Cancer Genome Anatomy Project SNP500Cancer Database

NCI > CGAP > SNP500Cancer > Search by SNP

Human Genome build 36.3, dbSNP build 129

Home Search by Gene/ Chromosome/ Pathway Search by SNP HLA results Assays FTP Links Log In What's new?

SNPs matching: MMP1-03 dbSNP ID: rs5854 SNP500Cancer ID: MMP1-03 Gene: MMP1 SNP Region: Ex10-224C>T   Note: 3'UTR   dbSNP NCBI map Ensembl map Entrez Gene Surrounding Sequence    (GC Content=38%) GAGTCACTGATACACAGAATATAATCTTAYTTATACCTCAGTTTGCRTATTT TTTTACTATTTAGAATGTAGCCCTTTTTGTACTGATAYAATTTAGTTCCACA AATGGTGGGTACAAAAAGTCAAGTTTGTGGCTTATGGATTCATATAGGCCAG AGTTGCAAAGATCTTTTC(C/T)AGAGTATGCAACTCTGACGTTGATCCCAG AGAGCAGCTTCAGTGACAAACATATCCTTTCAAGACAGAAAGAGACAGGAGA CATGAGTCTTTGCCGGAGGAAAAGCAGCTCAAGAACACAYGTGCAGTCACTG G To link to the SNP in the Genewindow genome browser, click on the red SNP. To view one of the other SNPs in this sequence, click on its IUPAC code. Some SNPs in this sequence are not currently in the database. SNP500Cancer: Frequency Data as determined from 102 SNP500Cancer controls: Total Completed Genotypic Allelic CC CT TT C T 102   56/102 (0.549) 39/102 (0.382) 7/102 (0.069) 151/204 (0.740) 53/204 (0.260) View Subpopulation Frequencies Assays - the SNP500Cancer frequency results were obtained on the following platforms - click to view primers, probes, and conditions:   Sequencing    TaqMan Search by SNP by SNP identifier to display SNP details, allele and genotype frequencies Enter the dbSNP ID or internal SNP ID: search hints disclaimer