National Cancer Institute
U.S. National Institutes of Health | www.cancer.gov
In English | En español
NCI Home
Cancer Topics
Clinical Trials
Cancer Statistics
Research & Funding
News
About NCI
NCI Drug Dictionary
Page Options
Print This Page
More NCI Dictionaries
Dictionary of Cancer Terms

Glossary of Statistical Terms

NCI Dictionary of Genetics Terms

Terminology Resources
Quit Smoking Today
Search for
# A B C D E F G H I J K L M N O P Q R S T U V W X Y Z All

ISIS 3521
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)

Synonym:DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
US brand names:Affinitac
Affinitak
Code names:CGP 64128A
LY900003



Previous:iron sucrose injection, IRX-2, Iscar, Iscomatrix, ISIS 2503
Next:ISIS 5132, isoniazid, isosulfan blue, isotretinoin, Isovorin

A Service of the National Cancer Institute
Department of Health and Human Services National Institutes of Health USA.gov