If you are familiar with GenBank sequence submission tools such as
Sequin, BankIt or tbl2asn, you can continue using these tools.
A streamlined GenBank submission pipeline for the submission of Influenza virus sequences has been established. To use this pipeline, just follow the
three simple steps:
1. Prepare a table (in tab-delimited or Microsoft Excel format) containing sample information as shown below. For a template, you
can:
Download an Excel file, or
Download a tab-delimited text file.
Instructions for making the table:
A. Headers of the table should be exactly the same as those in the example for existing fields.
B. "Blinded Number" should be unique for each virus (and with an institution-specific prefix is highly recommended). Avoid using symbols other
than letters, numbers or dashes.
C. Organism name should follow influenza naming convention (A/non-human host/location/isolate number/year in four digits(subtype)).
D. Use only GenBank standard country names in the "Country" field (e.g.
United Kingdom, not England).
E. Collection date should be in the format of DD-Mmm-YYYY (e.g. 03-Jul-2009).
F. Use lower cases for "Host" names, except for proper names (e.g. American wigeon).
G. Additional source information can be included at the end of the table for inclusion in GenBank.
2. Prepare all nucleotide sequences in one FASTA
file, as shown in an example below. You can also download the
example file.
>WIV-123456.4
GATCAGATTTGCATTGGTTACCATGCAAACAATTCAACAGAGCAGGTTGACACAATCATG
GAAAAGAACGTTACTGTTACACATGCCCAAGACATACTGGAAAAGACACACAACGGGAAG
CTCTGCGATCTAGATGGAGTGAAGCCTCTAATTTTAAGAGATTGTAGTGTAGCTGGATGG
...
>WIV-123456.7
AGCAAAAGCAGGTAGATATTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCT
CTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAAACTTGAAGATGTTTT
...
>CDC07726225.6
AGCAAAAGCAGGAGATTAAAATGAATCCAAATCAGAAGATAATAACCATTGGATCAATCT
...
|
The blinded number should be included in the definition line of the corresponding sequence. Sequences of different segments for each virus are
identified by adding a suffix with the segment number to the blinded number in the
definition line of the sequence file (e.g. >CDC07726225.6 for segment 6 of sample CDC07726225).
3. Send the table and sequence files in an email to: genomes@ncbi.nlm.nih.gov.
A list of authors and a brief description of the sequences (or the title of a manuscript) should also be provided in the email.
After receiving these data, NCBI staff will start the GenBank submission process and communicate with submitters if there are any
issues with the submission.
Contact us if you have any questions.
|