Search Results

Basic Search | Intermediate Search | Gene Image Map | Home

Streptococcus mutans Search Results

Record: 1 of 1 MiniMap

LANL Gene ID: SMu1739GenBank Locus Tag: SMU.1915DNA Molecule Name: 1 GenBank ID: 24380265Gene Name: comC Definition: S. mutans specific competence stimulating peptide, precursorCellular Location: Extracellular, Cytoplasm [Evidence]Gene Start: 1795008Gene Stop: 1795148Gene Length: 141Molecular Weight*: 5193pI*: 10.50Net Charge*: 2.98EC: Functional Class: Cellular processes; Competence Gene Ontology:Pathway: pathway tablePrimary Evidence: Matsumoto-Nakano M, Kuramitsu HK. Role of bacteriocin immunity proteins in the antimicrobial sensitivity of Streptococcus mutans. J Bacteriol. 2006 Dec;188(23):8095-102. Epub 2006 Sep 22. PMID: 16997961 Petersen FC, Fimland G, Scheie AA. Purification and functional studies of a potent modified quorum-sensing peptide and a two-peptide bacteriocin in Streptococcus mutans. Mol Microbiol. 2006 Sep;61(5):1322-34. PMID: 16925560 Yonezawa H, Kuramitsu HK. Genetic analysis of a unique bacteriocin, Smb, produced by Streptococcus mutans GS5. Antimicrob Agents Chemother. 2005 Feb;49(2):541-8. PMID: 15673730 Wang BY, Kuramitsu HK. Interactions between oral bacteria: inhibition of Streptococcus mutans bacteriocin production by Streptococcus gordonii. Appl Environ Microbiol. 2005 Jan;71(1):354-62. PMID: 15640209Secondary Evidence: Cheng Q, Campbell EA, Naughton AM, Johnson S, Masure HR. The com locus controls genetic transformation in Streptococcus pneumoniae. Mol Microbiol. 1997 Feb;23(4):683-92. PMID: 9157240Comment: For other 'com' genes see SMu0567 (comEA); SMu0568 (comEC); SMu0138 (comR);SMu1814 (comX1); SMu0258 (comA);SMu0259 (comB);SMu1804 (comYA);SMu1803 (comYB);SMu1802 (comYC); SMu1801 (comYD); SMu0451 (comF);SMu0452 (comFC); SMu0490 (comC);SMu1782 (comA);SMu1684 (comEB); SMu1710 (comA) and SMu1740 (comD).View in HOMD Genome ViewerBlast Summary: PSI-Blast Search This sequence corresponds to the previously published 12698430, 12698428|, and >12698434 in GenBank. There are no other signnificant matches to SMu1739. SMu1739 has no significant similarity (BLAST p-value < 1e-3) to Streptococcus agalactiaeTop Blast Hits: Updated monthly Click here to view the entire PsiBlast results. gi|90903941|gb|ABE02365.1| competence stimulating peptide p... 73 5e-12 gi|24380265|ref|NP_722220.1| competence stimulating peptide... 72 7e-12 gi|12698428|gb|AAK01541.1| competence stimulating protein p... 72 8e-12 gi|90903971|gb|ABE02380.1| competence stimulating peptide p... 72 1e-11 gi|90903937|gb|ABE02363.1| competence stimulating peptide p... 68 1e-10 gi|115312739|emb|CAL29393.1| competence stimulating peptide... 68 1e-10 gi|115312733|emb|CAL29390.1| competence stimulating peptide... 68 2e-10 gi|12698434|gb|AAK01544.1|AF277154_1 competence stimulating... 67 2e-10 gi|90903939|gb|ABE02364.1| competence stimulating peptide p... 66 8e-10InterPro Summary: InterProScan No hits reported. COGS Summary: COGS Search No hits to the COGs database. Blocks Summary: Blocks Search No significant hits to the Blocks database. ProDom Summary: Protein Domain Search No significant hits to the ProDom database. Paralogs: Local Blast Search SMu1739 has no significant similarity (blastp p-value < 1e-3) to any other gene in this genome. Pfam Summary: Pfam Search No significant hits to the Pfam 11.0 database Top PDB Hits: No significant hits to the NCBI PDB database. Gene Protein Sequence: MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK Gene Nucleotide Sequence: Sequence Viewer ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGA TGAATTAGAGATTATCATTGGCGGAAGCGGAAGCCTATCAACATTTTTCC GGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA Los Alamos National Laboratory • Est 1943 Operated by Los Alamos National Security, LLC for the U.S. Department of Energy's National Nuclear Security Administration Inside | © Copyright 2006 LANS LLC All rights reserved | Disclaimer/Privacy