Disease characteristics. Spastic paraplegia 7 (SPG7) is characterized by insidiously progressive bilateral lower limb weakness and spasticity. Most affected individuals have proximal or generalized weakness in the legs and impaired vibration sense. Onset is mostly in adulthood, although symptoms may start as early as age 11 years and as late as age 72 years. Additional features such as hyperreflexia in the arms, sphincter disturbances, spastic dysarthria, dysphagia, pale optic disks, ataxia, nystagmus, strabismus, decreased hearing, scoliosis, pes cavus, motor and sensory neuropathy, and amyotrophy may be observed.
Diagnosis/testing. The diagnosis of SPG7 is suspected in individuals with characteristic neurologic findings and is confirmed by detection of disease-causing mutations in SPG7, the gene encoding the protein paraplegin. SPG7 is the only gene known to be associated with SPG7. Sequence analysis and deletion analysis are clinically available.
Management. No specific treatment for SPG7 exists. Drugs that may reduce spasticity and muscle tightness include baclofen, tizanidine, dantrolene, and diazepam. Physical therapy and assistive walking devices often reduce contractures, provide support, and promote stability. Occupational therapy helps with activities of daily living. Surveillance includes annual neurologic evaluation to identify potential complications of spasticity, such as contractures.
Genetic counseling. SPG7 is inherited in an autosomal recessive manner. Heterozygotes (carriers) are usually asymptomatic. Each sib of an affected individual has a 25% chance of being affected, a 50% chance of being an asymptomatic carrier, and a 25% chance of being unaffected and not a carrier. Prenatal diagnosis for pregnancies at increased risk is possible if both disease-causing alleles have been identified in an affected family member.
The diagnosis of spastic paraplegia 7 (SPG7) is suspected in the presence of the following:
Insidiously progressive bilateral leg weakness
Spasticity
Decreased vibratory sense caused by degeneration of cortical spinal axons and dorsal columns
Neurologic examination demonstrating:
A pure phenotype of spastic paraplegia with hyperreflexia, extensor plantar responses, and mildly impaired vibration sensation in the distal legs
OR
In some individuals, a complicated phenotype of spastic paraplegia including pale optic disks, slowed speech, swallowing difficulties, urinary urgency, ataxia, nystagmus, strabismus, decreased hearing, scoliosis, pes cavus, motor and sensory neuropathy, and amyotrophy [Harding 1983, De Michele et al 1998, Fink 2003, Wilkinson et al 2004, Elleuch et al 2006]
Family history consistent with autosomal recessive inheritance
The diagnosis is confirmed by detection of disease-causing mutations in the SPG7 gene.
Neuroimaging
In a few individuals, cerebral MRI may show cerebellar (or, less frequently, cortical) atrophy [De Michele et al 1998, Wilkinson et al 2004, Elleuch et al 2006].
Spinal imaging studies are useful in the differential diagnosis to exclude other anomalies of the ponto-medullary junction and of the cervical and dorsolumbar medulla.
Other investigations
Spinal evoked potentials may reveal delayed prolongation of the central conduction time [Nielsen et al 2001].
Paired transcranial magnetic stimulation (TMS) may show delayed prolongation of the central motor conduction time and motor threshold in some affected individuals. The intracortical inhibition seems normal in SPG7 [Nardone et al 2003].
GeneReviews designates a molecular genetic test as clinically available only if the test is listed in the GeneTests Laboratory Directory by either a US CLIA-licensed laboratory or a non-US clinical laboratory. GeneTests does not verify laboratory-submitted information or warrant any aspect of a laboratory's licensure or performance. Clinicians must communicate directly with the laboratories to verify information.—ED.
Gene. SPG7, which encodes the protein paraplegin, is the only gene known to be associated with SPG7 [Casari et al 1998].
Clinical uses
Clinical testing
Sequence analysis. All currently known missense, nonsense, and splice site mutations can be detected using sequence analysis.
Deletion/duplication analysis. Deletion/duplication analysis for the 9.5-kb deletion that includes exons 12-17 as described by Casari et al 1998 is available on a clinical basis.
Table 1 summarizes molecular genetic testing for this disorder.
Test Method | Mutations Detected | Mutation Detection Frequency by Test Method | Test Availability |
---|---|---|---|
Sequence analysis | SPG7 sequence variants | 100% 1 | Clinical |
Deletion/duplication analysis | 9.5 kb deletion involving exons 12-17 of SPG7 2 | Unknown |
SPG7 Exon | Forward Primer 5'→3' | Reverse Primer 5'→3' | Conditions | Size of PCR Products | ||
---|---|---|---|---|---|---|
Temperature (°C) | MgCl2 | DMSO | ||||
Exon 1 | ATCACGCAGGCGCGGCTTTCAG | CTGGGCCTTAACAGAGCAGA | 58 | 2 | 10% | 271 |
Exon 2 | GTTGGTGTGACCTCCAGTATTG | CTGAGAGGCGGTAAGTGTGC | 52 | 2 | — | 197 |
Exon 3 | TGTTGTCCTGTATGCCTCCC | CATCCAGAGGCAGCTACTGA | 57 | 1.5 | — | 202 |
Exon 4a | CCGTGTCTGTTGCTCATGTG | CCAGGGTGCAGGTAGACTTC | 56 | 2 | — | 273 |
Exon 4b | CGACTTTGTCCACGAGATG | GCTGCCAGCCTGTGCCCA | 54 | 2 | 10% | 165 |
Exon 5 | GTAGGGTTGCTCGTCTGTC | AGCCAAGTTAGGTTTAGTTCA | 54 | 2 | — | 244 |
Exon 6 | TGTGCCTGCCTCTCTTTCTT | ACCAGAAAGAGTTCAGAGAGC | 54 | 2 | — | 169 |
Exon 7 | CCAGCTCCTTGCACTTTGTT | CCTCTGCTCACACCTCCCT | 56 | 1.5 | — | 205 |
Exon 8 | AGTGTTGCATTGTCTGCTGC | ATGTGTGAAAGGAGCCAGGT | 56 | 2 | — | 252 |
Exon 9 | CTGCCCATTTCCTGATTCTC | ACCTCCTCTGATGGTGCAAT | 56 | 1.5 | — | 257 |
Exon 10 | GCAGGGGAAATCTGTTGTGTC | CACCAAGAAGTGTCTTAGAG | 54 | 2 | — | 281 |
Exon 11 | CGACTGTCTTTCCTCCCCTGGT | GCCTCGATGCTGTTTGCG | 54 | 2 | — | 211 |
Exon 12 | CACACCGTGGCTGTTTGTG | CTGGGTATTTCTGGGGTTCA | 56 | 1.5 | — | 202 |
Exon 13 | CCACCGCGCCCAACTCATAC | GGACTCCCCACCCACCTTTG | 61 | 1.5 | — | 215 |
Exon 14 | CATCCTGCCTACTGACCTGG | AAGGAGTCATGCAGGGAAAA | 61 | 1.5 | — | 250 |
Exon 15 | TCTGCGCCTGCAGTGCTGA | CCTTGTGTGGTAGACCCA | 56 | 1.5 | — | 286 |
Exon 16 | CTTTGGTGCTGGAGCCAGG | GACCGTGGGTGCTGTGTGG | 61 | 1.5 | 10% | 200 |
Exon 17 (last) | ACATGCATATGCCTGTTCTTT | CTCAGCTGAAAAGCAACTCAG | 57 | 1.5 | — | 312 |
G Casari, unpublished data. Primers are described in McDermott et al 2001.
Interpretation of test results. For issues to consider in interpretation of sequence analysis results, click here.
No other phenotypes are known to be associated with mutations in SPG7.
Spastic paraplegia 7 (SPG7) is characterized by insidiously progressive bilateral lower limb weakness and spasticity. Most affected individuals have proximal or generalized weakness in the legs and impaired vibration sense.
Onset is mostly in adulthood, although symptoms may start as early as age 11 years and as late as age 72 years [De Michele et al 1998, McDermott et al 2001, Wilkinson et al 2004].
Additional features such as hyperreflexia in the arms, sphincter disturbances, spastic dysarthria, dysphagia, pale optic disks, ataxia, nystagmus, strabismus, decreased hearing, scoliosis, pes cavus, motor and sensory neuropathy, and amyotrophy may be observed [Harding 1983, De Michele et al 1998, Fink 2003, Wilkinson et al 2004, Elleuch et al 2006].
Progression of disease may be rapid with severe disability after eight years' duration [Elleuch et al 2006, Schüle et al 2006].
Serum creatine kinase concentration may be slightly above the normal range in some cases.
Electromyography (EMG) with nerve conduction velocities (NCV) may reveal axonal sensory motor neuropathy.
Muscle biopsy may shed light on the pathogenic process and reveal the following:
Changes of denervation with partial reinnervation
Atrophic, angulated fibers, predominatly type II
Ragged-red fibers, which are positive for the histoenzymatic reaction to succinate dehydrogenase (SDH) and negative for cytochrome c oxidase (COX, the complex IV of the mitochondrial respiratory chain), indicating an oxidative phosphorylation (OXPHOS) defect [Casari et al 1998, McDermott et al 2001, Wilkinson et al 2004].
No genotype-phenotype correlations can be proposed based on published studies.
The prevalence of SPG7 is estimated to be around 2-6/100,000 for most countries.
Autosomal recessive inheritance appears relatively uncommon outside regions with a high rate of consanguineous marriages. Of note, a significant proportion of individuals with autosomal recessive SPG7 may present as simplex cases (i.e., a single occurrence in a family).
SPG7 is estimated to account for 5%-12% autosomal recessive HSP [Casari, personal observation; McDermott et al 2001; Elleuch et al 2006].
For current information on availability of genetic testing for disorders included in this section, see GeneTests Laboratory Directory. —ED.
No significant differences exist between spastic paraplegia 7 (SPG7) and other types of pure autosomal dominant and autosomal recessive spastic paraplegia [Fink 2002, 2003]. See Hereditary Spastic Paraplegia Overview for a review.
Other conditions that need to be considered in the differential diagnosis of SPG7:
Structural abnormalities of the brain or spinal cord
Adrenomyeloneuropathy and other leukodystrophies (e.g., Krabbe disease, arylsulfatase A deficiency [metachromatic leukodystrophy]) [Bajaj et al 2002]
Vitamin B12 deficiency
Tropical spastic paraplegia (caused by HTLV1 infection)
Primary lateral sclerosis (PLS)
Arginase deficiency [Prasad et al 1997]
Evaluation by a multidisciplinary team that includes a general practitioner, neurologist, medical geneticist, physical therapist, social worker, and psychologist should be considered in individuals with spastic paraplegia 7 (SPG7).
No specific drug treatments or cures exist for SPG7.
Drugs to reduce spasticity and muscle tightness include baclofen, tizanidine, dantrolene, and diazepam — preferably administered one at a time.
Management of spasticity by intrathecal baclofen or intramuscular botulinum toxin injections may be an option in selected individuals [Young 1994].
A combination of physical therapy and assistive walking devices are often used to reduce contractures, provide support, and promote stability.
Occupational therapy is often helpful in managing activities of daily living.
Annual neurologic evaluation can help identify potential complications of spasticity that develop over time (e.g., contractures).
In an SPG7 mouse model using intramuscular viral delivery of the gene to correct some of the defects, Pirozzi et al (2006) observed an improvement of neuropathologic changes and mitochondrial morphology, described by Ferreirinha et al (2004), in the peripheral nerves of parapegin-deficient mice. This approach may offer hope for future treatment strategies.
Search ClinicalTrials.gov for access to information on clinical studies for a wide range of diseases and conditions.
Genetics clinics are a source of information for individuals and families regarding the natural history, treatment, mode of inheritance, and genetic risks to other family members as well as information about available consumer-oriented resources. See the GeneTests Clinic Directory.
Support groups have been established for individuals and families to provide information, support, and contact with other affected individuals. The Resources section may include disease-specific and/or umbrella support organizations.
Genetic counseling is the process of providing individuals and families with information on the nature, inheritance, and implications of genetic disorders to help them make informed medical and personal decisions. The following section deals with genetic risk assessment and the use of family history and genetic testing to clarify genetic status for family members. This section is not meant to address all personal, cultural, or ethical issues that individuals may face or to substitute for consultation with a genetics professional. To find a genetics or prenatal diagnosis clinic, see the GeneTests Clinic Directory.
Spastic paraplegia 7 (SPG7) is inherited in an autosomal recessive manner.
Parents of a proband
The parents of an affected child are obligate heterozygotes and therefore carry one mutant allele.
Heterozygotes (carriers) are asymptomatic. A single family in which an SPG7 mutation cosegregates with an HSP phenotype of apparent dominant inheritance has been identified [McDermott et al 2001].
Sibs of a proband
At conception, each sib of an affected individual has a 25% chance of being affected, a 50% chance of being an asymptomatic carrier, and a 25% chance of being unaffected and not a carrier.
Once an at-risk sib is known to be unaffected, the risk of his/her being a carrier is 2/3.
Heterozygotes (carriers) are asymptomatic.
Offspring of a proband. The offspring of an individual with SPG7 are obligate heterozygotes (carriers) for a disease-causing mutation in the SPG7 gene.
Other family members of a proband. Each sib of the proband's parents is at a 50% risk of being a carrier.
Carrier testing for at-risk family members is available on a clinical basis once the SPG7 mutations have been identified in the family.
Family planning. The optimal time for determination of genetic risk, clarification of carrier status, and discussion of the availability of prenatal testing is before pregnancy.
DNA banking. DNA banking is the storage of DNA (typically extracted from white blood cells) for possible future use. Because it is likely that testing methodology and our understanding of genes, mutations, and diseases will improve in the future, consideration should be given to banking DNA of affected individuals. DNA banking is particularly relevant when the sensitivity of currently available testing is less than 100%. See for a list of laboratories offering DNA banking.
Prenatal diagnosis for pregnancies at increased risk is possible by analysis of DNA extracted from fetal cells obtained by amniocentesis usually performed at approximately 15-18 weeks' gestation or chorionic villus sampling (CVS) at approximately ten to 12 weeks' gestation. Both disease-causing alleles of an affected family member must be identified before prenatal testing can be performed.
Note: Gestational age is expressed as menstrual weeks calculated either from the first day of the last normal menstrual period or by ultrasound measurements.
Requests for prenatal testing for typically adult-onset conditions such as SPG7 are not common. Differences in perspective may exist among medical professionals and within families regarding the use of prenatal testing, particularly if the testing is being considered for the purpose of pregnancy termination rather than early diagnosis. Although most centers would consider decisions about prenatal testing to be the choice of the parents, careful discussion of these issues is appropriate.
Preimplantation genetic diagnosis (PGD) may be available for families in which the disease-causing mutations have been identified. For laboratories offering PGD, see .
Information in the Molecular Genetics tables is current as of initial posting or most recent update. —ED.
Locus Name | Gene Symbol | Chromosomal Locus | Protein Name |
---|---|---|---|
SPG7 | SPG7 | 16q24.3 | Paraplegin |
Data are compiled from the following standard references: Gene symbol from HUGO; chromosomal locus, locus name, critical region, complementation group from OMIM; protein name from Swiss-Prot.
602783 | PARAPLEGIN; SPG7 |
607259 | SPASTIC PARAPLEGIA 7, AUTOSOMAL RECESSIVE; SPG7 |
Gene Symbol | Entrez Gene | HGMD |
---|---|---|
SPG7 | 6687 (MIM No. 602783) | SPG7 |
For a description of the genomic databases listed, click here.
Note: HGMD requires registration.
Normal allelic variants: SPG7 spans a physical distance of approximately 52 kb and is composed of 17 exons (Table 2).
Location | Nucleotide Change | Protein Consequence | Frequency in Individuals with HSP (%) | Frequency in Controls (%) |
---|---|---|---|---|
Exon 1 | 4 G>A | Ala2Thr | 1.5 | 1.7 |
Exon 1 | 9 G>T | Val3Val | 0.7 | 1.2 |
Exon 1 | 120 G>A | Gly40Gly | 0.7-5.7 | 1-3.5 |
Exon 2 | 199 C>T | Leu67Leu | 1.5 | 0.7 |
Intron 4 | IVS4 + 12 C>T | — | 73 | 56 |
Intron 4 | 618 + 12 T>C | — | 2.9 | ND |
Intron 7 | IVS7 + 5 G>A | — | 2.8 | 3 |
Intron 7 | 862-34 G>T | — | 33.1 | 70.5 |
Exon 7 | 881 G>A | Arg294His | 0.7 | 0.4 |
Intron 7 | 987 +5 A>G | — | 59.7 | 52 |
Intron 7 | 987 +57 G>T | — | 0.7 | 1.4 |
Intron 7 | IVS/ + 17G>C | — | 2.8 | 2 |
Intron 7 | IVS7 + 38G>A | — | 4.2 | 5 |
Exon 8 | 1032 C>T | Gly344Gly | 3.6 | 2.2 |
Intron 10 | IVS10 + 19G>A | — | 2.8 | 5 |
Intron 11 | 1450 + 29 G>A | — | 30.2 | 44 |
Intron 11 | 1552 + 65 A>C | — | 30.2 | 41.8 |
Exon 11 | 1457 G>A | Arg486Gly | 0.7 | 0.7 |
Exon 11 | 1507 A>G | Thr503Ala | 2.8-27.3 | 6-35.6 |
Exon 11 | 1529 C>T | Ala510Val | 1.4-9.6 | 4-0 |
Intron 12 | 1553 47 G>T | — | 0.7 | 11.5 |
Intron 12 | IVS12 + 13C>T | — | 1.4-11.5 | 4-12 |
Intron 13 | 1664 -15 C>A | — | 0.7 | 1 |
Intron 13 | 1779 + 47 G>C | — | 27.3 | 36 |
Intron 13 | IVS13 + 45G>C | — | 20 | 31 |
Exon 14 | 1816 C>T | Gly605Gly | 0 | 1 |
Intron 15 | 1937 -22 C>T | — | 0.7 | 0.6 |
Exon 15 | 2037 G>A | Ala679Ala | 0.7 | 0.6 |
Exon 15 | 2063 G>A | Arg688Gln | 7.1-27.3 | 24-33.1 |
Exon 17 | 2283 G>A | Gln761Gln | 2.8 | 2 |
Exon 17 | 2292 C>T | Ile764Ile | 2.8-0.7 | 5.7 -22 |
Exon 17/ 3' UTR | 2421 C>T 3'UTR | — | 0.7 | 1.8 |
Patient chromosomes: n=70; control chromosomes: n=100 [Wilkinson et al 2004]
Patient chromosomes: n=136; control chromosomes: n=275 [Elleuch et al 2006]
Pathologic allelic variants: All types of DNA alterations are observed in almost every exon or splice site. Missense mutations are the most frequent subgroup. Missense mutations and truncating mutations have been reported within the paraplegin functional domain. See Table 3 for primers used in molecular genetic testing [Casari, unpublished data; McDermott et al 2001].
To date, sixteen mutations have been confirmed in SPG7 (Table 4).
Location | Nucleotide Change | Effect on Protein | Reference |
---|---|---|---|
Exon 1 | 1A>T | No translation initiation | Elleuch et al 2006 |
Exon 1 | 28G>A | Ala10Ser | Wilkinson et al 2004 |
Exon 2 | 244-246delACA | Gln82del | Elleuch et al 2006 |
Exon 6 | 784del2 | Frameshift, truncated protein | Casari et al 1998 |
Exon 6 | 850-851 delTTinsC | Phe284ProfsX44 | Elleuch et al 2006 |
Exon 8 | 1057-1085del29 | Frameshift 353-384X385 | Wilkinson et al 2004 |
Exon 11 | 1450-1458del9 | Glu,Arg,Arg484-486del | McDermott et al 2001 |
Exon 11 | 1519 C>T | Glu507X | Elleuch et al 2006 |
Exon 13 | 1715C>T | Ala572Val | Wilkinson et al 2004 |
Exon 12-17 | del 9,5 kb | Large deletion of the peptidase M41 family domain | Casari et al 1998 |
Exon 13 | 1729G>A | Gly577Ser | Wilkinson et al 2004 |
Exon 13 | 1742-1744del3 | Val581del | Elleuch et al 2006 |
Exon 14 | 1904C>T | Ser635Leu | Elleuch et al 2006 |
Exon 15 | 1948G>C | Asp650His | Elleuch et al 2006 |
Exon 15 | 2026T>C | Phe676Leu | Wilkinson et al 2004 |
Exon 17 | 2228 Ins A | Frameshift, stop codon | Casari et al 1998 |
Normal gene product: Paraplegin, comprising 795 amino acids, is in the AAA (ATPases associated with diverse cellular activities) family — as is spastin, encoded by SPAST, mutations in which cause SPG4, an autosomal dominant form of HSP [Hazan et al 1999] (see also Hereditary Spastic Paraplegia Overview). Paraplegin and spastin belong to different subclasses of the AAA family, since mitochondrial function of spastin has been excluded but demonstrated as a function of paraplegin.
Paraplegin is ubiquitously expressed in adult and fetal human tissues.
Paraplegin shares its closest amino acid sequence homology with the yeast mitochondrial metalloprotease Afg3, Rca1, and Yme1 [Casari et al 1998, Settasatian et al 1999]. Yeast mitochondrial ATPases demonstrate both proteolytic and chaperone-like activities at the inner mitochondrial membrane, where they are involved in the assembly and degradation of proteins in the respiratory chain complex [Pearce 1999]. Two additional human genes encoding protein highly homologous to paraplegin, AFG3L2 and YME1L1, have been discovered [Banfi et al 1999, Coppola et al 2000]. The presence of two hydrophobic regions, which have the characteristics of transmembrane domains, allows identification of both paraplegin and AFG3L2 as integral membrane proteins. The AAA domain is localized in the central part of the protein between aa 344 and 534.
Abnormal gene product: Atorino et al (2003) demonstrated that paraplegin co-assembles with a homologous protein, AFG3L2, in the mitochondrial inner membrane. The two proteins form a high molecular-weight complex that appears to be aberrant in HSP fibroblasts. The loss of this complex causes reduced complex I activity in mitochondria, which can be reversed by increased expression of wild type paraplegin. Furthermore, complementation studies in yeast demonstrate functional conservation of the human paraplegin/AFG3L2 complex with the yeast m-AAA protease and also assign proteolytic activity to this structure.
Biochemical analysis from two SPG7 mutation-positive individuals revealed a reduction in citrate synthase-corrected complex I and complex II/III activities in muscle and complex I activity in mitochondrial-enriched fractions from cultured myoblasts [Wilkinson et al 2004]. Nolden et al (2005) showed impaired mitochondrial protein synthesis in paraplegin-deficient mice. Degeneration of the corticospinal axons in individuals with SPG7 could be caused by mitochondrial impairment of regulation of the respiratory chain.
GeneReviews provides information about selected national organizations and resources for the benefit of the reader. GeneReviews is not responsible for information provided by other organizations. Information that appears in the Resources section of a GeneReview is current as of initial posting or most recent update of the GeneReview. Search GeneTests for this disorder and select for the most up-to-date Resources information.—ED.
National Institute of Neurological Disorders and Stroke
Hereditary Spastic Paraplegia
Spastic Paraplegia Foundation, Inc.
11 Douglas Green
Woburn MA 01801
Phone: 703-495-9261
Email: community@sp-foundation.org
sp-foundation.org
National Ataxia Foundation
2600 Fernbrook Lane Suite 119
Minneapolis MN 55447
Phone: 763-553-0020
Fax: 763-553-0167
Email: naf@ataxia.org
www.ataxia.org
Medical Genetic Searches: A specialized PubMed search designed for clinicians that is located on the PubMed Clinical Queries page.
No specific guidelines regarding genetic testing for this disorder have been developed.
25 February 2008 (cd) Revision: deletion/duplication analysis available clinically
24 August 2006 (me) Review posted to live Web site
7 March 2005 (gc) Original submission