![[logo] US EPA](https://webarchive.library.unt.edu/web/20090826052856im_/http://www.epa.gov/epafiles/images/logo_epaseal.gif){kind=logo}
2002 Progress Report: Genetics of Chlorpyrifos Risk in Minority Populations
EPA Grant Number: R827039C003Subproject: this is subproject number 003 , established and managed by the Center Director under grant R827039
(EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
Center: Mount Sinai Center for Children's Environmental Health and Disease Prevention Research
Center Director: Wolff, Mary S.
Title: Genetics of Chlorpyrifos Risk in Minority Populations
Investigators: Wetmur, James G. , Wolff, Mary S.
Institution: Mount Sinai School of Medicine
EPA Project Officer: Fields, Nigel
Project Period: August 1, 1998 through July 31, 2003 (Extended to July 31, 2004)
Project Period Covered by this Report: August 1, 2001 through July 31, 2002
Project Amount: Refer to main center abstract for funding details.
RFA: Centers for Children's Environmental Health and Disease Prevention Research (1998)
Research Category: Health Effects , Children's Health
Description:
Objective:A molecular genetic research project, closely related to the first three studies, seeks to elucidate the biological mechanisms for individual variation in susceptibility to pesticides. The study will evaluate genotypic and phenotypic heterogeneity in the enzymes that activate and detoxify the oxons of chlorpyrifos and other cholinesterase inhibiting organophosphate pesticides. It will be undertaken using biological samples obtained from the ethnically diverse population of mothers and infants enrolled in the prospective cohort study.
(1) To determine paraoxonase and butyrylcholinesterase enzyme kinetics and acetylcholinesterase activities in maternal and cord blood of 150 African-American and 150 Hispanic mother-infant pairs who are part of the study cohort described in Project 2, as well as 100 Caucasian mother-infant pairs. One of the substrates for determining the enzyme kinetics will be chlorpyrifos oxon. The substrates for paraoxonase and arylesterase activities of paraoxonase will be selected to distinguish these activities. Butyrylcholinesterase also will be assayed with multiple substrates and inhibitors.
(2) To determine the frequency of polymorphisms (or mutations) in the paraoxonase and butyrylcholinesterase genes in the same three population groups. For both enzymes, the well established polymorphisms or mutations will be determined. Where the chlorpyrifos oxon and other substrate specificities do not agree with expectation for the known polymorphisms or mutations, the exon sequences and splice junctions will be determined. In samples with a very low enzymatic activity, the two promoters also will be investigated to relate phenotype to genotype.
(3) To establish an in vitro model for determining the relative contributions of paraoxonase and butyrylcholinesterase to detoxification of low concentrations of chlorpyrifos and related compounds. This phenotypic model will permit conversion of measurements of total exposure to chlorpyrifos to specific exposures to the oxon. The conversion factors for a genotypic model also will be determined.
(4) To compare the effects of total exposure to chlorpyrifos (Project 2) with specific exposure to chlorpyrifos oxon (phenotypic and genotypic) on the neurodevelopment of exposed neonates in minority populations in East Harlem.
Progress Summary:Chlorpyrifos, an insecticide implicated as a developmental neurotoxicant in animals, is utilized routinely in the homes of inner city residents. As part of an effort to measure the associated neurodevelopmental risks to specific individuals in this population, the paraoxonase and butyrylcholinesterase enzyme kinetics and acetylcholinesterase activities are being determined in maternal and cord blood of 150 African-American and 150 Hispanic mother-infant pairs who are part of the prospective epidemiological study cohort from Project 2, as well as 100 Caucasian mother-infant pairs. All of the samples studied in this Project are coded by Project 2.
As of 6/10/02, we have received coded 423 adult and 233 cord blood samples from Project 2. All samples were immediately separated into red cell, huffy coat and serum fractions. Serum aliquots were stored for subsequent analysis of enzyme activities. DNA was extracted and aliquots stored for genotyping.
The accomplishments of this project are:
Human paraoxonase (PON1) is a polymorphic arylesterase with 8- to 40-fold differences in serum paraoxonase/arylacetate activity ratios for certain substrates, such as paraoxon and phenylacetate, depending on the polymorphism Q192R. A second, frequent polymorphism (M55L), together with one or more of three recently-discovered common promoter polymorphisms (-909, -162, -108) leads to a change in the serum enzyme concentration. PON1 is found bound to HDL and protects both HDL and LDL from oxidation. PON1 has arylesterase activity and protects against cholinesterase inhibition by cleavage of organophosphate oxons. The common polymorphisms have been implicated as cardiovascular risk factors in non insulin-dependent diabetic patients. All five polymorphisms have been determined by ASPCR or PCR/RFLP. In addition, paraxonase activity has been determined by a high-throughput kinetic enzyme assay.
PON1 enzymatic activity was strongly dependent upon the promoter alleles in both maternal and cord blood. For example, PON1 activities for position -909 C/C, C/G and G/G mothers were 141, 133 and 116 arylesterase U/mI, (ANOVA, p<0.001), whereas the same PON1 activities for the respective cord bloods were 46.7, 35.7 and 20.6 U/mI, (p<0.00l). The trends were independent of race/ethnicity. Thus, not only do neonates have reduced capacity to detoxify organophosphates compared to adults, but this lower capacity is more strongly influenced by genotype than in adults.
Because the five polymorphisms in PON1 occur in a short stretch of DNA, they were tested for linkage disequilibrium. Significant linkage disequilibrium was found between the -909 alleles and M54L for Caucasians and Hispanics. Linkage between the -909 alleles and Q191R was not significant.
Butyrylcholinesterase is a suicide substrate for chlorpyrifos oxon, and thus may also play a role in protection of the central nervous system. The common polymorphism does not lead to an RFLP. Thus, we use the primer ATTCCATATTTTACAGGAAATGCTGATGAA together with one of two reverse primers ending in AA to determine a common polymorphism in BuChE. The sequence following the primer begins with AC or GC. The forward primer mismatches the template at the GC site. The PCR products incorporate an MwoI site, which cleaves at GCN7GC. This technique can usually be employed to allow PCR-RFLP genotyping rather than relying on more complicated dot-blot or allele-specific PCR methods. We have also completed these genotype analyses. A significant number of phenotype assay remain to be completed.
DNA pooling for epidemiological studies (including gene-environment interactions)
The ideal technology for screening SNPs requires high-throughput with minimal cost per sample, minimal usage of valuable DNA resources and maximal flexibility for introduction of new polymorphisms. Array hybridization which relies on the difference between hybridization of matched and mismatched products to allele-specific oligonucleotides on the array is powerful, although not foolproof for detecting heterozygosity. Other competing methods such as “Taqman” and molecular beacons probes require fluorescent labeling of probes, which increases the expense. We will describe a new technology, kinetic allele-specific PCR with DNA pooling, developed at Roche Molecular Systems [Germer S, Holland MJ, Higuchi R 2000. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res 10:258-66.]. In this study, the loss of sensitivity as a result of measurement error was typically minimal, compared with that due to sampling error alone, for population samples up to 1000. The method satisfies all of these criteria and offers a powerful new tool for detecting meaningful polymorphic differences in candidate gene association studies and genome-wide linkage disequilibrium scans.
We have carried out a blinded test of the technology. In brief, we had three individuals prepare pooled DNA samples from 252 individuals that we had genotyped for the PON1 gene by RFLP-PCR method. These three pooled DNA samples were genotyped by our collaborative investigators at Roche Molecular Systems using kinetic allele-specific PCR. Overall, from three poolings resulting in a total of 12 PCR measurements, the allele frequency was 0.449 ± 0.010 compared to that of 0.448 determined by PCR-RFLP. In work in progress, we have tested the method on subsets of our population. Our results demonstrate the utility of this powerful new technology for determining frequencies of SNPs in an epidemiological study.
Chlorpyrifos, an insecticide implicated as a developmental neurotoxicant in animals, is utilized routinely in the homes of inner city residents. In collaboration with Project 2, we are endeavoring to measure the associated neurodevelopmental risks specific for certain individuals in this population.
Future Activities:The next year will involve continued data collection as subjects are enrolled by Project 2.
Journal Articles:No journal articles submitted with this report: View all 1 publications for this subproject
Supplemental Keywords:, Toxics, Geographic Area, Scientific Discipline, Health, RFA, PHYSICAL ASPECTS, Susceptibility/Sensitive Population/Genetic Susceptibility, Risk Assessments, Health Risk Assessment, Physical Processes, Children's Health, Biochemistry, pesticides, Environmental Chemistry, State, exposure assessment, pest management, environmental hazard exposures, health effects, integrated pest management, assessment of exposure, human health risk, PCBs, pesticide residues, New York (NY), community support, community-based intervention, dietary exposure, pesticide exposure, sensitive populations, developmental toxicants, biological response, children, disease, exposure, PCB, environmental health hazard, human exposure
Progress and Final Reports:
2000 Progress Report
Original Abstract
Main Center Abstract and Reports:
R827039 Mount Sinai Center for Children's Environmental Health and Disease Prevention Research
Subprojects under this Center: (EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
R827039C001 Growing Up Healthy in East Harlem
R827039C002 Exposure to Indoor Pesticides and PCBs and their Effects on Growth and Neurodevelopment in Urban Children
R827039C003 Genetics of Chlorpyrifos Risk in Minority Populations
R827039C004 Prenatal PCB Exposure and Neurodevelopmental Outcomes in Adolescence and Adulthood
R827039C005 Neuroendocrine Mechanisms of Environmental Toxicants: PCBs and Pesticides