The search textbox has an autosuggest feature. When you enter three or more characters,
a list of up to 10 suggestions will popup under the textbox. Use the arrow keys
to move through the suggestions. To select a suggestion, hit the enter key. Using
the escape key closes the listbox and puts you back at the textbox. The radio buttons
allow you to toggle between having all search items start with or contain the text
you entered in the search box.
![](https://webarchive.library.unt.edu/web/20120926075826im_/http://www.cancer.gov/images/spacer.gif)
ISIS 3521
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)
![](https://webarchive.library.unt.edu/web/20120926075826im_/http://www.cancer.gov/images/spacer.gif)
Synonym: | ![]() | DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) | |
![]() | |||
US brand names: | ![]() | Affinitac Affinitak | |
![]() | |||
Code names: | ![]() | CGP 64128A LY900003 | |
![]() |