Searching for Genetic Treasures

Web Extras

Videocast: Geneticist Sarah Tishkoff on Human Genetic Diversity
(Download free Quicktime Player)

Article: Computing Evolutionary Trees Using Ancient Molecules

Imagine finding a treasure chest that contains all of the precious gems and metals ever mined, but you can only lift the lid far enough to see the glint of gold and the sparkle of diamonds. That’s how some biologists felt not too long ago. Advances in computer technology have opened the genetic treasure chest all the way, revealing the human genome and answering questions about diseases, drug treatments, and even crimes.

»  Side Effects: Genes and Medicines
»  Answers from Africa
»  Word Games
»  Mutiny Against Antibiotics
»  CSD: Crime Scene DNA

Side Effects: Genes and Medicines
By Susan Gaidos

Medicines that work wonders for you can be ineffective—or even harmful—to others. Why? Age, weight, lifestyle, and other medicines each play a role, but so do genes.

Scientists use computers to find the specific genetic variations that affect the way we respond to drugs. This field of research is called pharmacogenetics, and its goal is to determine the type and dose of medicine best suited for each individual.

Geneticist Gary Peltz at Roche Palo Alto in California leads one research team working in this field. His group has looked for tiny differences that change how mice process, or metabolize, the drug warfarin.

In 2005, the U.S. Food and Drug Administration approved a heart-failure drug specifically targeted to African Americans. Why do you think some people raised ethical concerns?

Nearly 2 million Americans, especially those who have heart disease or are recovering from major surgery, take warfarin to prevent deadly blood clots. But warfarin is tricky to prescribe. Too much causes excessive bleeding and too little could allow clots to form. Doctors use a careful, trial-and-error approach to find the right amount for each person.

The California researchers pinpointed the gene that makes an enzyme the mice need to metabolize warfarin. Searching with computers, they then found slight variations in the gene's DNA that could influence how quickly the animals eliminated the drug from their bodies. The scientists were able to use the mice's genetic profiles to predict how the mice would process the drug. Similar studies in humans could ultimately help doctors more quickly and precisely prescribe the right dose of warfarin.

Back to Top

Answers from Africa
By Alisa Zapp Machalek

Geneticist Sarah Tishkoff splits her time between her laboratory at the University of Maryland, College Park, and remote parts of Africa.

She works with and collects DNA from people as diverse as hunter-gatherers in the jungles of central Africa; grain-growing farmers in southern Africa; and nomadic, cattle-raising warriors in eastern Africa.

By designing computer models to compare the DNA of these different populations, she hopes to track down gene variations that make some people less susceptible to malaria—one of the world's leading causes of death.

Tishkoff enlists African tribespeople in her project to understand how human genomes have responded to malaria.
Credit: Sarah Tishkoff

People in certain African tribes that have been exposed to malaria for thousands of years can contract the disease and survive it. These tribespeople developed genetic adaptations that gave them natural resistance to malaria, which they passed on to their descendants. Through the generations, the resistance genes have become more common in the population.

Tishkoff calls this process the "footprints of natural selection." Following the trail can lead scientists to the genetic basis of innate resistance—and possibly to future therapies—for malaria and other diseases.

So far, the trail has taken Tishkoff to data indicating that innate resistance to malaria is caused by a variant in the gene for a specific enzyme nicknamed G6PD. People with this genetic variant make less of the enzyme, which is needed for several important chemical reactions inside cells.

Up to one-quarter of the people living in malaria-infested regions of Africa have this variant. Everywhere else, fewer than 5 percent have it.

Understanding how the G6PD genetic variant protects people from malaria could eventually help treat and prevent the spread of the disease. The work, Tishkoff adds, is also helping to unravel the history of modern humans in Africa and beyond.

Back to Top

Word Games

Make up your own 3-letter series, and ask your friends to arrange them.

The answer is: BIT, BAT, BAN, FAN, FUN.

If you're hooked on sudoku, you should try the letter game called genetic code. Here's an easy example: Put the following words in a sequence so that each one differs from the previous word by just one letter.

FAN | BIT | BAT | BAN | FUN

Now imagine working with words that contain thousands of letters. And, instead of shuffling around recognizable words, you have long, seemingly random strings of As, Ts, Gs, and Cs—the letters of the DNA code.

That's what scientists face when they try to track and analyze changes within an organism's genetic material, or genome. The task may sound tough, but it's easy with the help of computers.

Scientists typically start with a collection of gene sequences from different people or organisms. These sequences could come from blood, bodily tissues, or even ancient bones.

To figure out when the variations occurred, researchers use computational tools to put the gene sequences in chronological order. In this way, computers are revealing the genetic changes, combinations, and quirks that create the Earth’s remarkable biological diversity.—AZM

Back to Top

Mutiny Against Antibiotics

Blow your nose. There's a good chance that your tissue contains Staphylococcus aureus, or "staph" bacteria. Normally, this common bug doesn't cause sickness, but it occasionally can be life-threatening. Computer models can help identify strategies for keeping the spread of these infections at bay, especially in hospitals, where they can be the most dangerous.

What can dirty diapers teach us about medicine? That infectious bugs are cagey.

When scientists designed the first antibiotics more than 50 years ago, they called them medical marvels. The drugs cured common infections caused by bacteria in just days, slashing death rates and transforming medical care.

But through tiny genetic changes, prompted in part by our own overuse and misuse of antibiotics, super bugs now outsmart our once super drugs. Certain bacterial strains have developed resistance to antibiotics that once killed them and passed this ability to their descendants. Today, a few of these strains can even overcome every existing antibiotic.

Scientists thought that after many generations without exposure to antibiotics, the bacteria would eventually succumb to the drugs once again. Unfortunately, that doesn't seem to be the case, says Bruce Levin, a population geneticist at Emory University in Atlanta, Georgia.

Levin analyzed E. coli bacteria—the harmless kind in our colons—found in 70 dirty diapers from a day care center. One-quarter of the bacteria in the used diapers were resistant to streptomycin, an antibiotic rarely prescribed in the previous 30 years.

Levin's diaper discovery was buoyed by research led by Richard Lenski, a microbiologist at Michigan State University in East Lansing who trained in Levin's lab.

Since 1988, Lenski has monitored flasks of streptomycin-resistant E. coli. After 10 years and 20,000 bacterial generations, he flooded the bugs with streptomycin for the first time. They remained unfazed by the drug.

Levin and others have run thousands of computer simulations to come up with strategies that slow the development and spread of resistance.

Because drug-resistant bacteria will continue to plague us, Levin jokes that research on antibiotic resistance offers the perfect career opportunity. He says, "We must continually discover new ways to deal with bacterial infections. I tell students that when you graduate from school, there are plenty of things for you to do!"—AZM

Back to Top

CSD: Crime Scene DNA

As of 2007, the Innocence Project, which offers legal assistance to people who claim they've been wrongfully accused, says that DNA fingerprinting has led to the freeing of more than 194 people.

In 1995, a Louisiana nurse accused her ex-boyfriend, a doctor, of attempted murder. She claimed he gave her the AIDS virus by injecting her with blood from an HIV-positive patient. Lawyers from both sides recruited scientists to analyze viral DNA from the nurse.

Who do you think is guilty? Evidence from a crime scene leads police to five suspects. Compare DNA from the perpetrator's blood left at the crime scene with the suspects' DNA below.

DNA sequence from perpetrator's blood found at the crime scene: AGGCTGCCTACGCGGTTAGG

DNA sequences from suspects:
#1 AGGATGGCTACCCGGTTAGG
#2 AGGCTGCCTCAGCGGATAGG
#3 AGGCTGCCTACGCGGTTAGG
#4 CGGCAGCCTACTCGGTTAGG
#5 AGGCTGGATACGCGGCTAGG

In the Louisiana murder trial, scientists compared more than 2,000 letters of HIV from about 30 people. Computers did most of the work!

The answer is: #3.

To prove its case, the prosecution had to convince the jury that the virus from the nurse and the virus from the patient were close relatives. So, scientists dusted for DNA fingerprints!

The investigative team, led by computational biologist David Hillis at the University of Texas at Austin and virologist Michael Metzker at Baylor College of Medicine in Houston, Texas, used a technique called DNA fingerprinting to compare the DNA sequences from the two viral samples. The team also used a number of different computer programs to piece together how the viral sequences most likely changed between the alleged injection in 1994 and the trial in 1998.

The results showed that certain genetic sequences from the nurse's virus were identical to those of the patient's virus. The doctor was convicted of attempted second-degree murder and sentenced to 50 years in prison. Lawyers appealed his case all the way up to the U.S. Supreme Court, which let the conviction stand in 2002.

The case marks the first time that such genetic analysis, called phylogenetics, was used as evidence in a U.S. criminal court.—AZM

Back to Top