![](https://webarchive.library.unt.edu/eot2008/20090506090142im_/http://www.cdc.gov/ncidod/EID/images/spacer.gif)
|
![](https://webarchive.library.unt.edu/eot2008/20090506090142im_/http://www.cdc.gov/ncidod/EID/images/spacer.gif) |
Dispatch
Accidental Infection of Laboratory
Worker with Vaccinia Virus
Nissin Moussatché,* Mari Tuyama,† Sayuri E.M. Kato,* Ana Paula
V. Castro,* Brian Njaine,* Regina H. Peralta,‡ José M. Peralta,‡ Clarissa
R.A. Damaso,* and Paulo F. Barroso†
*Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio
de Janeiro, Rio de Janeiro Brazil; †Hospital Universitário Clementino
Fraga Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil;
and ‡Instituto de Microbiologia Prof. Paulo de Góes, Universidade Federal
do Rio de Janeiro, Rio de Janeiro, Brazil
Suggested citation for this article: Moussatché
N, Tuyama M, Kato SEM, Castro APV, Njaine B, Peralta RH, et al. Accidental
infection of laboratory worker with vaccinia. Emerg Infect Dis [serial
online] 2003 Jun [date cited]. Available from: URL: http://www.cdc.gov/ncidod/EID/vol9no6/02-0732.htm
We report the accidental
needlestick inoculation of a laboratory worker with vaccinia virus.
Although the patient had previously been vaccinated against smallpox,
severe lesions appeared on the fingers. Western blot and polymerase
chain reaction–restriction fragment length polymorphism were used to
analyze the virus recovered from the lesions. The vaccinia virus–specific
immunoglobulin G levels were measured by enzyme-linked immunosorbent
assay. Our study supports the need for vaccination for laboratory workers
that routinely handle orthopoxvirus.
The smallpox vaccine, formulated with vaccinia virus, is a highly effective
immunizing agent. In 1980, the World Health Organization certified that
the world was free of naturally occurring smallpox, and smallpox immunization
programs were subsequently discontinued (1). Vaccination
is still recommended for particular groups, namely, healthcare workers
who handle materials potentially infected with vaccinia virus or other
orthopoxviruses that infect humans (2).
The use of vaccinia virus in laboratories is likely to increase as a
consequence of international concerns about the potential use of variola
(smallpox) virus as a bioterrorism weapon. The vaccine is considered safe
but can produce mild to moderate disease in vaccinees and can be disseminated
to their close contacts (1,3,4). Accidental infections
have also been reported. In 1991, an accidental infection with recombinant
vaccinia virus was described after a needlestick injury on the left thumb
of a laboratory worker (5). A case of vaccinia keratouveitis
has been reported after accidental ocular autoinoculation from a recent
vaccination site (6). We now report the accidental infection
of a laboratory worker who manipulated vaccinia virus–infected cells.
Case Report
A 26-year-old healthy laboratory worker, previously vaccinated against
smallpox in childhood, sought treatment in March 2002 with a history of
pain followed by the appearance of erythema and a pustule on the left
thumb (Figure 1A). These symptoms appeared 3 days
after she experienced an accidental needlestick while working with material
from a vaccinia virus (strain WR)–infected cell culture during a virus
purification procedure. Local symptoms worsened, and on the days 5 and
6, respectively, she noticed new pustules on the fourth and fifth fingers
of the same hand (Figure 1E). Axillary lymphadenopathy
was noticed on the day 6 after the accident. On day 8, necrotic areas
around the lesions and a large erythemathous lesion appeared on the left
forearm. On day 9 after inoculation, the local lesions worsened and amoxicillin/clavunate
(1,750/250 mg per day) was administered because of a clinical suspicion
of secondary bacterial infection (Figure 1B, F).
The hand lesions were surgically excised to remove the necrotic tissue,
and pustular fluid was collected for analysis (Figure
1C, G). After the surgical procedure, the patient improved slowly
until she made a full recovery (Figure 1D, H),
and the lesions healed in approximately 3 weeks.
Results
Pustular fluid from the lesions was collected and tested for the presence
of bacteria and virus. The Gram stain and cultures were negative for bacteria.
When a diluted sample of the pustular fluid was added to BSC-40 (monkey
kidney) cell culture, a poxviruslike cytopathic effect was evident after
48 h of infection (data not shown). Vaccinia virus proteins were detected
in infected cells by 12% sodium dodecylsulfate–polyacrylamide gel electrophoresis
(SDS-PAGE), followed by Western Blot analysis with rabbit antiserum raised
against total vaccinia virus proteins as described before (7).
The protein profile was indistinguishable from that of the WR strain of
vaccinia virus currently used in the laboratory (Figure
2A). The presence of vaccinia virus genome in the pustular fluid could
be demonstrated by polymerase chain reaction (PCR), followed by restriction
fragment length polymorphism (RFLP) of the phenol-chloroform–extracted
DNA from BSC-40 cells infected with the clinical sample for 24 h at 37°C
(8). Total DNA isolated from cells infected with the
vaccinia virus–WR was used as reference. Two regions of the vaccinia virus
genome were analyzed by using the following PCR primers: A24Rfwd 5'ATGAAAAAAAACACTGATTC
and A24Rrev 5'TTACACCAGAAAAGACGGCT; B9Rfwd 5'GACTAAATATTCATAA and B14Rrev
5'TACTAAAGTTCCGTCATC. The A24R gene was used as marker for the nonvariable
region of the virus genome, and the PCR amplicons were digested with the
endonucleases SspI and RsaI (New England Biolabs, Beverly,
MA, USA), as recommended by the manufacturer. The variable region of vaccinia
virus genome was investigated by amplifying the DNA segment from the B9R
to B14R genes and digestion of the amplicons with EcoR V and AluI
(Life Technologies, Rockville, MD, USA), as recommended. The digestion
products were analyzed by using 1.2% agarose gels. The restriction patterns
obtained for both regions in the test sample were identical to the profiles
observed with the genome of vaccinia virus–WR (Figure
2B).
Serum collected from the patient day 20 after the initial inoculation
was tested for vaccinia virus–specific immunoglobulin (Ig) G response
by enzyme-linked immunosorbent assay (ELISA) as described (9,10).
Purified vaccinia virus (1 mg/mL in 0.05 M carbonate buffer, pH 9.6) was
used as the antigen, and the serum samples were diluted 1/100. Bound antibodies
were detected with peroxidase-labeled, anti-human IgG (Biolab Diagnóstica,
São Paulo, Brazil) dulated 1/8,000 as described (9,10).
The optical density (OD) values were obtained with a microtiter plate
spectrophotometer at 450 nm (BioRad, Model 3550 UV, Bio-Rad Laboratories,
Hercules, CA, USA). The test serum specimen was compared to a panel of
serum specimens from 22 unvaccinated persons and 11 persons who had been
vaccinated some time previously, including a sample from the laboratory
worker taken 6 years before the accident. When we compared the serum specimens
collected before and after the accident, we observed an increase by a
factor of 3.5 in the IgG-antibody response to vaccinia virus (Figure
2C). Furthermore, the vaccina virus–specific IgG levels in the test
serum were 1.6 to 2.8 times higher than the levels in the panel of positive
control samples and >5 times higher than levels in naive persons. Together,
these results confirm that after the recent accident, a productive infection
was found in the lesion and an immune response to vaccina virus was elicited.
Conclusions
Accidental infection with live pathogens by healthcare and laboratory
workers has been frequently reported (11,12). The risk
of infection cannot be avoided, although it can be prevented or minimized
by safety measures. In some cases, vaccination of the workers is the best
way to prevent the disease; however, vaccines are not always available.
We report the response of a laboratory worker to an accidental needlestick
inoculation with vaccinia virus in 2002. After the accident, typical symptoms
of vaccinia infection developed in the worker, followed by full recovery
4 weeks later. Vaccinia virus could be reisolated from the pustular fluid,
and no major variation from the original seed virus was detected. Although
the patient had been vaccinated against smallpox >20 years ago, a serum
sample isolated 6 years before the accident showed a level of vaccina
virus–specific IgG antibodies approximately 2 times higher than the level
in naive persons. This level of humoral immunity was not able to prevent
the progression of the infection as would be expected if she had been
vaccinated recently. This result indicates that despite the high IgG levels
induced after vaccina virus inoculation, persons vaccinated for >20
years are no longer fully protected against vaccina virus infection and
could be vulnerable to variola virus or other orthopoxviruses that infect
humans.
Nevertheless, we should consider some aspects of this accident that are
not common in other situations (e.g., revaccination). The amount of virus
in the needle before the accident was approximately 1,000 times higher
than the amount in the vaccine preparations used for smallpox vaccination
(1). Even in a recently vaccinated person, a response
to an infection of such high magnitude will most likely result in a local
lesion. However, the question of whether a major reaction with severe
symptoms would emerge in this hypothetical situation remains. Usually,
a severe reaction has occurred only when a long period has elapsed after
vaccination (1). Therefore, after a properly conducted
risk assessment, laboratory workers vaccination should be considered as
an occupational protection measure against accidental exposure to orthopoxviruses.
The results of this study support the current Advisory Committee on Immunization
Practices guidelines that recommend a 1-year vaccination regimen for workers
who handle low-virulence poxvirus and a 3-year regimen for workers that
handle high-virulence strains.
This work was partly
supported by grants from Conselho Nacional de Desenvolvimento Cientifico
e Tecnológico (CNPq) and Fundaçao Carlos Chagas Filho de Amparo à Pesquisa
do Estado do Rio de Janeiro (FAPERJ) to C.D.; FAPERJ and CNPq to N.M.,
A.C., and B.N. were recipients of a fellowship from CNPq.
Dr. Moussatché is
an associate professor at the Instituto de Biofísica Carlos Chagas Filho,
Universidade Federal do Rio de Janeiro, and head of the Laboratório
de Biologia Molecular de Vírus there. His main research interests include
host-cell interactions and the molecular biology of Cantagalo virus
(an emergent poxvirus isolated in Brazil) and general molecular aspects
of vaccinia virus transcription and DNA replication.
References
- Fenner F, Henderson DA, Arita I, Jezek Z, Ladnyi ID.
Smallpox and its eradication. Geneva: World Health Organization; 1988.
- Vaccinia (smallpox) vaccine, 2001: recommendations of the Advisory
Committee on Immunization Practices (ACIP). MMWR Morb Mortal Wkly Rep
2001;50:1–25.
- Spencer, RC, Lightfoot, NF. Preparedness
and response to bioterrorism. J Infect 2001;43:104–10.
- Centers for Disease Control and Prevention. Smallpox response plan
and guidelines (version 3.0). October 28, 2002. Available from: URL:
http://www.bt.cdc.gov/agent/smallpox/response-plan/index.asp
- Openshaw PJM, Alwan WH, Cherrie AH, Record FM. Accidental
infection of laboratory worker with recombinant vaccinia virus.
Lancet 1991;338:459.
- Lee SF, Buller R, Chansue E, Hanika WC, Brunt EM, Aquino T, et al.
Vaccinia
keratouveitis manifesting as a masquerade syndrome. Am J Ophthalmol
1994;117:480–7.
- Damaso CRA, Esposito JJ, Condit RC, Moussatché N. An
emergent poxvirus from humans and cattle in Rio de Janeiro State: Cantagalo
virus may derive from Brazilian smallpox vaccine. Virology 2000;
277:439–49.
- Damaso CRA, Oliveira MF, Massarani SM, Moussatché N. Azathioprine
inhibits vaccinia virus replication in both BSC-40 and RAG cell lines
acting on different stages of virus cycle. Virology 2002;300:79–91.
- Peralta RHS, Vaz AJ, Pardini A, Macedo HW, Machado LR, De Simone SG,
et al. Evaluation
of an antigen from Taenia crassiceps cysticercus for the serodiagnosis
of neurocysticercosis. Acta Trop 2002;83:159–68.
- Konya J, Thompson CH, De Zwart-Steffe RT. Enzyme-linked
immunosorbent assay for measurement of IgG antibody to Molluscum contagiosum
virus and investigation of the serological relationship of the molecular
types. J Virol Methods 1992;40:183–94.
- Herwaldt BL. Laboratory-acquired
parasitic infections from accidental exposures. Clin Microbiol Rev
2001;14:659–88.
- Zule WA, Desmond DP, Neff JA. Syringe
type and drug injector risk for HIV infection: a case study in Texas.
Soc Sci Med 2002;55:1103–13.
|