensor assay with PCR product of ISMav2: PCR was performed for ISMav2
using DNA as target using the following primers, FP 5' CCCTGACCGGCATCGATGAT3'
And RP 5' CTTGCCGTTATCGGTCAAGA3'. The PCR product was used as target for
the biosensor assay. The target (2 ul) and the probes (Capture and
Reporter probes) along with the master mix were denatured at 100C and
hybridization was carried out at 50C, after adding 1 ul of Liposomes tagged with
reporter probes. Good signals were noticed at the capture zone and the
signals were analyzed with the reflectometer. Biosensor assay for IS900:
Since there were only weak signals for IS900, internal probes were also
designed and used. Signals could not be improved even with internal
probes, which were at 5pmol and 10pmol concentrations. The reason for the
weak signal at the capture zone could be due to the secondary structures formed
by the target amplified RNA (NASBA product), which has more than 60 percent GC
content. Further improvement with different primer sets is ongoing.
Biosensor assay with the RT-PCR product of ISMav2 was performed and it
gave weak signals. Attempts are being made to optimize the assay to get
better signals and also to try with the RT-PCR product of IS900.
IMPACT:
2005/01 TO 2005/12 Due to the insidious nature of Johne's disease and the
lack of a cost effective treatment, control of this disease depends on accurate
diagnosis and aggressive management to lessen the serious economic impact this
disease may have in an infected herd or flock. Therefore, improvement of
Johne's disease diagnosis is very important to curtail the economic loss caused
by this bacterium. Attempts to develop a better diagnosis for this disease
using a novel biosensor technique. Biosensors are portable devices that
can, with high sensitivity and specificity, rapidly analyze a sample for the
presence of a specific analyte and quantify the amount present. Biosensors
are typically easy to use, inexpensive and reliable for field-testing.
Once we develop the test, it will be used to help the quick diagnosis of
this disease. This will improve the economic growth in the cattle industry
and reduce the environmental contamination of the bacterium. Since this
bacterium has been suspected to be the cause of human Crohn’s's disease (a
gastroenteritis of human), the culling of infected animals will reduce the
chance of milk, cheese contamination of this organism. This will have a
great social impact on the quality of life. In conclusion, we are
confident that we will develop a new technique to help the curtail the economic
loss of this disease.
PUBLICATIONS: 2005/01 TO
2005/12
No publications reported
this period.
PROJECT CONTACT:
Name: Decker, D. J.
Phone: 607-255-2224 Fax: 607-255-9499
Email: cuaes@cornell.edu
PROJ
TYPE:
STATE PROJ STATUS: EXTENDED
START: 01 OCT 1988 TERM: 30 SEP
1998 FY: 2005
INVESTIGATOR: Lein, D. H.; Shin, S. J.; Jacobson, R. H.
PERFORMING INSTITUTION: Diagnostic Laboratory.
PROJ
TYPE:
SPECIAL GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO:
2006-34475-17127 PROPOSAL NO: 2006-06092 START: 01 AUG 2006 TERM: 31 JUL 2008
GRANT YR: 2006 GRANT AMT: $1,317,014 INVESTIGATOR: Freeman, D.; Logue, C.;
Sellnow, T.; Hinsz, V.; Nganje, W.; Khaitsa, M.; Gibbs, P.; Panigrahi, S.; Hall,
C.; Glower, J.
PERFORMING INSTITUTION: Veterinary & Microbiological
Sciences. North Dakota State Univ.
SUBJECT: Food safety risk assessment,
ND.
NON-TECHNICAL SUMMARY: Annually, millions of people in the
APPROACH: 1) Studies
will investigate Salmonella in turkeys from entry into rearing barns to
slaughter. Molecular analysis will further define the pathotype of the
organism and the transfer between flock rotations. Domestic exposure of
consumers to Salmonella in homes will be evaluated. 2) The
empirical model will include optimal intervention strategy at the retail
(consumer) level. The associated risks, costs and benefits of alternative
mitigation strategies (e.g., generic and augmented HACCP) for Salmonella
are evaluated jointly. 3) Studies will test potential risk communication
messages that contain varying strategies related to culture, learning styles,
public outrage, and message source in order to determine message receptivity.
The messages will be tested with diverse publics, including general
American macro-culture and underserved populations. We will test
differences in message receptivity, and develop strategies for adapting risk
messages to meet the needs of various audiences. 4) Studies will test
whether the activation of the disgust emotion heightens perceptions and
judgments of risk and diminishes willingness to approach and interact with foods
appearing to have properties associated with contamination. Food handlers
and preparers reports of key practices will be assessed. 5) Different
turkey meat products including organic, fresh, frozen, and ready to eat products
from retail outlets will be randomly sampled and tested for the presence of
Salmonella. 6) Data and information from all studies will be merged
and reported in a range of media. B. Risk Assessment for Pathogens of Food
Safety Concern in Milk and Powdered Milk Products. Initial Approach to All
Objectives: Assess the potential for milk and milk products as a source of
Enterobacter sakazakii, other members of the Enterobacteriaceae, and
M. avium subsp. paratuberculosis on raw milk samples. Culturing
procedures for E. sakazakii and M. avium subsp.
paratuberculosis have been optimized with newly developed and
commercially available media. An improved method for isolation of M.
avium subsp. paratuberculosis from bulk tank milk samples will be
implemented. C. Intelligent Quality Sensors 1) Representative meat samples
will be analyzed using HPLC technique to determine their constituents and
identify indicator metabolites. 2) The identified metabolites (compounds)
will be characterized using SERS (surface enhanced) Raman spectroscopy. 3)
Detectors will be fabricated based on their novel sensing characteristics to
provide additional sensitivity to the indicator compounds. 4) We will use
the responses of different electronic nose modules to determine probability
density functions (pdf), which will be used to generate additional numbers of
simulated data sets which will be used to develop and evaluate classification or
prediction models using neural networks techniques. 5) The framework for
integrated prototype electronic nose will be developed. The integrated
nose modules will then be further evaluated for discriminating Salmonella
contaminated meat samples.
PROJECT CONTACT:
Name: Freeman, D. A.
Phone: 701-231-8504 Fax: 701-231-9692
Email: douglas.freeman@ndsu.edu
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
MULTISTATE PROJ NO:
NC-107
START: 01 OCT 2001 TERM: 30 SEP 2006 FY: 2004
INVESTIGATOR:
Sreevatsan, S.
PERFORMING INSTITUTION: Food Animal Health Research
Program.
SUBJECT:
Evolving pathogens, targeted sequences, and strategies for control of
bovine respiratory disease.
NON-TECHNICAL SUMMARY: Chronic
respiratory disease is one of the most important disease problems in cattle.
The project addresses emerging and reemerging agents, pathogenesis, and
intervention strategies of chronic respiratory diseases of cattle.
APPROACH: The new
project will generate data on pathogen patterns and better diagnostic methods
that can be used for better treatment and control measures. Understanding
the mechanisms used by the various agents of BRD to persist on the host, and
produce inflammatory and immune responses are needed fo the characterization of
novel intervention targets that can minimize the use of
antibiotics.
PROGRESS: 2001/10 TO
2006/09This project was terminated.
IMPACT: 2001/10 TO
2006/09This project was terminated.
PUBLICATIONS: 2001/10 TO
2006/09
No publications reported
this period
PROJECT CONTACT:
Name: Sreevatsan, S.
Phone: 330-263-3745 Fax: 330-263-3677
Email: sreevatsan.1@osu.edu
PROJ
TYPE: HATCH PROJ
STATUS: NEW
MULTISTATE PROJ NO:
S-1000 START: 01 OCT 2001 TERM: 30 SEP 2006 FY: 2005
INVESTIGATOR: Keener,
H. M.
PERFORMING INSTITUTION: Food, Agric and Biological Engineering.
SUBJECT:
Animal manure and waste utilization, treatment and nuisance avoidance for
a sustainable agriculture.
NON-TECHNICAL SUMMARY: A. Livestock
manures applied as liquids sometimes move offsite through the soils macropores
to tile lines causing surface water pollution. B. Nutrients in manures
incur high transportation cost and often generate odors when applied in liquid
form. A This project examines ways to minimize offsite movement of applied
liquid manures. B This project is to develop cost effective systems for
converting liquid manures to solid manures by changing manure handling practices
with the focus on composting.
APPROACH: 1. Investigate
rheology of liquid waste as a function of water content. Evaluate flow
through various pore sizes in soil using laboratory and field test plots.
2. Determine kinetic parameters and odor levels during composting of
animal manure/amendment mixes using various aeration patterns in pilot scale
vessels. Determine the rates of decomposition and moistures loss under
full scale windrow composting. Develop simulation models of compost
process and use to optimize design and management of compost systems. 3.
Evaluate new housing concepts for poultry and swine, evaluating the
characteristics of manure generated products along with doing material balances
for N,P,K, and water. Focus of research are belt battery systems for
poultry and high rise hog facilities.
PROGRESS: 2005/01 TO
2005/12 Results reported for: plant growth studies in soilless mixes made
with cardboard bedding/horse manure compost (Wilkinson et al.); dry matter and
NH3 loss when composting dairy manure amended with straw, sawdust and sand
bedding (Michel et al.); concentrations of malodorous volatile chemicals emitted
during composting dairy manure (Willett et al.); spatial and temporal
distributions of air quality on large dairy farms and swine facilities in Ohio
(Zhao et al.); leaching of suspended solids, total dissolved solids, ammonia
nitrogen, phosphorous and potassium from dairy cow manure/sawdust composting in
windrows (Keener et al.). Willet noted during windrow composting, addition
of small quantities of air (1.6 g/kg/hr) was sufficient to maintain aerobic
conditions. Zhao noted for dairy, inside average dust mass concentrations
range from 0.9 to 1.5 mg/m3 and ammonia concentrations range from 1.4 to 3 ppm
in different seasons. Keener reported loss factors for %NH3-N, P and K
from composts for 3 ages of compost, 0, 16.5 and 30 days and noted results can
be applied to the design of control structures for treating runoff from compost
pads. Manuzon reported on the design and efficiency of an NH3 spray
scrubber from emissions from caged layer operations. Noted improved
efficiency if used acid in water. Michel and Grewal and Michel et al.)
reported on persistence of dairy and swine manure pathogens - Escherichia
coli O157:H7, Listeria monocytogenes, Salmonella spp., and
Mycobacterium avium subsp. paratuberculosis (M.
paratuberculosis) during composting (55 degrees C), manure pack (25 degrees
C) and liquid storage. M. paratuberculosis was most persistent of
organisms studied. Evaluation of all results indicate thermophilic
composting should be recommended for manures destined for pathogen sensitive
environments such as vegetable production. Keener and Michel presented
generalized equations for predicting ammonia emissions from all classes of
livestock operations. The analysis uses a control volume approach and
N/ash ratios. It does not require measuring total masses of materials into
and from the system, can be highly accurate for time averaged emissions, and
significantly lower in cost than monitoring ammonia concentrations and airflow
to evaluate NH3 emissions. Darr et al. developed and evaluated a
controller area network's ability to transmit sensor data over the long
transmission distances common to livestock facilities. Effective
transmission distance was directly correlated to the data bus rate. A bus
rates of 50 kbits/sec or less can accurately deliver CAN messages up to 600
meters on a continuous basis. Keener conducted laboratory studies on
liquid dairy and swine manure to determine viscosity and flow rates of manures
through macropores of 7.24 mm (0.285 inches). Dairy manure had a higher
viscosity than the hog manure at comparable moisture level. Results of 7.24 mm
sieve test showed swine manure with solids 13.2% and dairy manure with 5.8% had
flow-abilities 1/10 that of water. Results indicated fresh dairy manure
(12% solids) posses little risk of flow, while swine manure (11% solids) poses a
potential risk.
IMPACT: 2005/01 TO
2005/12 Reduce monitoring cost and accuracy of assessing ammonia
emissions. Modified mass balance approach for evaluating NH3 emissions is
lower cost than current methods of assessing NH3 emissions based on
concentrations and gas flow rates. Lowering manure moisture significantly
reduces potential for preferential flow. Results of studies on manure
viscosity and flow-ability (relative to water) shows that lowering manure
moisture, i.e. increasing solids, would be effective in preventing preferential
flow at time of application.
PUBLICATIONS: 2005/01 TO
2005/12
1. Darr,M.J., Zhao,L.,
Ehsani,M.R., Ward,J.K. and Stombaugh,T.S. 2005. Evaluation of controller area
network data collection system in confined animal feeding operations. pp.
179-187 in Seventh International Livestock Environment Symposium (18-20 May
2005,
3. Keener, H.M. and F.C.
Michel Jr. 2005. Predicting NH3 emissions from manure N for caged layer
facilities. A modified mass balance approach. Symposium on the State of
4. Keener, H.M., T.F.
Wilkinson, F.C. Michel Jr. and L.C. Brown. 2005. Evaluation of leaching from
composting windrows using a rainfall simulator. 2005 Animal Waste
Management Symposium. 10/5-7. Sheraton Imperial Hotel and
8. Manuzon, R.B. (L.Y.
Zhao, advisor). 2005. Development of a Prototype Spray Scrubber for
Reducing Ammonia Emissions from Poultry Facilities Exhaust Fans. MS
Thesis. The
Name: Keener, H. M.
Phone: 330-263-3856 Fax: 330-263-3670
Email: keener.3@osu.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 MAR 1999 TERM: 31
DEC 2001 FY: 2003
INVESTIGATOR: Smith, B. B.
PERFORMING INSTITUTION:
SUBJECT: Pathogenesis of
Mycobacterium paratuberculosis (Johne's disease) in the llama.
NON-TECHNICAL SUMMARY: Johne's disease is a serious intestinal disease in
the llama and alpaca caused by the bacteria Mycobacterium
paratuberculosis which causes ill thrift, chronic weight loss and severe
diarrhea. The purpose of this project is to establish the temporal
relationship between infection and 1) shedding of the bacteria, 2) the time of
onset of clinical symptoms, and 3) the development of antibodies to the
infection.
APPROACH: Six adult and
six juvenile llama pairs will be experimentally infected per os with 5x10(6) CFU
of an IS900 positive strain of MpTB on alternate days for 14 days. Fecal and
serum samples will be collected at prescribed intervals: a) to establish if
viable MpTB can be detected in the feces within hours to days following
ingestion but prior to establishment of an infection, b) to determine the time
lag between exposure and the onset of symptoms, seroconversion, and fecal
shedding of MpTB, c) to test if there is an age relted difference in
susceptibility to MpTB infections, and d) to characterize the development of the
disease under controlled conditions.
PROGRESS: 1999/03 TO
2001/12 Project terminated
IMPACT: 1999/03 TO
2001/12 Data will be available for other studies
PUBLICATIONS: 1999/03 TO
2001/12
None available at this time 2002
PROJECT CONTACT:
Name: Smith, B. B.
Phone: 541-737-6942
Email: smithbr@ccmail.orst.edu
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 01 SEP
2003 TERM: 31 AUG 2008 FY: 2005
INVESTIGATOR: Karns J S; Van Kessel J S;
Whitlock R H
PERFORMING INSTITUTION: Veterinary Preventive Medicine.
Univ of
OBJECTIVES: The
objective of this research is to set up a Pilot Program consisting of two dairy
herds to focus on the protocol development, laboratory set-up, program
logistics, and database and bio-bank development needed to evaluate the impact
of intervention strategies on Johne's disease dynamics, milk and beef quality
(particularly with respect to zoonotic bacterial pathogens), economics and
sustainability through intensive longitudinal follow up of selected
research/demonstration dairy farms. Long term goals are to validate
intervention strategies to support BMP's and to optimize intervention and
monitoring strategies given the constraints on time, labor and financial
resources in modern dairy herds. In addition, a national resource bank
(data and biological specimens on well-characterized animals) will be created
for current and future monitoring and research on dairy cattle diseases.
Emphasis will be on longitudinal data collection on endemic infectious
diseases of public health and animal health concern in dairy herds. APPROACH:
Pathogens are of increasing concern on dairy farms and in dairy products.
The production of safe and wholesome food from US farms requires control
of the production process on the farm. Specific focus areas in this
process are biosecurity, food safety and animal health. To be able to
scientifically support regional process control programs there is a need for
longitudinal research on commercial dairy farms throughout the
PROGRESS: 2003/10 TO
2004/09 4. What were the most significant accomplishments this past year?
4D. This report serves to document research conducted under a Specific
Cooperative Agreement between ARS and the
PUBLICATIONS:
2003/10 TO 2004/09
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 01 SEP
2003 TERM: 31 AUG 2008
INVESTIGATOR: Karns J S; Van Kessel J S; Jayarao B M
PERFORMING INSTITUTION: Veterinary Science.
SUBJECT: Pilot study of factors
affecting maintenance of Mycobacterium, Salmonella, E. coli and Listeria on
dairy farms.
PROGRESS: 2003/10 TO
2004/09 4. What were the most significant accomplishments this past year?
4D. This report serves to document research conducted under a Specific
Cooperative Agreement between ARS and
PUBLICATIONS:
2003/10 TO 2004/09
PROJ
TYPE:
USDA COOPERATIVE AGREEMENT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 58-3625-8-120
START: 01 JUN 1998 TERM:
01 JUN 2001 FY: 2001 GRANT YR: 1998 GRANT AMT: $38,300
INVESTIGATOR: Stabel,
J. R.; Miller, J. M.; Whitlock, R.
PERFORMING INSTITUTION: Clinical Studies.
Univ of
SUBJECT: Biology and immune
response of cattle naturally infected with Mycobacterium
paratuberculosis.
APPROACH: The principal
long term goal of this project is to develop more sensitive and specific
diagnostic tests enabling earlier detection of preclinical paratuberculosis
infection in cattle. Specifically, we will monitor the immune response of cattle
naturally infected with M. paratuberculosis over a three (3) year period.
The immune response to M. paratuberculosis infection will be
monitored using established serological tests, such as the ELISA and gamma
interferon (g-IFN) assays that measure humoral (antibody) specific and
cell-mediated specific immune reactions, respectively. Concurrent
determination of responses in cattle naturally infected with M.
paratuberculosis will help to better define the host-pathogen interaction
and provide a valuable assessment of the comparative sensitivity and specificity
of the ELISA and g-IFN assays as diagnostic tools for diagnosis of M.
paratuberculosis infection in cattle. The results of the serological
tests will be compared to fecal culture results, as well as tissue culture
results for cull animals.
PROGRESS: 2000/10 TO
2001/09 1. What major problem or issue is being resolved and how are you
resolving it? Paratuberculosis (Johne's disease) is a chronic, progressive
enteric disease of ruminants caused by infection with Mycobacterium
paratuberculosis. Economic losses are estimated to be $200/infected
cow/year and are the result of animal culling, reduced milk production, poor
reproductive performance, and reduced carcass value. Research on improved
diagnostic tests for detection of this disease will provide tools for reducing
contamination of the environment with M. paratuberculosis and the spread
of infection within a herd. Research on the pathogenesis and immunology of
M. paratuberculosis infections of cattle is conducted within a specific
cooperative agreement with the
1. Wells, S.J.,
Whitlock, R.H., Lindeman, C., Stabel, J.R. Evaluation of fecal culture pools
for detection of Mycobacterium avium subsp. paratuberculosis in
groups of dairy cows. AAVLD 2000 meeting, Birmingham, AL. 2000.
Abstr. p. 15.
2. Wells, S.J.,
Whitlock, R.H., Stabel, J.R. Descriptive epidemiology of Johne's
disease in an infected dairy herd. International Society for Veterinary
Epidemiology and Economics Meeting. 2000. Abstr. p. 77.
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 01 JAN 1999 TERM: 31
DEC 2003 FY: 2004
INVESTIGATOR: Correll, P. H.
PERFORMING INSTITUTION:
Veterinary Science.
SUBJECT: Role of the STK receptor in macrophage activation and
inflammation.
APPROACH: Utilize
STK-deficient mice to determine whether STK is acting through other known
regulators of NO production. Utilize the RAW264.7 macrophage cell line to
determine the biochemical mechanisms by which STK suppresses NO. Infect
STK-deficient mice with mycobacterium paratuberculosis to determine the effect
of STK on the infection process and its potential role in Johne's and Crohn’s's
disease.
PROGRESS: 1999/01 TO
2003/12 Macrophages are a diverse and dynamic population of cells
that play a key role in host defense as well as in the maintenance of normal
tissue structure and function. However, inappropriate activation of
macrophages can promote inflammation and tissue damage through the production of
inflammatory mediators, such as nitric oxide, and the support of Th1
differentiation and the production of IFN-(gamma) which feeds back positively to
further activate pro-inflammatory macrophage activities. It has been
suggested that changes in the threshold of signal required for classical
macrophage activation may promote the progression of autoimmune disease by
enhancing Th1 differentiation through the upregulation of IL-12 and MHC Class
II, thus generating a positive feedback loop for further tissue destruction.
We propose that the threshold for classical macrophage activation is set,
in part, by the expression of receptor tyrosine kinases (RTKs) on these cells
and that RTKs may represent a new class of therapeutic targets for regulating
the tissue-damaging effects of autoimmunity. We have shown previously that
the STK receptor tyrosine kinase inhibits the production of nitric oxide through
the downregulation of inducible nitric oxide synthase (iNOS) expression while,
at the same time enhancing expression of arginase, an enzyme that competes with
iNOS for the substrate, L-arginine, resulting in cell proliferation and matrix
synthesis. Thus we concluded that the expression of STK on tissue-resident
macrophages tips the balance of these cells from cytotoxic mediators to cells
with more reparative functions. More recently, we have shown that STK
inhibits the production of IL-12 and the expression of MHC Class II by
macrophages, resulting in a reduction in the ability of these cells to support
Th1 differentiation in vitro. Subsequently, mice with a targeted deletion
in STK are more susceptible to endotoxic shock and exhibit more inflammation in
a delayed-type hypersensitivity response. In the past year, we have set
out to determine whether the expression of the STK receptor tyrosine kinase on
tissue-resident macrophages regulates the progression of autoimmunity. Our
preliminary data suggests that the progression of autoimmune disease is
dramatically enhanced in the absence of STK.
IMPACT: 1999/01 TO
2003/12 Regulation of macrophage activation is critical in order to
maintain a balance between an effective immune response and
inflammatory-mediated tissue damage and cell death. This work is an
important step toward understanding the regulatory mechanisms that govern
macrophage activation and may eventually lead to the identification of targets
for regulating chronic inflammation.
PUBLICATIONS: 1999/01 TO
2003/12
1. Forgie A, Wyatt S,
Correll PH and Davies AM. 2003. Macrophage stimulating protein (MSP) is a
novel target-derived neurotrophic factor for developing sensory and sympathetic
neurons. Development. 130 (5): 995-1002.
2. Teal HE, Craici A,
Paulson RF and Correll PH. 2003. MSP potentiates erythropoietin receptor
signaling in primary erythroid progenitors. J Hem Stem Cell Res 12,
165-177.
3. Lutz MA, Liu Q-P and
Correll PH. 2003. Activation of complement-mediated phagocytosis by MSP
requires the RON receptor, tyrosine kinase activity, phosphatidylinositol
3-kinase and protein kinase C-(geta). J Leuko Biol 73 (6),
802-814
PROJ
TYPE: SPECIAL GRANT
PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2005-34163-16014
PROPOSAL NO: 2005-06119
START: 01 AUG 2005 TERM: 31 JUL 2007 FY: 2005 GRANT
YR: 2005 GRANT AMT: $656,525
INVESTIGATOR: Jayarao, B. M.; Perdew, G.; Key,
D.; Love, B. C.; DebRoy, C.; Narasimha, H. V.; Heinrichs, A.; Wolfgang, D. R.
PERFORMING INSTITUTION: Veterinary Science.
SUBJECT:
Bioreporter and molecular beacon-based technologies for detection of
organic toxicants and bacterial pathogens in milk and milk products.
NON-TECHNICAL SUMMARY: Develop state of the art diagnostics for
detection of organic toxicants and foodborne pathogens in milk and milk products
This project will focus on developing reliable and highly sensitive assays
for detection of organic toxicants and foodborne pathogens in milk and milk
products that can be used for monitoring and safeguarding milk supply and milk
products.
OBJECTIVES: PROJECT 1: Bioreporter-based technology for detection
of organic toxicants directly from milk and milk products Objective 1.1 Develop
promoter-reporter gene constructs for detection of BETTX (benzene, ethylbenzene,
toluene, trichloroethylene, and xylene) and PCBs. Objective 1.2
Standardize bioreporter assays for detection of BETTX (benzene, ethylbenzene,
toluene, trichloroethylene, and xylene) and PCBs in milk and milk products.
Objective 1.3 Survey milk and milk products for BETTX (benzene,
ethylbenzene, toluene, trichloroethylene, and xylene) and PCBs along the food
chain continuum.
APPROACH: PROJECT 1: The toluene degradation operon
(tod) that degrades benzene, ethylbenzene, toluene, tricloroethylene, and xylene
(BETTX) will be amplified from the genomic DNA of the Pseudomonas putida
(ATCC53902). The primers for the PCR amplification for the tod promoter and
regulator elements will be designed using the tod sequence reported by Mosqueda
and Ramos (2000). The biphenyl dioxygenase gene (bphA1) has been shown to
degrade PCBs. The gene will be amplified from genomic DNA of the
Burkholderia cepacia (ATCC 55487). The primers for PCR
amplification for the bphA1gene will be designed using the bphA1gene sequence
(AJ251217) in the NCBI nucleotide database. The PCR amplified product will
be cloned in to pGlow-TOPO vector (Invitrogen,
PROJECT
CONTACT:
Name: Jayarao, B. M.
Phone: 814-863-5939 Fax: 814-863-6140
Email:
bmj3@psu.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 98-35204-6705
START: 01 SEP 1998 TERM: 31 AUG
2003 FY: 2003 GRANT YR: 1998 GRANT AMT: $300,000
INVESTIGATOR: Sweeney, R.;
Scott, P.
PERFORMING INSTITUTION:
SUBJECT: Role of cytokines in
immune response to paratuberculosis vaccination in cattle.
APPROACH: Calves will be
infected by oral challenge with live M. paratuberculosis during the first
week of life, then vaccinated at 14 days old using bacterin with or without
IL-12. One month after vaccination, calves will be euthanized and
peripheral blood, cells from the lymph node draining the vaccination site and
ileocecal lymph node cells will be harvested. Lymphocytes will be cultured
and antigen-specific lymphoproliferation and IFN-g production measured.
Cytokine gene expression will be measured using RT-PCR. Humoral
antibody responses in serum will be measured by ELISA. Some of the calves
will be housed in isolation for 20 months and monitored for immune response and
fecal shedding of M. paratuberculosis and clinical signs of disease.
Calves will be euthanized and tissues will be harvested by lymphocyte
culture and cytokine RT-PCR as above. Extensive postmortem quantitative
mycobacterium cultures of numerous tissues will be performed to compare severity
of infection between groups.
PROGRESS: 1998/09 TO
2003/08 Calves were given subcutaneous commercially available
paratuberculosis vaccine with or without human recombinant IL-12, and challenged
orally with field strain live Mycobacterium paratuberculosis.
Subcutaneous vaccination induced an immune response in local lymph node
and mesenteric lymph node, as measured by antigen-specific interferon-gamma
production by lymph node cells. However, vaccination did not prevent
colonization of the intestines with M. paratuberculosis organisms.
When IL-12 was included, the intensity of the interferon-gamma response
was not enhanced, but the cytokine gene expression for IL-10 was reduced.
In contrast with the commercially available vaccine, subcutaneous
vaccination with a heat-killed field isolate M. paratuberculosis resulted
in significant reduction in Mycobacterium tissue loads, compared with
non-vaccinated controls. Inclusion of IL-12 resulted in sterile immunity
in some calves, but infection was not prevented in all animals. In an
attempt to better enhance mucosal immunity to paratuberculosis, oral vaccination
was attempted in preliminary experiments. Calves were orally inoculated
with heat-killed field isolate of M. paratuberculosis within the first 24
hours of life, then challenged with homologous live field strain oraganisms.
Oral vaccination resulted in a less intense interferon-gamma response than
that induced by subcutaneous vaccination. However, preliminary results
suggest vaccinated calves may have a reduced tissue load compared with
unvaccinated controls.
IMPACT: 1998/09 TO
2003/08 The results of these experiments suggest that vaccination for
paratuberculosis has the potential to prevent colonization with M.
paratuberculosis organisms. However, the currently commercially
available product may not protect as well as vaccines prepared from
field-isolate strains of the organism. The results of these studies can
help guide future research directed at developing vaccine strains of organism
that can be given orally to protect against paratuberculosis
infection.
PUBLICATIONS: 1998/09 TO
2003/081.
1. Uzonna, J.E., Chilton, P., 'Whitlock, R.H., Habecker, P.L.,
Scott, P. and Sweeney, R.W. 2003. Efficacy of commercial and field-strain
Mycobacterium paratuberculosis vaccinations with recombinant IL-12 in a
bovine experimental infection model. Vaccine.
21:3101-3109.
2. Uzonna, J.E.,
Whitlock, R.H., Scott, P. and Sweeney, R.W. Oral vaccination for
paratuberculosis in calves. 2002. Proceedings 7th International
Colloquium on Paratuberculosis,
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JAN 1999 TERM: 31
DEC 2001 FY: 2002
INVESTIGATOR: Sweeney, R.
PERFORMING INSTITUTION:
OBJECTIVES:
Paratuberculosis (Johne's Disease) is a progressive and ultimately fatal
infection in cows caused by Mycobacterium paratuberculosis.
Currently available vaccines are not effective for preventing Johne's
Disease. The overall goal is to determine the characteristics of the host
immune response to M. paratuberculosis vaccination that result in
susceptibility or resistance to Johne's disease.
APPROACH: Determine the
nature of the early local, systemic and intestinal immune response to
subcutaneous M. paratuberculosis vaccination with or without IL-12
infected calves. Correlate the early immune response following vaccination
to clinical response and oral challenge.
PROGRESS: 1999/01 TO
2001/12 Subcutaneous vaccination with commercially available M.
paratuberculosis vaccine induced both systemic and local (gut)
interferon-gamma producing lymphocytes, but calves were not protected from
challenge infection with live M. paratuberculosis organisms.
However, when calves were given subcutaneous vaccine produced from
heat-killed field strain M. paratuberculosis, augmented with IL-12, there
was a significant reduction in number of CFU of M. paratuberculosis
recovered from tissues 4 weeks after challenge infection with virulent M.
paratuberculosis.
PUBLICATIONS: 1999/01 TO
2001/12
No publications reported
this period
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 SEP 2000 TERM: 31 AUG 2002
FY: 2002
INVESTIGATOR: Whitlock, R.
PERFORMING INSTITUTION:
SUBJECT: Molecular diagnostics for mycobacterial
diseases in alpacas.
APPROACH: Prepare serial
dilutions of M. paratuberculosis that we have grown. Aliquots will
be saved for future PCR experiments to determine the lower limit of sensitivity
of detection with PCR-DNA probe test. The lower limit of detection will be
determined in triplicate with two methods 1) in media and 2) by spiking fecal
samples from alpacas known to be free of disease. These experiments should
provide an index of the lower limit of detection of the PCR probe. The
same serial dilutions will be mixed with alpaca fecal pellets to determine the
lower limit of detection by the PCR test. Immunomagnetic beads will then be
evaluated to further improve sensivitity of the best DNA extraction method.
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 15 MAY 2001 TERM: 30 NOV 2002
FY: 2002
INVESTIGATOR: Whitlock, R.
PERFORMING INSTITUTION:
SUBJECT: Immunomagnet separation assay for M.
paratuberculosis.
APPROACH: Development,
evaluation and selection of antibodies recognizing surface structures on M.
paratuberculosis and suitable for immunocapture of organisms as whole cell
antibodies and antibodies specific for LAM, a362 and p35 antigens.
Development of immunomagnetic separation (IMS) reagents and methods for
separation of M. paratuberculosis from stool samples, tissue samples and
other matrices (e.g., milk or water concentrates). Development of
alternative solid phase immunocapture methods designed to improve sample
processing throughput. Test immunocapture method in conjunction with
PCR-detection of enhancement of PCR sensitivity and streamlining of overall
process.
PROJ
TYPE:
STATE PROJ STATUS: NEW
START: 01 JAN 2005 TERM: 31 DEC 2006
FY: 2005
INVESTIGATOR: Sweeney, R.
PERFORMING INSTITUTION:
SUBJECT:
Oral vaccination for Johne's disease in cattle.
NON-TECHNICAL
SUMMARY: Johne's disease is widespread, costly and incurable in cattle. An
effective oral vaccine will significantly enhance efforts to eliminate Johne's
disease from infected herds.
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 JUL 2006 TERM: 30 JUN 2011
INVESTIGATOR: Fitts, M. G.
PERFORMING INSTITUTION: Livestock-Poultry
Health.
SUBJECT: Metabolic profiling of microbes of
economic and animal health significance.
NON-TECHNICAL SUMMARY:
Mycobacterium avium subsp. paratuberculosis is the causative agent
of Johne's disease and a suspect agent in Crohn’s's disease. Some estimates have
the economic loss to the
APPROACH: In-house and
reference strain microbes are cultured on select solid media either alone or
co-cultured with another microbe of interest and harvested at different time
intervals. Bacterial suspensions are heated and bacterial debris removed
by centrifugation. The resulting supernatant is applied to a size
exclusion column to collect a fraction containing molecules less than 3,000
daltons. These extracts are applied to a liquid chromatography - mass
spectrometer (LC-MS) to identify small molecules of interest. Selected
molecules that cannot be matched to any libraries will be submitted to the
Name: Fitts, M. G.
Phone: 803-788-2260 Fax: 803-699-8910
Email:
mfitts@clemson.edu
PROJ
TYPE:
HATCH PROJ STATUS: TERMINATED
START: 01 JAN 2000 TERM: 30
SEP 2002 FY: 2001
INVESTIGATOR: Christopher-Hennings, J.; Nelson, E. A.;
Epperson, W.; Chase, C. C.; Henning, D.
PERFORMING INSTITUTION: Veterinary
Science.
SUBJECT:
Johne's disease in cattle and buffalo (bison): a
NON-TECHNICAL
SUMMARY: Diagnosis of Johne's disease is difficult since current serology,
culture and PCR techniques are not adequate in identifying subclinical carriers.
We propose to develop a sensitive, rapid, high-throughput PCR for
detection and quantitation of Mycobacterium paratuberculosis in cattle,
buffalo and colostrum and milk products for human consumption and describe the
pathogenesis in young cattle.
IMPACT: 2000/01 TO
2002/09 The impact of this research has been to provide valuable
information to veterinary diagnostic laboratories using these PCR assays and
culture to detect M. paratuberculosis. The development of the
real-time PCR demonstrated that the sensitivity of the assay is statistically
equal to that of culture, which will lessen the amount of time necessary for
detection. It also provides the basis for further pathogenesis studies of
Johne's Disease by allowing for quantitation and rapid detection of the
organism. The time required for detection of the bacteria has been
decreased dramatically with use of the real-time PCR assay and will allow for
more rapid detection of Johne's infected animals which will assist in the
voluntary Johne's Certification Programs. This study also determined that
the real-time PCR will detect M. paratuberculosis in bison, which will be
useful in establishing Johne's-free bison herds.
PUBLICATIONS: 2000/01 TO
2002/09
1. Christopher-Hennings
J., M. A. Dammen, S. R. Weeks, W. B. Epperson, S. N. Singh, G. L. Steinlicht, Y.
Fang, J. L. Skaare, J. L. Larsen, J. B. Payeur, E. A. Nelson. 2003.
Comparison of two DNA extractions and nested PCR, real-time PCR, a new
commercial PCR assay and bacterial culture for detection of Mycobacterium
avium subsp. paratuberculosis in bovine feces. J. Vet. Diagn.
Invest. 15:000-000. (in press)
2. Fang Y., W-H Wu, J.
L. Pepper, J. L. Larsen, S. A. E. Marras, E. A. Nelson, W. B. Epperson, J.
Christopher-Hennings. 2002. Comparison of real-time, quantitative PCR with
molecular beacons to nested PCR and culture methods for detection of
Mycobacterium avium subsp. paratuberculosis in bovine fecal
samples. J. Clin. Microbiol. 40:287-291.
3. Skaare J., Y. Fang,
M. Dammen, S. Weeks, W. Epperson, S. Singh, G. Steinlicht, J. Larsen, J. Payeur,
E. Nelson, J. Christopher-Hennings. 2002. Comparison of two DNA extractions
and nested PCR, real-time PCR, a new commercial PCR assay and bacterial culture
for detection of Mycobacterium avium sbsp. paratuberculosis in
bovine feces. American Association of Veterinary Laboratory
Diagnosticians,
PROJECT
CONTACT:
Name: Christopher-Hennings,
J. Phone: 605-688-5171 Fax: 605-688-6003
Email:
Jane_Christopher-Hennings@sdstate.edu
PROJ
TYPE:
HATCH PROJ STATUS: NEW
START: 01 OCT 2003 TERM: 30 SEP 2008
FY: 2005
INVESTIGATOR: Speer, C. A.
PERFORMING INSTITUTION: Forestry
Fisheries & Wildlife.
SUBJECT:
Development of an early diagnostic test for Johne's disease in
cattle.
NON-TECHNICAL SUMMARY: Johne's disease affects
numerous ruminants (including cattle) in which it is characterized as a chronic
wasting disease. Losses are estimated at $250 million annually in the
APPROACH: Generate
monoclonal antibodies against Ag85a peptides and then test for reactivity and
specificity against Ag85a from M. a. paratuberculosis in sera of infected
cattle.
PROGRESS: 2005/01 TO
2005/12 Mycobacterium avium subsp. paratuberculosis (MAP) is the
etiologic agent of Johne's disesase (JD), which occurs worldwide affecting many
domestic and wild animals including cattle, sheep and many other ruminants.
Infections with MAP often lead to chronic granulomatous enteritis with
clinical signs of diarrhea, weight loss, decreased milk production and
mortality. To date, there are no effective diagnostic tests,
chemotherapeutics or vaccines for JD. Until now, the fecal culture test
with a sensitivity level of 38% was considered the best diagnostic test for JD
and no JD diagnostic test is capable of detecting prepatent MAP infections.
We have developed a flow cytometric method (FCM) for the diagnosis of JD
in cattle that has diagnostic sensitivity and specificity levels of 95.2% and
96.7%, respectively. Compared to the fecal culture test and commercially
available ELISA tests, the FCM detected MAP infections 6-44 months earlier than
the fecal culture test and 17-67 months earlier than a commercial ELISA.
Recently, by using information gleaned from the FCM, we converted the FCM
test to an ELISA format that has diagnostic specificity and sensitivity rates
equal to that of the FCM. Our ELISA for JD is also capable of detecting
early, prepatent MAP infections.
IMPACT: 2005/01 TO
2005/12 Johne's disease costs the
PUBLICATIONS: 2005/01 TO
2005/12
Eda, S., B. Elliott,
M.D. Scott, W.R. Waters, J.P. Bannantine, R.H. Whitlock, and
PROJ
TYPE:
HATCH PROJ STATUS: REVISED
START: 15 JUL 2004 TERM: 14 JUL
2009 FY: 2005
INVESTIGATOR: Adams, L. G.; Ficht, T. A.; Ficht, A. R.;
Womack, J. E.; Thomas, T. L.; Baumler, A. J.; Tsolis, R. M.; Zhu, G.; Clarke, N.
P.; Walker, D. H.; Peters, C. J.; Yilma, T.
PERFORMING INSTITUTION:
Veterinary Pathobiology. Texas A&M Univ.
SUBJECT: Molecular pathogenesis
of emerging & zoonotic intracellular pathogens of ruminants as the basis for
improved diagnosis and vaccination.
NON-TECHNICAL SUMMARY: This will
provide deterrents to biological warfare through innate resistant cattle,
biosignatures for diagnostics, and improved vaccines. The outcomes from
these projects have application for improving public health, producing safer
foods and minimizing agricultural and human bioterrorism.
PROGRESS: 2005/01 TO
2005/12 Molecular Basis of Disease Processes. Gene expression analyses for
both cattle and select agents has been implemented to expand the knowledge base
using bioinformatic and computational biologic analyses to identify host
biosignature gene expression and biomarker patterns that will be explored as
rationales for rapid diagnostics and improved vaccines. Diagnostics: FMDV,
RVFV and AI and Brucella abortus diagnostic assays were developed,
implemented and are being evaluated for specificity and sensitivity on samples
of known status. Antigens for ELISA-based diagnostic tests for FMD, RVF,
BRU, and AI are being developed under BSL-2 conditions for antigen expression
systems for direct application in currently robotics systems as well as lateral
flow immunoassays (LFIA). Biomarker candidates for brucellosis for have
been identified using banked sera from infected and control cattle. A
functional LFIA has been implemented which distinguishes high pathogenicity H5N1
from low pathogenicity H7N1 AIV strains. Vaccines: Candidate vaccines are
being constructed through site-directed or transposon mutagenesis and/or antigen
expression in alphavirus replicons or vacciniapoxvirus systems for testing
protective immunity against RVF, BRU and AI. These vaccines are being
screened through in vitro target host cell culture systems, followed by
evaluation for in vivo safety, immunogenicity and protection in laboratory
animals and ruminants. Innate Disease Resistance: Candidate resistance
genes against FMD, RVF and brucrllosis, including Toll-Like Receptor (TLR) and
Nucleotide Oligomerization Domain (NOD) genes, have been mapped to their
specific location on cattle chromosomes and partially sequenced.
Identification of RVFV resistance genes in rats are being pursued as a
homolog for ruminants, attempts are made for re-derivation of frozen rat
embryos. IMPACT: 2005/01 TO 2005/12 Specific deliverable products
that address the priority areas are targeted including new methods for
detection, diagnosis, and immunization, as well as better understanding of the
genetic basis for host-pathogen interactions. Development and
implementation of new technologies and capabilities focused on the four major
representative diseases is expected to be provide broad, flexible platforms
applicable to emerging diseases and many forms of animal bioterrorism. The
products of related research projects are expected to yield a better
understanding of the molecular basis for the disease processes of select agents;
improved, more reliable diagnostics; and more rational and innovative
development of vaccines that will not compromise internationally standardized
diagnostic assays. The impact of new deliverables to priority areas will
serve as input to disease modeling so that the impact of these deliverables can
be estimated in the prevention, detection, response and recovery from emerging
diseases and agrobioterrorist events.
PUBLICATIONS: 2005/01 TO
2005/12
1. Raffatellu, M.,
3. Gorton, T. S.,
Barnett, M. M., Gull, T., French, R. A., Lu, Z., Kutish, G. F.,
PROJECT
CONTACT:
Name: Adams, L. G.
Phone: 979-845-9816 Fax: 979-862-1088
Email:
gadams@cvm.tamu.edu
URL:
http://www.cvm.tamu.edu/vtpb
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 06 AUG 1998 TERM: 05
AUG 2004 FY: 2005
INVESTIGATOR: Brumbaugh, G. W.
PERFORMING INSTITUTION:
SUBJECT:
Physiologic, pathophysiologic, and pharmacologic management of animal
health.
NON-TECHNICAL SUMMARY: Management practices to enhance or
sustain health of animals become outdated with the introduction of new
technology and research findings. This project will critically and
rationally evaluate published information about continued or new animal health
issues and application of techniques in order to develop rational management
practices or to eliminate irrational practices.
APPROACH: Critical and
rational evaluation of published information about continued or new animal
health issues and application of techniques to evaluate processes involved in
order to develop rational management practices or to eliminate irrational
practices.
PROGRESS: 1998/08 TO
2004/08 The susceptibility in vitro of Mycobacterium avium sbsp.
paratuberculosis to monensin sodium and to tilmicosin phosphate were
evaluated. Subsequent to exposure to those compounds, the infectivitiy of
the organism in vivo was evaluated using a murine model. This project
contributed to the knowledge base about the organism's response to two chemical
agents that may be evaluated as part of the control of cattle with bovine
paratuberculosis, globally.
IMPACT: 1998/08 TO
2004/08 The two compounds evaluated are commonly used in cattle around the
world for other indications. Bovine paratuberculosis is a globally
recognized disease for which there is no treatment and for which control
measures are customized. With results of this study, studies with diseased
cattle should be conducted next to evaluate the role of these compounds for the
control of this disease.
PUBLICATIONS: 1998/08 TO
2004/08
Brumbaugh GW. Simpson
RB, Edwards JF, Anders DR, Thomson TD. 2003. Susceptibility of
Mycobacterium avium sbsp. paratuberculosis to monensin sodium or
tilmicosin phosphate in vitro and resultant infectivity in a murine model.
(Accepted for publication, 2004, Canadian Journal of Veterinary
Research)
PROJECT
CONTACT:
Name: Brumbaugh, G. W.
Phone: 979-845-7257. Fax: 979-845-6544
Email:
gbrumbaugh@cvm.tamu.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 FEB 2001
TERM: 30 SEP 2003 FY: 2003
INVESTIGATOR: Ficht, T. A.; Adams, L. G.; Ficht,
A. R.
PERFORMING INSTITUTION: Veterinary Pathobiology. Texas A&M
Univ.
SUBJECT:
Host-agent interaction and molecular typing of Mycobacterium avium subst.
[sic] paratuberculosis.
NON-TECHNICAL SUMMARY: Gene
expression in host (mammalian) cells will be monitored following exposure to
Mycobacterium avium subsp. paratuberculosis the causative agent of
Johne's disease. Activated gene expression in response to the infectious
agent will provide insight to the mechanism of disease and possible provide
diagnostic reagents used to identify infected animals. Genetic markers
within the agent itself are also sought in an attempt to identify host and
virulence specific activities.
APPROACH: The close
relationship between Mycobacterium avium subsp. avium (MapTB) and
M. avium subsp. avium (M. Avium) has complicated diagnosis,
yet these organisms have completely different outcomes in ruminant infection.
The work proposed is designed to take advantage of these differences by
comparing the interaction of both organisms with the bovine gut. To this
end, we will compare gene expression in host cells, in response to infection
with MapTB and M. avium. Gene expression will be evaluated in vitro
in macrophages and in ileal Peyer's patches (IPP) of ligated loops and
mesenteric lymph nodes (MLN). Variation among Map Tb isolates has been
described for surface antigens, virulence, and hose range. Sheep and
bovine isolates exhibit variation that my reflect preferences for a particular
host or changes in response to a host. The ability to identify markers for
each of these variables is the first step in identifying the genes responsible
for infection or persistence in a particular host. We propose the use of
AFLP (amplified fragment length polymorphisms) to characterize the genetic
diversity among Map Tb isolates.
PROGRESS: 2001/02 TO
2003/09 AFLP (amplified fragment polymorphism) has been employed to
compare Mycobacterium avium subsp. avium (M. avium) and
Mycobacterium avium subsp paratuberculosis (MparaTb) for genetic
differences that may be used as diagnostic probes that vary between or within
subspecies. Ninety-six AFLP primer sets have been employed to characterize
20 MparaTb field isolates, one ATCC MparaTb isolate (ATCC 19698), and two M.
avium isolates (ATCC 35716 and Mac 104). Specifically, 16 MseI primers
bearing selective dinucleotides at the 3?end were used in combination with PstI
primers also bearing 3? selective dinucleotides. Using specific primer
sets, diagnostic patterns have been established for the identification of
MparaTb isolates when compared with the ATCC strain of M. avium or with a
field isolate of M. avium (Mac 104). Four AFLP fragments unique to
the MparaTb genome have been cloned and sequenced. Primers were generated within
these regions and all MparaTb isolates used in this study produced an
appropriate PCR product for at least two of the four primer sets developed.
The M. avium isolates failed to act as templates for all of these
primer sets. This work also revealed the presence of polymorphisms in the
genome of MparaTb and this data provides a sound foundation for the use of a
multiplex diagnostic PCR for to detect MparaTb isolates. Among the MparaTb
specific sequences one revealed a 5,145bp region missing from the M.
avium genome that has sequence homology to genes responsible for
integrase/recombinase function. Additional MparaTb-specific AFLP bands
have been cloned and are being tested for their diagnostic and epidemiological
value. A variety of signals may initiate the intestinal response to MapTb
infection, including the transient expression of chemokine genes. In
calf-ileal loop experiments, real time PCR was used to determine cytokine
expression levels. The results were normalized to a target mRNA, GAPDH,
and expressed 2-ddCT. A 14-fold stimulation of GRO a transcription (4 hr)
and a 12-fold increase in GRO g transcription (8 hr) relative to GADPH was
observed. There were increases in the transcription of GCP1 (4-fold) and
GCP2 (6-fold). MCP1 (6-fold) and MCP2 (11-fold) transcription reached an optimum
at 4 hours post infection. These were accompanied by the expected
stimulation of IL1beta (14-fold) transcription. Expression of GRO may be
under the control of IL-1 and/or TNF. Our results suggest involvement of
IL-1 on GRO expression. These results support the contention that
differential activation of granulocyte and monocyte chemotactic cytokines may
play a major role in the pathogenesis of Maptb infection. It will be
interesting to compare these results with that obtained using the closely
related organism M. avium.
IMPACT: 2001/02 TO
2003/09 MparaTB isolates will be fingerprinted in an effort to
epidemiologically track outbreaks of infection. Differences between M
avium and MparaTB may be used to identify gene functions controlling
virulence and host range.
PUBLICATIONS: 2001/02 TO
2003/09
1. O’Shea, B., et
al., Genotyping and Characterization of Mycobacterium avium subsp.
paratuberculosis using amplified fragment length polymorphism for the use
as a diagnostic tool. 2003.
2. Khare, S., et al.,
Rapid and sensitive detection of Mycobacterium avium subsp.
paratuberculosis in bovine and American bison milk and fecal samples
by an immunomagnetic bead real-time PCR. Infection and Immunity,
2002. Submitted for publication.
PROJECT
CONTACT:
Name: Ficht, T. A.
Phone: 979-845-4118. Fax: 979-862-1088
Email:
tficht@cvm.tamu.edu
PROJ
TYPE: NRI COMPETITIVE
GRANT PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO:
2005-35204-16087 PROPOSAL NO: 2005-01639 START: 01 SEP 2005 TERM: 31 AUG 2008
FY: 2005 GRANT YR: 2005 GRANT AMT: $314,984
INVESTIGATOR: Fosgate, G. T.;
Norby, B.; Ward, M. P.; Gayle, L.; Ellis, D.
PERFORMING INSTITUTION:
Veterinary Integrative Biosciences. Texas A&M Univ.
SUBJECT: Foreign animal disease
surveillance systems for the future: evaluation of methods for data acquisition
and analysis.
NON-TECHNICAL SUMMARY: The intentional or accidental
introduction of a foreign animal disease poses a great risk to the animal
agriculture industry of the
APPROACH: A practitioner network has been
formed based on the American Veterinary Medicine Association (AVMA) member
directory. A brief mailing was performed describing the objectives of the
current proposal and included a postcard for the veterinarian to return stating
his or her interest level in participating in this type of study.
Educational materials will be developed concerning foreign animal disease
diagnosis and surveillance and distributed to the veterinarians participating in
this network in addition to currently available materials such as the CD version
of the Grey Book available from the United States Animal Health Association
(USAHA). A monthly newsletter will be created including a disease of the
month feature spotlighting pertinent pathological and epidemiological
characteristics of different foreign animal diseases. The newsletter will
also contain updates concerning the research activities including the number of
samples submitted and disease prevalences. Practitioners enrolled as part
of the surveillance network will be requested to submit serum samples from
cattle with illnesses that cannot be definitively diagnosed based exclusively on
physical exam findings. Practitioners will be asked to submit serum and
data from 2 cattle per month over a 2-year sample collection period. A
random sample of serum specimens submitted to the State-Federal Laboratory in
PROJECT
CONTACT:
Name: Fosgate, G. T.
Phone: 979-845-3203. Fax: 979-847-8981
Email:
gfosgate@cvm.tamu.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO: 2002-35204-12634 PROPOSAL NO: 2002-02212
START: 01 SEP 2002 TERM: 31 AUG 2005 GRANT YR: 2002 GRANT AMT: $249,000
INVESTIGATOR: Ficht, A. R.; Ficht, T. A.; Adams, G. L.
PERFORMING
INSTITUTION:
SUBJECT:
Genetic diversity applied to the diagnosis and epidemiology of
Mycobacterium avium paratuberculosis.
NON-TECHNICAL SUMMARY: Johne's
disease ('paratuberculosis') is a chronic, infectious, wasting disease with
significant impact on herd productivity resulting in a corresponding economic
loss to
IMPACT: 2002/09 TO
2003/08 The work we have completed will enable a rapid diagnostic test to
be put in place utilizing isolation of organisms from milk or feces followed by
PCR. This test will enable a diagnosis within a matter of days rather than
the 6 or more weeks normally required for culture growth and identification.
As we continue to investigate a spectrum of field isolates and analyze
them via AFLP, we will identify more DNA targets and additional PCR diagnostic
primer sets that will facilitate not only identification of M.
paratuberculosis isolates, but epidemiological tracking of organisms.
PUBLICATIONS: 2002/09 TO
2003/08
1. O'Shea, Brian, Khare,
Sangeeta, Bliss, Katherine, Klein, Patricia, Ficht, Thomas A., Adams, L. Garry,
Rice-Ficht, Allison C. (2003) Genotyping and characterization of
Mycobacterium avium subsp. paratuberculosis using amplified
fragment length polymorphism (submitted).
2. O'Shea, Brian (2002)
International Conference on Emerging Infectious Diseases;
PROJECT
CONTACT:
Name: Ficht, A. R.
Phone: 979-458-1024 Fax: 979-847-9481
Email:
a-ficht@tamu.edu
PROJ
TYPE:
STATE PROJ STATUS: TERMINATED
START: 01 JUL 2000 TERM: 31
DEC 2003 FY: 2004
INVESTIGATOR: Bingham, H. R.; Bagley, C. V.
PERFORMING
INSTITUTION: Animal Dairy & Vet Science.
SUBJECT: Seroprevalence of Mycobacterium avium subspecies
paratuberculosis in
NON-TECHNICAL SUMMARY: Dairy and beef cattle
infected with the bacteria Mycobacterium paratuberculosis may eventually
develop chronic diarrhea (commonly known as Johne's disease) which decreases the
market value and productivity of the infected animal and spreads the organism to
uninfected cattle. This research will estimate the prevalence of
Mycobacterium paratuberculosis infection in
No publications reported
this period
PROJECT
CONTACT:
Name: Bingham, H. R.
Phone: 435-797-7146. Fax: 435-797-3959
Email:
hbingham@cc.usu.edu
PROJ
TYPE: USDA
COOPERATIVE AGREEMENT PROJ STATUS: NEW
START: 30 SEP 2004 TERM: 29
SEP 2009
INVESTIGATOR: Karns J S; Smith J; Van Kessel J S.
PERFORMING
INSTITUTION:
SUBJECT: Pilot study of factors affecting
maintenance of Mycobacterium, Salmonella, E. coli and Listeria on dairy farms.
OBJECTIVES: The objective of this research is to identify and
characterize a third dairy herd to be included in a Pilot Program that currently
consists of two dairy herds and which focuses on the protocol development,
laboratory set-up, program logistics, and database and bio-bank development
needed to evaluatesuch that the impact of intervention strategies on Johne's
disease dynamics, milk and beef quality (particularly with respect to zoonotic
bacterial pathogens), economics and sustainability can be evaluated through
intensive longitudinal follow up of selected research/demonstration dairy farms.
Long-term goals are to validate intervention strategies to support best
management practices (BMPs) and to optimize intervention and monitoring
strategies given the constraints on time, labor and financial resources in
modern dairy herds. In addition, a national resource bank (data and
biological specimens on well-characterized animals) will be created for current
and future monitoring and research on dairy cattle diseases. Emphasis will
be on longitudinal data collection on endemic infectious diseases of public
health and animal health concern in dairy herds.
APPROACH: Pathogens are of
increasing concern on dairy farms and in dairy products. The production of
safe and wholesome food from US farms requires control of the production process
on the farm. Specific focus areas in this process are biosecurity, food
safety and animal health. To be able to scientifically support regional
process control programs there is a need for longitudinal research on commercial
dairy farms throughout the
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: NEW
START: 01 JUL 2005 TERM: 30
JUN 2006 FY: 2005
INVESTIGATOR: Boyle, S. M.; Sriranganathan, N.;
Gwazdauskas, F. C.
PERFORMING INSTITUTION:
SUBJECT: Immune response in
cattle to Brucella abortus RB51 over-expressing protective antigens.
NON-TECHNICAL SUMMARY: Current vaccines against brucellosis do not afford
specific protection against other cattle diseases. The development of a
multivalent vaccine to protect against brucellosis and other cattle diseases
would make vaccination programs more cost effective. This project assesses
the ability of a second generation vaccine derived from vaccine strain RB51 to
induce antibodies or cellular immune responses consistent with protection
against mycobacterium infections.
APPROACH: Our ability to
raise healthy cattle, free of zoonotic diseases such as Brucella spp.,
has had a positive impact on both the health and expenditures of producers and
consumers of animal foods in
PUBLICATIONS: 2004/10 TO
2005/09
No publications reported
this period
PROJECT
CONTACT:
Name: Boyle, S. M.
Phone: 540-231-4641 Fax: 540-231-3426
Email:
smboyle@vt.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: REVISED
START: 01 NOV 2003 TERM:
31 OCT 2006 FY: 2005
INVESTIGATOR: Fox, L. K.; Hancock,
PERFORMING INSTITUTION: Animal
Science.
SUBJECT:
Investigation of food animal disease problems in the state of
NON-TECHNICAL SUMMARY: The
control animal disease and of zoonotic and food-borne disease agents can be
addressed by epidemiological research at the level of the farm. Research
that can define the epidemiology of zoonotic pathogens in the livestock industry
can lead to HACCP procedures that will reduce their impact on the well being of
the public.
APPROACH: The
identification of herd disease problems requiring investigation and research,
and herds to collaborate in research, will be through the accessions of the
Washington Animal Disease Diagnostic Laboratory, through specific livestock
industry requests, and through identification of problems and herds by private
veterinary practitioners and county livestock agents. The Washington
Animal Disease Diagnostic Laboratory receives samples from herds with problems
throughout the State and its accessions can readily identify a disease problem
occurring or developing at multiple sites throughout the State. Disease
investigative teams will be formed for each disease problem that is identified
as an emerging disease that warrants investigation. The team will consist
of a core and ancillary members. The core will consist of epidemiologists
and species specialists from the Field Disease Investigation Unit. The
ancillary group will be those scientists in the
PUBLICATIONS: 2005/01 TO
2005/12
1. Smith, E.M., L.E.
Green, G.F. Medley, H.E. Bird, L.K. Fox, Y.H. Schukken, J.V. Kruze, A.J.
Bradley, R.N. Zadoks, and C.G. Dowson. 2005. Multilocus sequence typing of
intercontinental bovine Staphylococcus aureus isolates. J. Clin.
Micro 43:4737-4743.
2. Fox, L.K., J.H. Kirk,
and A. Britten. 2005. Mycoplasma mastitis: A review of
transmission and control. J. Vet. Med. 52:153-160.
3. Biddle, M.K., L.K.
Fox, M.A. Evans, and C.C. Gay. 2005. Pulsed-field gel electrophoresis
patterns of Mycoplasma isolates from various body sites in dairy cattle
with Mycoplasma mastitis. JAVMA 227:445-459.
4. Chang, S. B., G.A.
Bohach, S.U. Lee, W.C. Davis, L.K. Fox, W.A. Ferens, K.S. Seo, H. C. Koo, M.H
Kwon, Y.H. Park. 2005. Immunosuppression by T regulatory cells in cows
infected with Staphylococcal superantigen. J. Vet. Sci.
6:247-250.
5.
PROJECT
CONTACT:
Name: Fox, L. K. Phone:
509-335-0786 Fax: 509-335-1082
Email:
fox@wsu.edu
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 AUG 1995
TERM: 30 JUN 2002 FY: 2002
INVESTIGATOR: Mcelwain, T. F.; Knowles, D. P.;
McGuire, T. C.
PERFORMING INSTITUTION:
SUBJECT: Agricultural animal health
unit.
PROGRESS: 1995/08 TO
2002/06 This project was an umbrella infrastructure project of the
Agricultural Animal Health Program (AAHP) in the
1. Call, DR, Borucki MK,
Loge FJ. 2003. In press. Detection of bacterial pathogens in environmental
samples using DNA microarrays. J Micro Methods.
2.
PROJ
TYPE:
ANIMAL HEALTH PROJ STATUS: TERMINATED
START: 01 JUL 2001
TERM: 30 JUN 2002 FY: 2002
INVESTIGATOR:
PERFORMING
INSTITUTION:
SUBJECT:
CD4+ T-cell IFN-gamma expression in bovines infected with M.
paratuberculosis. NON-TECHNICAL SUMMARY: Paratuberculosis (Johne's
Disease) is a chronic, debilitating gastrointestinal disease of ruminants and
other species world wide. Currently, available diagnostic tests are unable
to reliably detect infected animals until very late in the disease. This
proposal describes the development of a diagnostic test that will allow the
earliest detection of animals infected with M. paratuberculosis.
APPROACH: This project
is designed to validate the flow cytometric assay in animals known to be
infected with Map. Study animals will be chosen from local cooperating
dairies based on their infection status as determined by ELISA, fecal and milk
PCR, and fecal culture results. The dairy supplying samples from infected
animals has ongoing monthly serologic testing of all late gestation cows.
Access to the 3500 cows in this herd (20% ELISA positive prevalence) will
enable the selection of a pool of infected animals. Samples from
non-infected control animals will be obtained from the
IMPACT: 2001/07 TO
2002/06 Early and accurate detection of cattle infected with M.
paratuberculosis is essential for investigating the immunology,
pathobiology, and epidemiology of paratuberculosis. A more thorough
understanding of these areas will be critical for implementing successful and
appropriate control and prevention strategies.
PUBLICATIONS: 2001/07 TO
2002/06
Barrington GM, Gay JM, Eriks IS,
PROJECT
CONTACT:
Name: Barrington, G. M.
Phone: 509-335-0703 Fax: 509-335-3330
Email:
PROJ STATUS:
TERMINATED
START: 01 JUL 2002 TERM: 30 JUN 2003 FY: 2003
INVESTIGATOR: Davis, W. C.;
PERFORMING INSTITUTION: ANIMAL HEALTH RESEARCH CENTER
SUBJECT: Rapid universal diagnostic assays for
detection and differentiation of animals infected with M. bovis and/or M.
paratuberculosis.
NON-TECHNICAL SUMMARY: Two mycobacteria are of
economic importance and a potential health hazard for animals and humans: M.
bovis, the causative agent of bovine tuberculosis and M.
paratuberculosis, the causative agent of Johne's disease (paratuberculosis).
The lack of effective vaccines and rapid diagnostic tests for early
detection has made eradication of these diseases difficult. There is an
essential need to develop better assays to control these diseases. The
primary objective of this research is to develop rapid simple diagnostic assays
that can be used for early diagnosis and control of these diseases.
APPROACH: 1. A
non-hemagglutinating mAb, TH17A (IgM), known to recognize a highly conserved
determinant on RBCs and leukocytes, will be used in the initial studies to
prepare ESAT-6 and a362 peptide conjugates. Peptides containing the
immunodominant determinants of ESAT-6 and a362 will be prepared with an extra
lysine for conjugation with the mAb. Following purification, the mAb will
be treated with sodium periodate to generate aldehyde groups on the carbohydrate
sidechains. The peptides will bind through an amine group to the aldehyde.
The binding of mAb-peptide conjugates to RBC will be demonstrated by flow
cytometry. Reactivity of the peptide will be determined by ELISA before
and after coupling to the antibody, using immune sera from animals infected with
Mbv or Map. Nonspecific peptides will be coupled to the mAb and used as
negative controls. The mAb conjugates will be tested for their capacity to
agglutinate in the presence of antibody. 2. A commercial source of
sulfated 0.8 mM latex microspheres will be used in initial trials to develop
bead assays to detect ESAT-6 and a362 peptide antigens. The beads will be
prepared according to the manufacturer's protocol and reacted with serial
dilutions of ESAT-6 and a362 peptides. Comparable sets of latex beads will
be coated with nonspecific peptides to serve as negative controls.
Following validation of the capacity of the mAb and latex bead conjugates
to form antibody-antigen aggregates, studies will be performed with sets of
antisera from known infected animals and uninfected animals to establish the
sensitivity and specificity of the assays. PROGRESS: 2002/07 TO 2003/06
The objective of the study was to develop and compare the sensitivity and
specificity of two antigenic peptide based assays for use in the diagnosis and
control of bovine tuberculosis and paratuberculosis. A red blood cell
(rbc) based antigen-antibody capture assay and antigen coated latex bead assay
were developed and compared with the sensitivity and specificity of an existing
enzyme linked immunosorbent assay (EIA). An antigenic peptide from
Mycobacterium bovis, ESAT-6, was used as the first test antigen.
The rbc based antigen assay proved to be difficult to use and not
sufficiently sensitive so further efforts to develop the assay were stopped.
Comparison of the latex bead agglutination assay with the EIA, with a
panel of sera obtained from infected and uninfected animals, showed both assays
yield comparable levels of sensitivity, 94% and 96% respectively. The data
suggest it will be possible to develop a rapid latex bead based diagnostic assay
for use in the diagnosis of animals infected with M. bovis. Studies
are now needed with blind panels of sera from known infected and uninfected
animals to verify the sensitivity and specificity of the assay. Studies
are also needed to determine if a comparably sensitive latex bead agglutination
assay can be developed for paratuberculosis.
IMPACT: 2002/07 TO
2003/06 Diagnostic assays that improve our ability to detect infected
animals at early stages of disease will help control disease and the movement of
infected animals into clean dairy and cattle operations.
PUBLICATIONS: 2002/07 TO
2003/06
No publications reported
this period
PROJECT
CONTACT:
Name: Davis, W. C.
Phone: 509-335-6051 Fax: 509-335-8328
Email:
davisw@vetmed.wsu.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT
PROJ STATUS: NEW
CONTRACT/GRANT/AGREEMENT NO: 2002-35204-11688 PROPOSAL NO: 2001-02282
START: 15 DEC 2001 TERM: 30 DEC 2003 FY: 2004 GRANT YR: 2002 GRANT AMT:
$117,000
INVESTIGATOR:
PERFORMING INSTITUTION:
SUBJECT: CD4+ T-cell IFN-y
expression in bovines infected with M.
paratuberculosis.
NON-TECHNICAL SUMMARY: Paratuberculosis (Johne's
disease) is a chronic, debilitating, gastrointestinal disease of cattle,
worldwide. Strategies for control will ultimately be based on a thorough
understanding of the biology and epidemiology of the disease. Currently,
the single largest impediment to improving our knowledge of this disease lies in
the absence of a sensitive diagnostic test that identifies infected animals
during the early phases of disease (Stage 1 or the 'silent infection' stage).
The primary goal of this project is to develop a novel diagnostic test to
identify animals infected with Mycobacterium avium subsp.
paratuberculosis (Map), the causative agent of paratuberculosis, during
the early stages of disease. To accomplish this goal, we will develop a
test to measure substances produced by specific cells of the immune system in
response to infection. Once validated in known-infected animals, the test
will be used to identify the earliest time in which infection can be identified
in calves infected with Map, from birth until 15 months of age. The test
will also help define changes in the immune system of infected animals during
progression of disease. This diagnostic test will provide a critical tool
to accelerate investigations of many aspects of paratuberculosis, eventually
leading to development of vaccines and other preventative strategies that will
reduce the prevalence of this infection in cattle. Such knowledge will
have a substantial positive benefit for
OBJECTIVES: The objective of this project is to develop a
flow cytometric-based assay capable of identifying cattle infected with
Mycobacterium avium subsp. paratuberculosis (Map), the causative
agent of paratuberculosis, during the earliest stages of disease.
APPROACH:
The most promising early-stage diagnostic approach to paratuberculosis involves
recognition of the cell-mediated immune response as it is the first detectable
host response to Mycobacteria infections. To date, the most proficient
technology to evaluate such a response is multiparameter flow cytometry.
In this proposal, we hypothesize that a flow cytometry assay will
demonstrate intracellular expression of interferon (IFN) gamma in activated CD4+
T lymphocytes of animals silently infected by Map. Two specific aims are
proposed to examine this hypothesis. Specific aim 1: Demonstrate the expression
of IFN-gamma in activated CD4+ T lymphocytes of known Map-infected animals using
multiparameter flow cytometry. This aim will validate the flow cytometric
assay in animals known to be infected with Map. Study animals will be
chosen based on their infection status as determined by enzyme linked
immunosorbent assay (ELISA), fecal and milk polymerase chain reaction (PCR), and
fecal culture results. Samples from non-infected control animals will be
obtained from a separate paratuberculosis-free dairy (no paratuberculosis
diagnosed for 30+ years). Three groups of cattle will be tested including
5 subclinically infected animals, 5 clinically infected animals and 5
non-infected control animals. A variety of antigens will be used to
stimulate cytokine production by memory T-cells including preparations of whole
Map organisms, Johnin purified protein derivative (PPD), and a non-specific
T-cell mitogen. Flow cytometry will be used to identify T-cell subsets
responding to Mycobacteria antigens by recognizing which subsets are producing
cytokines. Specific aim 2: Identify the age at which IFN-gamma expression
by CD4+ T lymphocytes can be demonstrated in calves experimentally infected with
Map. A total of 8 male, castrated calves will be used for this study.
The calves will be separated into 2 groups of 5 infected and 3 control
calves. Calves will be infected multiple times during the first week of
life to assure infection and to mimic exposure in an endemic herd.
Infected calves will be obtained from a dairy with endemic
paratuberculosis mentioned in aim 1. Control calves will be obtained from
the paratuberculosis-free dairy previously described. Sampling of calves
will occur bi-monthly until the calves are 15 months of age. This age is
the approximate time that heifers are bred and is therefore a critical juncture
for management decisions in the dairy industry. Sampling during this
period will identify the earliest age at which a cell mediated immune (CMI)
response occurs and will facilitate characterizing the dynamics of the CMI
response over time. It is possible that calves will develop a CMI response
at different ages and some calves may even develop clinical disease within the
15-month period. We believe that data obtained from these calves will be
critical for beginning to elucidate the heterogeneity of responses to Map
infection. Future studies will be directed at utilizing this assay in
calves naturally infected with Map.
PROGRESS: 2002/01 TO 2002/12
Newborn
IMPACT: 2002/01 TO 2002/12 Early and accurate
detection of cattle infected with M. paratuberculosis is essential for
investigating the immunology, pathobiology, and epidemiology of
paratuberculosis. A more thorough understanding of these areas will be
critical for implementing successful and appropriate control and prevention
strategies.
PUBLICATIONS: 2002/01 TO 2002/12
PROJECT
CONTACT:
Name: Barrington, G. M.
Phone: 509-335-0703 Fax: 509-335-0880
Email:
geob@vetmed.wsu.edu
PROJ
STATUS:
NEW
START: 01 OCT 2006 TERM: 30 SEP 2010
INVESTIGATOR:
Landick, R.
PERFORMING INSTITUTION: Bacteriology. Univ of
NON-TECHNICAL SUMMARY: RNA polymerase
is a good target for developing new antibiotics needed to control agricultural
pathogens. This project will develop new methods to produce RNA
polymerases from agricultural pathogens and to use them to identify new
antibiotic candidates. OBJECTIVES: This project will generate new methods for
study of mycobacterial RNAPs by developing methods to produce them in
recombinant form using E. coli (mycobacteria are exceptionally hard to
grow in the lab, making direct purification difficult). The recombinant
mycobacterial RNAPs will be used to characterize the function of different
mycobacterial sigma initiation factors involved in the mycobacterial life cycle,
to characterize unique structural features of mycobacterial RNAP, to determine
the termination mechanism of mycobacterial RNAPs, which is currently unknown,
and to develop a novel method to screen for new inhibitors of mycobacterial
RNAPs. The work is directly relevant to major bacterial threats to
PROJECT
CONTACT:
Name: Landick, R. Phone:
608-265-8475. Fax: 608-262-9865
Email:
landick@bact.wisc.edu
PROJ
STATUS:
NEW
START: 01 OCT 2006 TERM: 30 SEP 2009
INVESTIGATOR:
Talaat, A.
PERFORMING INSTITUTION: Animal Health & Biomedical
Science. Univ of
SUBJECT:
Genomic plasticity of Mycobacterium paratuberculosis causing Johne's
disease.
NON-TECHNICAL SUMMARY: Cattle infection with
Mycobacterium paratuberculosis causes Johne’s disease. Millions of
dollars (from the dairy industry) are lost every year because of the Johne’s
disease especially in
PROJECT
CONTACT:
Name: Talaat, A. Phone:
608-262-2861 Fax: 608-262-7420
Email:
atalaat@wisc.edu
PROJ
STATUS:
TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 00-35204-9311 PROPOSAL NO:
2000-02295
START: 01 SEP 2000 TERM: 31 AUG 2003 FY: 2003 GRANT YR: 2000
GRANT AMT: $199,000
INVESTIGATOR: Collins, M. T.
PERFORMING INSTITUTION:
PATHOBIOLOGICAL SCIENCES. UNIV OF
SUBJECT:
Induction of diagnostically valuable M. a. paratuberculosis
antigens.
NON-TECHNICAL SUMMARY: M. paratuberculosis antigens
used to develop diagnostic tests for Johne's disease in livestock may vary
depending upon the conditions under which the bacterium is grown. This
study will analyze the differences among antigens seen when M.
paratuberculosis is grown under different conditions.
APPROACH: We hypothesize
that M. paratuberculosis responds to different culture conditions by
producing different proteins. Based on our in-depth experience with the
organism plus a review of the literature addressing intracellular environments
and preliminary studies, we have selected 5 chemical or environmental factors
(Tween 80, iron, pH, oxygen tension, and heat shock) that have a high likelihood
of affecting the physiological characteristics of M. paratuberculosis.
By varying these factors individually and in combination in a focused
manner, we hypothesize that new proteins will be induced which may be
immunodominant in the course of Johne's disease. M. paratuberculosis
strains will be cultured under specified culture conditions and the growth
curves will be measured. Cellular, extracellular, and membrane bound
proteins of M. paratuberculosis will be subjected to SDS-PAGE and BN-PAGE
analysis to qualitatively and quantitatively compare protein profiles, and to
Western blot analysis using a panel of sera from naturally infected cattle to
identify immunodominant antigens. Protein bands on Western blot that are
recognized only by sera of infected vs. uninfected cattle will be considered
indicative of M. paratuberculosis-specific immunodominant
antigen(s).
PROGRESS: 2000/09 TO
2003/08 Study of M. paratuberculosis response to intracellular life
in the infected host or extracellular life and persistence outside the host
requires in vitro experimentation. In vitro studies generally necessitate
cultivation of the organism. The work from this project demonstrated that
multiple in vitro factors influence the degree to which M.
paratuberculosis can withstand thermal stress or exposure to low pH
conditions. It illustrates that extrapolating from in vitro observations
to the in vivo situation, be it a macrophage phagosome, raw milk, soil or lake
water, is problematic and should be done with extreme caution. However,
careful characterization of the M. paratuberculosis can lead to a better
understanding of the fundamental mechanisms of pathogen response to stress and
adaptation to suboptimal environments. For example, both sublethal heat
stress and low pH stress cause up regulation of GroES which can repair damaged
proteins. Interestingly, adverse conditions for M. paratuberculosis also
caused up regulation of key cell wall synthesis enzymes, the Antigen 85 Complex,
and this was then associated with greater amounts of mycolic acids in the cell
wall. A thicker cell wall could be another defensive strategy for M.
paratuberculosis that may help survival under some adverse conditions.
M. paratuberculosis is a worthy adversary for animals and possibly
humans. Knowing the adversary will enhance our ability to control it.
IMPACT:
2000/09 TO 2003/08 Culture medium was shown to affect heat resistance,
acid resistance, cell wall thickness, and protein profiles. The impact of
this work will be to draw the attention of future investigators to the profound
impact of culture medium on the phenotypic characteristics of M.
paratuberculolsis and thereby insure appropriate in vitro cultivation
methods are used to study this important pathogen, avoiding laboratory artifact.
Specifically, this study will impact antigen production methods for
Johne's disease diagnostic tests.
PUBLICATIONS: 2000/09 TO
2003/08
1. Sung, N., Collins,
M.T. 2003. Variation in resistance of Mycobacterium paratuberculosis
to acid environments as a function of culture medium. Appl. Env.
Microbiol. 69:6833-6840.
2. Sung, N., Collins,
M.T. 2004. A possible association of GroES and antigen 85 proteins with heat
resistance of Mycobacterium paratuberuclosis. Appl. Env.
Microbiol. (in press).
PROJECT
CONTACT:
Name: Collins, M. T.
Phone: 608-262-8457 Fax: 608-265-6463
Email:
mcollin5@facstaff.wisc.edu
PROJ
TYPE:
OTHER GRANTS
PROJ STATUS:
TERMINATED
CONTRACT/GRANT/AGREEMENT NO: 00-52100-9621
PROPOSAL NO: 2000-04294
START: 15 SEP 2000 TERM: 15 SEP 2005 FY: 2005 GRANT
YR: 2000 GRANT AMT: $477,220
INVESTIGATOR: Shook, G. E.; Collins, M. T.;
Kirkpatrick, B. W.
PERFORMING INSTITUTION: Dairy Science. Univ of
SUBJECT: Genetic resistance to
paratuberculosis in dairy cattle.
NON-TECHNICAL SUMMARY:
Paratuberculosis, commonly known as Johne's Disease, affects 22 percent of all
OBJECTIVES: The long-term objective of our collaboration is to develop a
genetic approach to prevention of paratuberculosis in cattle. The specific
objectives for this project are: 1) Establish a resource of DNA samples and
paratuberculosis test results for 15 half sib families of Holstein cattle for
study of genetic resistance to paratuberculosis; 2) Search for segregating DNA
markers throughout the cattle genome that are associated with resistance or
susceptibility to paratuberculosis in five sire families. The
paratuberculosis test results and DNA samples obtained under objective 1 will
later be used to complete a genome wide scan in the remaining ten sire families;
3) Disseminate the results of this research to: a) producers, veterinarians, and
dairy extension agents throughout the country, b) sire procurement personnel in
the artificial insemination industry, and c) students in our undergraduate,
graduate, and veterinary medicine courses.
APPROACH: A genome wide search
for DNA markers linked with major genes that influence paratuberculosis
resistance or susceptibility will be carried out. This scan will involve
140 heterozygous markers across all 29 autosomal chromosomes. We propose
to study a total of 6000 daughters of 15 prominent sires in 400 to 600
commercial dairy herds throughout the country. This project will complete
the disease testing for all 15 sire families and genotyping for five sire
families. Subsequently, with additional funding, the genome wide search
will be completed for the remaining ten sire families. Paratuberculosis
will be assessed by the combination of an ELISA test for serum antibody to the
pathogen and bacterial culture of the pathogen from fecal samples. In
herds with disease prevalence between 5 and 25%, predictive values for both
positive and negative test results are greater than 90% for the combined tests.
Genotyping will be performed selectively for all daughters that are
positive for either of the two diagnostic tests. Advantages for genotyping
positive animals include a considerable reduction in the number of animals
genotyped and the fact that the diagnostic tests have a low rate of false
positive results. Animals with negative test results may have escaped
exposure to the disease and the diagnostics have a moderately high rate of false
negative results; therefore, these cases would not indicate resistance to
disease even though test results are negative. Data analysis will be
carried out within sire families: For loci with no effect on disease resistance,
affected daughters are expected to have inherited with equal frequency one of
the two alleles from their sire. Loci at which the two sire alleles differ
in their disease resistance will be revealed by a high frequency of the
susceptible allele and low frequency of the resistant allele among affected
daughters. We plan a proactive nationwide program of extension activities
and website development to make our findings known to producers, veterinarians,
the animal genetics industry, and dairy extension agents.
PROGRESS: 2000/09
TO 2005/09 Phase 1 of the project involved collecting blood and fecal
samples for disease testing and a second blood sample for DNA extraction. A
total of 308 cooperating commercial, pedigreed herds submitted samples.
Our final resource population consisted of 4233 daughters of 12 project
bulls in a daughter design. The 12 project sires were selected based on
large numbers of daughters in production and low genetic relationships among
sires. Two disease diagnostic tests for M. paratuberculosis were
performed on each cow: a serum antibody ELISA and a fecal culture for the
pathogen. A cow was classified as infected if positive to either test.
Only daughters from herds with direct evidence of disease were included in
these studies. Phase 2 involved quantitative analysis of the disease test
results. Predicted apparent prevalence of Johne's disease in bulls'
daughter groups ranged from 5.3 to 10.4% and averaged 7.9%. Heritability for
disease susceptibility from the combined antibody and fecal culture tests was
10.2%. These results demonstrate that important genetic variation exists
among bulls and that selection against disease susceptibility would be
effective. Phase 3 involved identification of molecular markers associated
with susceptibility to paratuberculosis infection. We have completed a
genomewide scan for quantitative trait loci (QTL) with DNA pools in 3 of our 12
half-sib sire families. These families were chosen for their large numbers
of daughters (252, 570, and 400) and relatively high predicted future daughter
disease prevalence (7.2, 8.0, and 9.0%). The sires were genotyped for a
set of 270 microsatellite markers to determine each sire's heterozygosity for
each marker. One sire was heterozygous for 176 markers and the other two
were heterozygous for 151 markers. Correct sire identification was
verified with 8 independent, polymorphic markers for which the sires were
heterozygous. Incorrect parentage was found for 15% of the daughters which
is similar to the industry average. Parentage verified daughters were
genotyped within family by selective DNA pooling. Infected daughters
(positive pool) were matched with 2 of their non-infected herdmates (negative
pool) in the same lactation to control for herd and age effects. The DNA
pools for each sire were genotyped for markers that were heterozygous in the
sire. Nine chromosomal regions (BTA 7, 10, 12, 14, 15, 16, 18, 20, and 25)
(P < 0.01) were putatively associated with M. paratuberculosis
infection in at least one family. Three of these regions (BTA 7, 10, and
12) were significantly associated with infection in 2 families. Interval
mapping is in progress to validate significance and refine location of these
effects. Also, a linkage disequilibrium analysis is in progress for the
remaining nine sire families. For this experiment, DNA pools were formed
across families and were genotyped on a commercial10K bovine SNP chip which uses
molecular inversion probe technology. Pool genotyping has been completed
and data analysis is in progress.
IMPACT: 2000/09 TO 2005/09 The
project has assisted more than 300 dairy producers throughout the
PUBLICATIONS: 2000/09 TO 2005/09
1. Shook, G. E., M. G.
Gonda, B. W. Kirkpatrick, and M. T. Collins. 2004. A search for major genes
that cause susceptibility to Johne's disease. Pages 106-111 in Proc.
20th Tech. Conf. Artificial Insemination and Reproduction. Nat'l. Assoc.
Anim. Breeders,
3. Gonda, M. G., Y. M. Chang, G. E.
Shook, M. T. Collins, and B. W. Kirkpatrick. 2005. Genetic variation of
Johne's disease susceptibility in
4. Gonda, M.G., G.E. Shook, B.W.
Kirkpatrick, and M.T. Collins. 2006. Mapping quantitative trait loci
affecting Mycobacterium paratuberculosis infection in cattle. Page
234 in Proceedings Plant and Animal Genome Conference XIV,
PROJECT
CONTACT:
Name: Shook, G. E.
Phone: 608-263-3486. Fax: 608-263-9412
Email:
shook@calshp.cals.wisc.edu
PROJ
TYPE:
ANIMAL HEALTH
PROJ STATUS: TERMINATED
START: 01 OCT
2002 TERM: 30 SEP 2003 FY: 2003
INVESTIGATOR: Collins, M. T.
PERFORMING
INSTITUTION: Pathobiological Sciences. Univ of
SUBJECT: Biosecurity: field evaluation of best
management practices.
NON-TECHNICAL SUMMARY: Johne's disease is an
infectious disease affecting over 22 percent of
PROGRESS: 2002/10 TO
2003/09 Ten Wisconsin dairy herds continued on a Johne's disease program
with the assistance provided by the Experiment Station funding. Herds
ranged in size from 70 to 1400 milking cows. Funding helped the PI to
leverage additional support, an amount 4 times that of the Experiment Station
grant, to sustain the 7 year project. In herds with calf health problems,
the heifer rearing management recommendations served to improve calf health.
Heifers born under the Johne's control program will enter the herds as
milking cows in 2004. This will be the first opportunity to measure the success
of the control program.
IMPACT: 2002/10 TO
2003/09 If Johne's control is successful, dairy producers will have an
affordable and effective field-tested control program. If control of this
disease is not achieved, then we will have learned that more sensitive
diagnostic tests and/or more stringent heifer rearing hygiene is required to
control M. paratuberculosis infections in dairy herds.
PUBLICATIONS: 2002/10 TO
2003/09
No publications reported
this period
PROJECT
CONTACT:
Name: Collins, M. T.
Phone: 608-262-8457. Fax: 608-265-6463
Email:
mcollin5@wisc.edu
PROJ
TYPE:
ANIMAL HEALTH
PROJ STATUS: NEW
START: 01 OCT 2003 TERM:
30 SEP 2006 FY: 2005
INVESTIGATOR: Czuprynski, C.
PERFORMING
INSTITUTION:
SUBJECT: Effect of macrophage receptors on
uptake, phagosomal fusion and intracellular fate of Mycobacterium
paratuberculosis.
NON-TECHNICAL SUMMARY: Mycobacterium
paratuberculosis is the causative agent of Johne's disease, a chronic
progressive enteritis of cattle and other ruminant species that causes
considerable economic losses to the dairy and beef cattle farmers of
APPROACH: In the proposed work we will determine whether prior
opsonization with IgG or complement affects the vacuole within which M.
paratuberculosis resides in bovine macrophages. Experiments will be
performed using a bovine macrophage cell line that exhibits many characteristics
of normal macrophages. We will compare our results with those obtained
using bovine peripheral blood monocytes, or monocytes cultured in vitro until
they acquire the characteristics of macrophages. Uptake of bacilli will be
quantified by microscopic (acid-fast staining) and radiometric (Bactec) methods.
To assess the ability of Fc receptors to facilitate macrophage ingestion
of M. paratuberculosis, we will pre-incubate M. paratuberculosis
with serum from cattle that are positive for anti-M. paratuberculosis
antibodies using a commercial ELISA assay, as described previously. These
sera will be generously provided by my colleague Dr. M. Collins, whose Johne's
IMPACT: 2005/01 TO 2005/12 This study
will provide needed information about the role of macrophages receptors in the
pathogenesis of paratuberculosis. The results suggest that the receptor
pathway by which the bacilli enter the macrophage can affect the numbers of
bacilli that do so. Stimulation of certain cytokine or nucleotide receptors are
likely to affect the fate of the bacilli. Such information could be used
to devise new vaccines that elicit an immune response that facilitates ingestion
of M. paratuberculosis via a macrophage receptor pathway that enhances
anti-mycobacterial activity.
PUBLICATIONS: 2005/01 TO 2005/12
Woo, S.R.,
J. Sotos, A.P. Hart, R. G. Barletta, and C.J. Czuprynski. 2006. Bovine
monocytes and a macrophage cell line differ in their ability to phagocytose and
support the intracellular survival of Mycobacterium avium subsp.
paratuberculosis. Vet. Immunol. Immunopathol.
110:109-120.
PROJECT
CONTACT:
Name: Czuprynski, C.
Phone: 608-262-8102. Fax:
608-262-8102
PROJ
TYPE:
ANIMAL HEALTH
PROJ STATUS: TERMINATED
START: 01 OCT
2003 TERM: 30 SEP 2005 FY: 2005
INVESTIGATOR: Talaat, A. M.
PERFORMING
INSTITUTION: Animal Health & Biomedical Science. Univ of
SUBJECT: Genetic analysis of the virulence of
Mycobacterium avium subspecies paratuberculosis.
NON-TECHNICAL
SUMMARY: A) Infection with Mycobacterium avium subspecies
paratuberculosis (MAP), the causative agent of Johne's disease
(Paratuberculosis) causes severe economic losses estimated to be around
$200-$250 million a year for the dairy industry in the
APPROACH: Specifically,
the library of MAP mutants will be characterized by Southern hybridization (to
ensure randomness), sequencing (to identify the disrupted genes) as well as
identification of nutritional auxotrophs. Verified auxotrophs will be
further studied in the mouse model of paratuberculosis to assess their
virulence. In future experiments, we will use the DNA microarrays
technology to dissect the genetic basis of MAP colonization/invasion into the
host cells. PROGRESS: 2003/10 TO 2005/09 Johne’s disease, caused by
Mycobacterium avium subsp. paratuberculosis (M.
paratuberculosis) infection, is a worldwide problem for the dairy industry
and has a possible involvement in Crohn’s disease in humans. To identify
virulence determinants of this economically important pathogen, a library of
5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis,
followed by large-scale sequencing to identify disrupted genes. During
this project, 1,150 mutants were analyzed and 970 unique insertion sites were
identified. Sequence analysis of the disrupted genes indicated that the
insertion of Tn5367 was more prevalent in genomic regions with lower G+C content
(50.5 to 60.5%) than the average G+C content (69.2%) of the rest of the genome.
Phenotypic screening of the library identified disruptions of genes
involved in iron, tryptophan or mycolic acid metabolic pathways that displayed
unique growth characteristics. Bioinformatic analysis of disrupted genes
identified a list of potential virulence determinants for further testing in
animals. Mouse infection studies showed a significant decrease in tissue
colonization by mutants with a disruption in gcpE, pstA, kdpC, papA2, impA,
umaA1 or fabG2 2 genes. Attenuation phenotypes were time-specific (e.g.
gcpE, kdpC) as well as tissue-specific (e.g. impA, papA2), suggesting that those
genes may be involved in different virulence mechanisms. The identified
potential virulence determinants represent novel functional classes that could
be necessary for mycobacterial survival during infection and could provide
suitable targets for vaccine and drug developments against Johne’s and Crohn’s
diseases.
IMPACT: 2003/10 TO
2005/09 During this project, we generated specific mutants that could be
the next generation of vaccines against Johne’s Disease. We also identified
several virulence factors that were not known before.
PUBLICATIONS: 2003/10 TO
2005/09
1. Talaat, A.M.,
Stemke-Hale, K. 2005. Expression Library Immunization: A road-map for vaccine
discovery against infectious diseases. Infect. Immun. 73,
7089-7098.
2. Shin, S-J., Wu, C-W.,
Steinberg, H., Talaat, A.M. 2006. Identification of novel virulence
determinants in Mycobacterium avium subspecies paratuberculosis
using large-scale screening of an Insertional Mutant Library.
(Submitted).
PROJECT
CONTACT:
Name: Talaat, A. M.
Phone: 608-262-2617
Email:
atalaat@wisc.edu
PROJ
TYPE:
ANIMAL HEALTH
PROJ STATUS: TERMINATED
START: 01 DEC 2003 TERM: 30 SEP 2004 FY: 2004
INVESTIGATOR: Collins, M.
T.
PERFORMING INSTITUTION:
SUBJECT: Induction of
diagnostically valuable Mycobacterium paratuberculosis protein
antigens.
NON-TECHNICAL SUMMARY: Johne's disease is economically
important to a wide variety of ruminants of agricultural importance and blood
tests to diagnosis this infection are not sufficiently accurate. This
study is designed to understand the proteins that make up the bacterium causing
Johne's disease in order to design more accurate blood tests.
APPROACH: Stage #1 2-DE
immunoblot analysis of 4 antigenic preparations from two bovine strains of Mptb
will be done using sera pooled from 50 infected or noninfected cattle.
Proteins that stain strongly using pooled serum from cases but not at all
or far less strongly with serum from controls will be considered proteins of
potentially high diagnostic specificity. Stage #2 By 2-DE immunoblot sera
from 50 fecal culture-positive and 50 fecal culture-negative cattle will
establish the percentage of cattle responding to Mptb-specific proteins.
The Kodak immunoblotting system allows screening of serum from up to 10
cattle using a single 2-DE gel. The frequency and intensity of each spot
will be calculated. Proteins showing the best infection category
discrimination potential will be evaluated for analytical specificity.
Stage #3 Mycobacteria commonly found in cattle and those believed to
trigger false-positive commercial ELISAs will be studied using the same methods
as for Mptb. Proteins will be separated using 2-DE. Pooled sera from
cases and controls will be used. Internal markers added to the antigen
preparations will permit alignment of the gels allowing us to identify the
proteins in these other mycobacteria that are similar to those of Mptb. If
the candidate Mptb proteins are not in the same 2-DE gel location as
immunostained proteins of other mycobacteria, then we will presume that the Mptb
proteins have good analytical specificity. When we confirm that
immunogenic proteins with good diagnostic sensitivity are unique to Mptb, we
will proceed to identify them by Matrix-Assisted Laser Desorption/Ionization
Mass Spectrophotometry. Stage #4 The protein or proteins of interest will
be excised from wet 2-DE gels and analyzed by MALDI-MS. The data from
these assays will be compared to available databases to determine if the amino
acid sequence of the protein matches that of any known protein or is novel.
Many mycobacterial proteins have been identified and catalogued in public
databases. Stage #5 We will seek to create a protein fraction from Mptb,
not to isolate single proteins since this has already been done and the result
predictably was assays of low sensitivity. The location of proteins of
interest in 2-DE will reveal their molecular weight range and pI.
Classical chromatography methods, molecular sieve and ion exchange, will
be used to create protein fractions from Mptb that are enriched in the proteins
of greatest diagnostic value and depleted of those most cross-reactive with
other mycobacteria. Stage #6 The ELISA will be optimized and tested with
500 sera from cattle of known Mptb fecal culture status and over 500 sera from
certified paratuberculosis-free herds. All 4,000 sera will be tested using
the improved ELISA. OD values for cases (infected) and controls
(certified-free) will be evaluated using likelihood ratio
methods.
PROGRESS: 2003/12 TO
2004/09 The first ever two-dimensional electrophoresis (proteomic)
analysis of Mycobacterium paratuberculosis was created. Culture
medium composition and pH were found to significantly influence the protein
expression profile. Certain proteins were found associated with heat
resistance of the organism. More proteins from culture filtrates were
immunogenic (based on induction of serum antibodies in dairy cattle) than were
proteins from the cells harvested from cultures. The antibody response of
cattle to the secreted proteins of M. paratuberculosis was highly
variable with regard to the number and type of protein antigens recognized.
Twenty-three immunogenic proteins were identified by MALDI-MS. Of
these, 13 were cloned and expressed in E. coli and purified in large
amounts. These proteins are being evaluated for their diagnostic
potential.
IMPACT: 2003/12 TO
2004/09 The full protein antigenic profile of Mycobacterium
paratuberculosis, the cause of Johne's disease, was analyzed for the first
time. Key antigens that trigger antibody response in dairy cattle were
cloned and purified. These antigens are not ready for development into
improved, low-cost, high-throughput diagnostic assays.
PUBLICATIONS: 2003/12 TO
2004/09
1. Sung, N.*, K.
Takayama, and M.T. Collins. 2004. Possible association of GroES and antigen
85 proteins with heat resistance of Mycobacterium paratuberculosis.
Appl. Environ. Microbiol. 70:1688-1697.
2. Sung, N.*, and M.T.
Collins. 2003. Variation in resistance of Mycobacterium
paratuberculosis to acid environments as a function of culture medium.
Appl. Env. Microbiol. 69:6833-3840.
3. Collins, M.T. 2002.
Interpretation of a commercial bovine paratuberculosis enzyme-linked
immunosorbent assay by using likelihood ratios. Clin. Diagn. Lab.
Immunol. 9:1367-1371.
4.
Name: Collins, M. T.
Phone: 608-262-8457. Fax: 608-265-1958
Email:
mcollin5@facstaff.wisc.edu
PROJ
TYPE:
NRI COMPETITIVE GRANT
PROJ STATUS: EXTENDED
CONTRACT/GRANT/AGREEMENT NO: 2004-35204-14209 PROPOSAL NO: 2003-02230
START: 01 JAN 2004 TERM: 31 DEC 2006 FY: 2005 GRANT YR: 2004 GRANT AMT:
$220,000
INVESTIGATOR: Talaat, A.
PERFORMING INSTITUTION: Animal Health
& Biomedical Science. Univ of
SUBJECT: Persistence and virulence of Mycobacterium
paratuberculosis during infection: a functional genomics approach.
NON-TECHNICAL SUMMARY: Johne’s disease in cattle causes severe economic
losses for the dairy industry in the
PROGRESS: 2005/01 TO
2005/12 Infection with Mycobacterium avium subsp.
paratuberculosis (M. paratuberculosis) causes Johne’s disease in
cattle and is also implicated in cases of Crohn’s disease in humans.
Another closely related strain, M. avium subsp. avium (M.
avium) is a health problem for immunocompromised patients. To
understand the molecular pathogenesis of M. avium subspecies, we analyzed
the genome contents of isolates collected from humans and domesticated or
wildlife animals. Comparative genomic hybridizations indicated distinct
lineages for each subspecies where the closest genomic relatedness existed
between M. paratuberculosis isolates collected from human and clinical
cow samples. Genomic islands (N=24) comprising 846 Kb were present in the
reference M. avium strain but absent from 95% of M.
paratuberculosis isolates. Additional analysis identified a group of
18 M. paratuberculosis-associated islands comprising 240 Kb that were
absent from most of the M. avium isolates. Sequence analysis of DNA
regions flanking the genomic islands identified three large-size inversions in
addition to several small inversions that could play a role in regulation of
gene expression. Analysis of genes encoded in the genomic islands reveals
factors that are probably important for various mechanisms of virulence.
Overall, M. avium isolates displayed a higher level of genomic
diversity than M. paratuberculosis isolates. Among M.
paratuberculosis isolates, those from wildlife animals displayed the highest
level of genomic rearrangements that were not observed in other isolates.
The presented findings will affect the future design of diagnostics and
vaccines for Johne’s and Crohn’s diseases and provide a model for genomic
analysis of closely related bacteria.
IMPACT: 2005/01 TO
2005/12 So far, we identified several regions of difference between the
genome of the pathogenic M. paratuberculosis and the less virulent strain
of M. avium. These regions can be further exploited to develop
accurate diagnostic tests.
PUBLICATIONS: 2005/01 TO
2005/12
1. Talaat, A.M., Stemke-Hale, K. 2005, Expression Library
Immunization: A road-map for vaccine discovery against infectious diseases.
Infect. Immun. 73, 7089-7098.
2. Wu, C-W, Glasner, J.,
Collins, M.T., Naser, S., Talaat, A.M. 2006, Whole genome plasticity among
Mycobacterium avium subspecies: insights from comparative genomic
hybridizations J. Bacteriol. 188, 711-723.
PROJECT
CONTACT:
Name: Talaat, A. M.
Phone: 608-262-2861. Fax: 608-262-7420
Email:
atalaat@wisc.edu
PROJ
TYPE:
STATE
PROJ STATUS: TERMINATED
START: 01 JUL 2001 TERM:
30 JUN 2003 FY: 2003
INVESTIGATOR: Collins, M. T.; Kelm, S. C.; Baumann, L.
E.
PERFORMING INSTITUTION:
SUBJECT: Johne's disease
prevalence in a dairy breed compared with the
NON-TECHNICAL SUMMARY: Johne's disease is an infectious
gastro-intestinal disorder that affects dairy cattle worldwide. This
project examines the prevalence of this disorder in dairy cattle breeds other
than Holsteins in an effort to determine if certain breeds are more resistant to
Johne's disease than
No publications reported
this period
PROJECT
CONTACT:
Name: Collins, M. T.
Phone: 608-262-8457. Fax: 608-265-1958
Email:
mcollin5@facstaff.wisc.edu
PROJ
TYPE:
STATE
PROJ STATUS: TERMINATED
START: 01 JUL 2003 TERM:
30 JUN 2005 FY: 2005
INVESTIGATOR: Collins, M.; Kelm, S.; Baumann, L.
PERFORMING INSTITUTION:
SUBJECT: Evaluating stage of lactation and
pooled sample effects for Johne's tests utilizing fecal culture.
NON-TECHNICAL SUMMARY: Johne's disease affects a majority of
APPROACH: Blood and
fecal samples will be collected from 100 serum ELISA-positive cows that are in
their second or higher lactation and reside in western
IMPACT: 2003/07 TO
2005/06 Johne’s disease represents a significant economic cost to dairy
farms in the
No publications reported
this period
PROJECT
CONTACT:
Name: Collins, M. Phone:
608-263-9801. Fax: 608-265-6748
Email:
mcollin5@wisc.edu
The Animal Welfare Information Center, Contact AWIC
http://www.nal.usda.gov/awic/pubs/johnes/johnes2.htm
October
16, 2006