STR 26plex Assay
[Information on Loci] [PCR Primer Sequences] [Example Data] [Bins and Panels] [Protocols] [Additional Information]
Hill, C.R., Kline, M.C., Coble, M.D., Butler, J.M. (2008) Characterization of 26 miniSTR loci for improved analysis of degraded DNA samples. J. Forensic Sci. 53(1):73-80.
An 8plex assay has also been developed with a subset of these loci...[link]
Hill, C.R., Butler, J.M., Vallone, P.M. (2008) A 26plex autosomal STR assay to aid human identity testing. J. Forensic Sci., in press.
Locus Name |
Forward Dye Label |
Primer Sequence (5' - 3') |
Primer Concentration, µM |
GenBank accession |
D1GATA113 |
PET |
F - acattaagcacatgcctctttgt |
1 |
Z97987 |
|
|
R - Gatgaactcattggcaaaagga |
1 |
|
D1S1627 |
NED |
F - catgaggtttgcaaatactatcttaac |
2 |
AC093119 |
|
|
R - Gttttaattttctccaaatctcca |
2 |
|
D1S1677 |
6FAM |
F - gcagtcagcttgattgatcc |
3 |
AL513307 |
|
|
R - GTTTCTTagaatgcaatagcaaatatcagaatg |
3 |
|
D2S441 |
NED |
F - caaaaggctgtaacaagggcta |
1 |
AC079112 |
|
|
R - Gttcactctccttcccaaatgtt |
1 |
|
D2S1776 |
VIC |
F - ttacctgtgagtatgtgtgcgta |
1.5 |
AC009475 |
|
|
R - ggtgctaggtgtgctcagga |
1.5 |
|
D3S3053 |
VIC |
F - tgacacaaatggaccaagaca |
2 |
AC069259 |
|
|
R - GTTTCTTgagagagcccttgaaatagca |
2 |
|
D3S4529 |
NED |
F - cccaaaattacttgagccaat |
0.75 |
AC117452 |
|
|
R - Gagacaaaatgaagaaacagacag |
0.75 |
|
D4S2364 |
VIC |
F - ctaggagatcatgtgggtatgatt |
0.75 |
AC022317 |
|
|
R - Gcagtgaataaatgaacgaatgga |
0.75 |
|
D4S2408 |
NED |
F - agctgacatcttaccacatgttc |
2 |
AC110763 |
|
|
R - Gtgcttggcatatattaagacactgta |
2 |
|
D5S2500 |
VIC |
F - gtttactgataaaccaaatgatgtgc |
2 |
AC008791 |
|
|
R - Gtaacttaaagggtaaatgtttgcag |
2 |
|
D6S474 |
6FAM |
F - ggttttccaagagatagaccaatta |
1.5 |
AL357514 |
|
|
R - Gtcctctcataaatccctactcatatc |
1.5 |
|
D6S1017 |
NED |
F - agatgggaacgatgcagaca |
2 |
AL035588 |
|
|
R - gcataaatggatgggtggat |
2 |
|
D8S1115 |
PET |
F - gcaccatttcacatatcca |
6 |
AC090739 |
|
|
R - Gcagtctcctaagtagc |
6 |
|
D9S1122 |
VIC |
F - gggtatttcaagataactgtagatagg |
0.75 |
AL161789 |
|
|
R - Gcttctgaaagcttctagtttacc |
0.75 |
|
D9S2157 |
NED |
F - gatcacgccacggta |
5 |
AL162417 |
|
|
R - Gttctccatttcaaagatcat |
5 |
|
D10S1248 |
6FAM |
F - cagtaaaaagcaaacctgagca |
1 |
AL391869 |
|
|
R - gcttggcaaagagcagatg |
1 |
|
D10S1435 |
VIC |
F - cacgttgggtttcctgactt |
1 |
AL354747 |
|
|
R - Gcccagctacttgggatgcta |
1 |
|
D11S4463 |
6FAM |
F - ctgtcccaaggctgagtgtt |
3 |
AP002806 |
|
|
R - GTTTCTTcgcagggcaaataaaaagaa |
3 |
|
D12ATA63 |
6FAM |
F - aggtggcagtgagctgtaac |
1 |
AC009771 |
|
|
R - GTTtcttggattttgagggccta |
1 |
|
D14S14343 |
PET |
F - ggctctgatttccaccactg |
2 |
AL121612 |
|
|
R - Gcaactcttggaagcccagtc |
2 |
|
D17S974 |
NED |
F - ggaacacttgagcca |
2 |
AC034303 |
|
|
R - gtggactggggtaagg |
2 |
|
D17S1301 |
PET |
F - aagatgaaattgccatgtaaaaata |
2 |
AC016888 |
|
|
R - Gtgtgtataacaaaattcctatgatgg |
2 |
|
D18S853 |
PET |
F - acatatataatgtgagaaaggaggagt |
2 |
AP005130 |
|
|
R - Gttaatgggtgcaacacacc |
2 |
|
D20S482 |
PET |
F - ctccattctctcacacccaat |
1 |
AL121781 |
|
|
R - Gcacttctggcttttctggttc |
1 |
|
D20S1082 |
6FAM |
F - acatgtatcccagaacttaaagtaaac |
1 |
AL158015 |
|
|
R - Gcagaagggaaaattgaagctg |
1 |
|
D22S1045 |
6FAM |
F - ccctgtcctagccttcttatagc |
1 |
AL022314 |
|
|
R - Gctgtgcccaagttgagagaa |
1 |
|
Amelogenin |
PET |
F - ccctttgaagtggtaccagagca |
2 |
M55418, M55419 |
|
|
R - gcatgcctaatattttcagggaata |
2 |
|
Example Data (1ng DNA, 30 cycles):
Click to download Bins and Panels for GeneMapperID v3.2
Results with Standard Samples (SRM 2391b components including 9947A, 9948 and K562, ABI 007):
http://www.cstl.nist.gov/biotech/strbase/miniSTR/miniSTR_NC_loci_types.htm
Examples of Artifacts Observed During Multiplex Testing Leading to Primer Redesign
Examples of non-specific products, artifacts, and incomplete adenylation that occurred with three loci (D3S3053, D17S974, D20S1082, respectively) indicating that the primer sets were incompatible and therefore candidates for redesign:
An example sequence map in Lasergene software of D3S3053.
All arrows pointing to the right represent forward primers and the arrows pointing to the left are reverse primers. The box in the center is the repeat motif and all of the theoretical PCR amplicon “amp” sizes are listed between the primers. The arrows closest to the repeat box are the miniSTR primers, the arrows labeled with “Seq” are the sequencing primers, the arrows labeled “MMP” are the first set of multiplex primers, and the arrows labeled “MMP new” are the second set of redesigned multiplex primers.
Representative Sensitivity Study data:
Lowest DNA template amounts for each cycling: 28, 30, and 32 cycles
Concordance Studies
A modified version of the multiplex (with 22 autosomal loci and amelogenin – 23plex) was used in concordance evaluations with the miniSTR data to determine the presence of null alleles, a mutation rate study with father/son sample pairs to examine mutation rates with these primer sets, and an extended family study to determine how extra autosomal loci affect close family relationship forensic testing.
Concordance Study info:
The use of non-overlapping primers for the majority of the loci permits the detection of allelic drop out. About half of the dropout is from 23plex primers indicating that the flanking regions near STR repeat do not appear to have a higher level of mutation.
Two examples of discordance between the 23plex primers and the miniSTR primers. A. The first illustrates a primer binding site mutation in the 23plex primers. B. The second illustrates a primer binding site mutation in the miniSTR primers.
Mutation Rates
List of calculated mutation rates for the 23plex and all commercially used markers, including the 13 CODIS loci.
Mutation Rate |
||
TH01 |
0.01% |
|
TPOX |
0.01% |
|
23plex |
0.07% |
|
D7S820 |
0.10% |
|
D5S818 |
0.11% |
|
D16S539 |
0.11% |
|
D19S433 |
0.11% |
|
D3S1358 |
0.12% |
|
D2S1338 |
0.12% |
|
D8S1179 |
0.14% |
|
D13S317 |
0.14% |
|
Penta D |
0.14% |
|
CSF1PO |
0.16% |
|
Penta E |
0.16% |
|
VWA |
0.17% |
|
D21S11 |
0.19% |
|
D18S51 |
0.22% |
|
FGA |
0.28% |
|
SE33 |
0.64% |
Mutation observed in 22 STR loci examined across 395 father/son pairs previously confirmed via Identifiler and Yfiler testing:
Ethnicity |
Locus |
Allele (father) |
Allele (child) |
African American |
D6S474 |
14,16 |
17,17 |
Caucasian |
D2S1776 |
13,13 |
12,14 |
Hispanic |
D11S4463 |
14,15 |
13,16 |
Asian |
D10S1435 |
11,14 |
12,13 |
Asian |
D3S4529 |
13,13 |
15,15 |
Asian |
D20S482 |
12,15 |
13,14 |
Extended Family Samples Study
Schematic of the extended family samples received from DNA Diagnostics Center. This figure illustrates all of the family relationships that were tested in this study.
Likelihood Ratio (LR) comparisons of different family relationships between the 15 autosomal loci of Identifiler and the 22 autosomal loci of the 23plex + the 15 loci from Identifiler (37 loci total).
Relationship Examined |
15 STRs (Identifiler, ID15) |
ID15 + 23plex 22 STRs = 37 loci (A37) |
Mother/Child* |
0.214 |
5,200,000 |
Siblings |
477 |
113,000 |
Uncle/Nephew |
824 |
247,000 |
Cousins |
0.45 |
2.25 |
Grandparents/Grandchildren |
0.53 |
1.42 |
For more information, see Butler, J.M., Hill, C.R., Decker, A.E., Kline, M.C., Reid, T.M., Vallone, P.M. (2007) New autosomal and Y-chromosome STR loci: characterization and potential uses. Proceedings of the Eighteenth International Symposium on Human Identification. Also available at http://www.promega.com/geneticidproc/ussymp18proc/oralpresentations/Butler.pdf.
Last Updated: 10/21/2008