HIV BLAST Examples
Output
All BLAST results begin with a table of the best matches to your query sequence. Matches are excluded if the %Identity is <50% or if the length of the match is <20% of the length of the query sequence.
Output columns:
- Download. Use these boxes to select sequences for download. Check/uncheck the top box to select all or unselect all.
- Accession. This will link you to the accession record for each sequence indicated.
- Name. The common name of the sequence in our database.
- Subtype. The sequence subtype, if defined.
- Country. The sampling country.
- Year. The sampling year.
- Description. The GenBank sequence description.
- Score. The score is calculated by the BLAST algorithm. It takes into account both the length of alignment and percent of matching bases. Click score to jump to the alignment of this sequence, below (pairwise output only).
Note that results are listed by score, and score is not always correlated with percent identity. For example, if you BLAST a full-length sequence, the top scores will be other full-length sequences; shorter sequences of higher identity will be missed.
- E value. The likelihood that this match is to occur by chance.
- Identities. The number and percent identity between your query and this subject, across the longest continuous alignment.
- Problematic. If any of the subject sequences are problematic, they will be indicated in this column. If none of the subject sequences are problematic, this column will not appear in your results. For information about problematic codes, see Search Help.
- Location of match. Shows the location and length of the subject sequence (yellow) and the matched region between query and subject (red).
Pairwise versus Master-Slave output
Following the list of best matches there appears an alignment of your query sequence to its matches. There are two different styles of alignment to choose from in the pop-up menu on the BLAST search submission page.
Pairwise:
In pairwise output, the query is matched against each single subject sequence and the identities are shown by the vertical bar ( | ) character.
Score = 541 bits (273), Expect = e-154
Identities = 273/273 (100%), Positives = 273/273 (100%)
Query: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa 60
Query: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120
Master-Slave with identities:
Query seq 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa 60 Z29296 1 ............................................................ 60 U95417 433 .............a.........g......g............................. 492 U95414 433 .....c.................g......g............................. 492 U95413 433 .............a.........g......g............................. 492 U95411 433 .............a.........g......g............................. 492 U95410 433 .............a.........g......g............................. 492 L21486 49 .............a.........g......g............................. 108 L21468 49 .............a.........g......g............................. 108 U95419 433 .............a.........g......g............................. 492 U95400 430 ............aat........g.............g............c......... 489 U95392 430 ............aat........g.............g............c......... 489 L21480 49 .............a.........g......g............................. 108 Z67943 4 ....................................g...................g... 63
Here the query is aligned against ALL sequences producing a BLAST match and the identities are shown by the dot character.
Occasionally you may see lines in the alignment that look like those below.
QUERY 121 ccaggcagagcattttatacaacaggagaaataataggagatataagtcaagcacattgt 180
AF105870 121 ............................................................ 180
\
|
a
This means that an "a" nucleotide occurs in sequence AF105870 at position 157. The sequence of AF105870 in the region of this insertion reads tagAgag, where the "A" marks the inserted "a". If you choose to download a file of all or part of this alignment the insertions are handled as follows. The insertion is placed into its sequence and gaps are opened in all other sequences at that point. In the example above the alignment in the region of the "a" insertion would look like:
QUERY tag-gag AF105870 tagagag
Links
BLAST: return to input page.
BLAST references