|
|
Dispatch
Fluoroquinolone Resistance
Linked to GyrA, GyrB, and ParC Mutations in Salmonella enterica
Typhimurium Isolates in Humans
Isabelle Casin,*† Jacques Breuil,†‡ Jean Pierre Darchis,§ Claire Guelpa,¶
and Ekkehard Collatz†
*Hôpital Saint-Louis, Université Paris VII, Paris, France; †INSERM E0004-LRMA,
Université Paris VI, Paris, France; ‡Centre Hospitalier Villeneuve-Saint
Georges, Villeneuve-Saint Georges, France; §Centre Hospitalier de Compiègne,
Compiègne, France; ¶Hôpital du Val d’Yerres, Yerres, France
Suggested citation
for this article:
Casin I, Breuil J, Darchis JP, Guelpa C, Collatz E. Fluoroquinolone-resistant
Salmonella enterica Typhimurium in humans. Emerg Infect Dis [serial
online] 2003 Nov [date cited]. Available from: URL: http://www.cdc.gov/ncidod/EID/vol8no11/03-0317.htm
We report two cases
of infection with clonally unrelated, high-level ciprofloxacin-resistant,
ß-lactamase–producing strains of Salmonella enterica Typhimurium.
Resistance was caused by four topoisomerase mutations, in GyrA, GyrB,
and ParC and increased drug efflux. Ciprofloxacin treatment failed in
one case. In the second case, reduced susceptibility to third-generation
cephalosporins occurred after initial treatment with these drugs and
may explain the treatment failure with ceftriaxone.
Ciprofloxacin, a member of the large and widely used fluoroquinolone
group of antimicrobial drugs, is considered the empirical treatment of
choice of gastrointestinal infections in adults. The fluoroquinolones
have been licensed for use in humans as well as in food-producing animals.
This use has raised a worldwide debate on the selection of fluoroquinolone-resistant
bacteria in, and the possible circulation between, the different ecosystems
concerned (1). While resistance to these drugs occurred
quickly in Escherichia coli and several other enterobacteriaceae,
high-level resistance to ciprofloxacin (HLRC) has been found exceptionally
in salmonellae (2–5). The low prevalence of salmonellae
with HLRC has been ascribed to counter selection in the environment (6),
an observation corroborated by the difficulty in selecting HLRC mutants
in vitro. This type of resistance generally involves multiple mutations
in the genes encoding the quinolone target enzymes, gyrase and topoisomerase
IV (2), and mutations in regulatory systems (marORAB
[7]) or soxRS [8]) or drug efflux
systems (AcrAB) (9). We report two cases of infection
caused by multiple-resistant Salmonella enterica Typhimurium with
HLRC in which initial therapy failed and present data on the fluoroquinolone
resistance mechanism.
The Study
Case 1
A 74-year-old man with an aorto-femoral bypass and chronic prostatitis
became febrile and was treated empirically with ciprofloxacin. After 2
weeks of persistent fever, he was hospitalized. Pyelonephritis was diagnosed
and endocarditis suspected. Urinalysis and blood culture both led to the
isolation of a strain of S. Typhimurium (STmA) resistant to ciprofloxacin,
amoxicillin, tetracycline, chloramphenicol, and sulfonamide. Treatment
with cefotaxime was started, the fever subsided, and the patient recovered
and was discharged. He did not go for follow-up consultations.
Case 2
A 3-month-old boy (body weight 6 kg) arrived at the hospital with severe
diarrhea and fever. A stool culture indicated a strain of S. Typhimurium
(STmB1) resistant to ciprofloxacin, amoxicillin, tetracycline, trimethoprime,
chloramphenicol, streptomycin, spectinomycin, and gentamicin. Treatment
was initiated with ceftriaxone IV (250 mg/day) and maintained for 7 days.
Signs and symptoms improved for a few days, but fever relapsed after 2
weeks. A second stool culture indicated S. Typhimurium strain STmB2,
with the resistance phenotype of the original isolate. A second treatment
with the same antimicrobial drug IV (300 mg/day) was given for 6 days,
again with apparent initial success. However, fever and diarrhea reoccurred
after 3 weeks (isolation of strain STmB3 from stool sample). All symptoms
disappeared after oral treatment with cefpodoxime (96 mg/day/7 days).
The search for carriers within the family was positive in one, with isolation
of strain STmC in a 1-year-old sibling who showed no clinical signs of
infection.
All STm strains were analyzed for their lysotype, pulsed-field gel electrophoretic
(PFGE) pattern, and resistance phenotype and genotype, as previously described
(10). Strain STmA was phage nonsusceptible; all STmB
and STmC strains were of lysotype 12. The last two had identical PFGE
profiles after digestion of genomic DNA with XbaI, patterns that
were clearly different from that of STmA (5 of 12 fragments were in common).
Polymerase chain reaction (PCR) amplification indicated ß-lactamase
genes in these strains of type TEM in STmA and of type TEM and OXA-1 in
the STmB and STmC strains. MICs of the antimicrobial drugs shown in the
Table were determined for the five clinical strains and the reference
strain S. Typhimurium NCTC 12416 (phage type LT2), on Mueller-Hinton
medium containing serially twofold diluted antimicrobial drugs. MICs of
ethidium bromide and of ciprofloxacin, cefotaxime, and ceftriaxone in
the presence of the efflux pump inhibitor Phe-Arg-ß-naphthylamide
(Sigma-Aldrich Chimie, Saint Quentin Fallavier, France) (11)
at concentrations of 50 mg/L were also determined. All clinical strains
were similarly high-level resistant to fluoroquinolones. Isolate STmA,
producing the TEM ß-lactamase, was more susceptible to cefotaxime
and ceftriaxone than the STmB and STmC isolates producing in addition
OXA-1, and the post-treatment STm strains B2 and B3 were two- to fourfold
less susceptible to the third-generation cephalosporins than STmB1 (Table).
In the presence of Phe-Arg-ß-naphthylamide at 50 mg/L, a concentration
at which no inhibition of growth was observed in the controls, MICs of
ciprofloxacin were reduced fourfold and those of cefotaxime and ceftriaxone
were reduced twofold. All STm isolates showed strongly reduced susceptibility
to ethidium bromide (MIC > 1,000 mg/L as opposed to <100
mg/L for the reference strain).
To identify mutations responsible for HLRC, the quinolone resistance
determining regions (QRDR) of DNA gyrase and topoisomerase IV were determined
after nucleotide sequencing of the corresponding QRDR fragments which
were PCR-amplified with the respective pairs of primers: 5´CTGAAGCCGGTACACCGTCG
and 5´TCGGCCATCAGTTCGTGGGC for gyrA; 5´TTATCGATGCTGCGCGTGCC
and 5´TCGCCGCTTTCAGGGCGTTC for gyrB; 5´CGCCTACTTAAACTACTCCA
and 5´ATCAGCGTAATCGCCGCTTT for parC; and 5´GACC-GAGCTGTTCCTTGTGG
and 5´GCGTAACTGCATCGGGTTCA for parE. The QRDRs of the topoisomerases
of the five strains had identical mutations in GyrA (Ser83Phe and Asp87Asn)
and in GyrB (Ser464Phe), while distinct mutations were observed in ParC
(Glu84Lys in strain STmA and Ser80Arg in all STmB and STmC strains). The
recently described quinolone resistance-conferring gene qnr was
absent from all STm strains as tested by PCR with the corresponding specific
primers (12). Also, nucleotide sequencing did not show
any mutation in the PCR-amplified marORA locus.
Electrophoretic (sodium dodecyl sulfate-polyacrylamide gel electrophoresis)
analysis of outer membrane proteins indicated the loss of one of them,
possibly a porin (data not shown), in the post-treatment isolates STmB2
and STmB3. These changes did not influence the levels of fluoroquinolone
resistance but were associated with reduced susceptibility to cefoxitin
(not shown) and cefotaxime (fourfold) and to ceftriaxone (twofold) (Table).
Conclusions
The two cases reported here show that clonally unrelated HLRC strains
of S. Typhimurium, which may cause severe infections, are present
in the community. In both cases initial treatment failed, respectively,
with a fluoroquinolone and a third-generation cephalosporin. In the first
case, the failure may be attributable to the multiple topoisomerase mutations
(possibly in conjunction with increased drug efflux), although treatment
failures have been reported in cases of lower levels of resistance to
ciprofloxacin (13). In the second case, the reason for
the initial treatment failure with ceftriaxone is less obvious. Strain
STmB1 had the potential to decrease its susceptibility to third-generation
cephalosporins under treatment, possibly related to the loss of an outer
membrane protein. The high-level resistance to ethidium bromide and the
increased susceptibility of the strains to ciprofloxacin in the presence
of Phe-Arg-ß-naphthylamide were strongly suggestive of an activated
drug efflux system, such as AcrAB, the substrates of which also include
cephalosporins with lipophilic side chains (2,14).
The growth rates of the strains were the same as that of the reference
strain, an observation which is at variance with that made with experimental
fluoroquinolone-resistant mutants selected in animals (6)
and which might imply the existence of additional compensatory mutants
in the human STm isolates.
Low-level ciprofloxacin resistance in salmonellae has been observed occasionally
in the environment in France (15) and elsewhere (16).
Since we did not have a pretreatment isolate at our disposal, we are not
certain whether any of the mutations resulting in the high-level fluoroquinolone
resistance observed in strain STmA were selected under treatment. On the
other hand, HLCR strain STmB may have been acquired as such from the environment
or through the food chain, since neither the patient nor his sibling had
ever been treated with fluoroquinolones, although no salmonellae with
this phenotype have been observed to date from environmental or animal
sources in France. In fact, to our knowledge, quadruple mutations affecting
three topoisomerase subunits have never been reported before in salmonellae.
The unwelcome occurrence of fluoroquinolone-resistant salmonellae accumulating
multiple mechanisms of resistance could compromise standard therapy of
infections attributable to such pathogens. For children, an initial high-dose
regimen with commonly used third-generation cephalosporins, or with oral
cephalosporins, may therefore be indicated for the treatment of infections
caused by S. Typhimurium strains such as STmB1.
Acknowledgments
We gratefully acknowledge
F. Grimont and F.X. Weill for lysotype determinations.
This work was supported
in part by a grant from the Ministère de la Recherche et de la Technologie
(Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses
et Parasitaires).
Dr. Casin is a medical
microbiologist at the Hôpital Saint-Louis, a university teaching hospital
in Paris, France. She works on various aspects of bacterial resistance
to antimicrobial drugs in gram-negative bacteria, including molecular
epidemiology and mechanisms.
References
- Angulo FJ, Johnson KR, Tauxe RV, Cohen ML. Origins
and consequences of antimicrobial-resistant non-typhoidal Salmonella:
implications for the use of fluoroquinolones in food animals. Microb
Drug Resist 2000;6:77–83.
- Piddock LJV. Fluoroquinolone resistance in Salmonella serovars
isolated from humans and food animals. FEMS Microb Rev 2002;26:3–16.
- Heisig P, Kratz B, Halle E, Graser Y, Altwegg M, Rabsch W, et al.
Identification
of DNA gyrase A mutations in ciprofloxacin-resistant isolates of Salmonella
Typhimurium from men and cattle in Germany. Microb Drug Resist 1995;1:211–8.
- Herikstad H, Hayes P, Mokhtar M, Fracaro ML, Threlfall EJ, Angulo
FJ. Emerging
quinolone-resistant Salmonella in the United States. Emerg
Infect Dis 1997;3:371–2.
- Nakaya H, Yasuhara A, Yoshimura K, Oshihoi Y, Izumiya H, Watanabe
H. Life-threatening
infantile diarrhea from fluoroquinolone-resistant Salmonella enterica
Typhimurium with mutations in both gyrA and parC. Emerg Infect Dis
2003;9:255–7.
- Giraud E, Brisabois A, Martel JL, Chaslus-Dancla E. Comparative
studies of mutations in animal isolates and experimental in vitro- and
in vivo-selected mutants of Salmonella spp. suggest a counterselection
of highly fluoroquinolone-resistant strains in the field. Antimicrob
Agents Chemother 1999;43:2131–7.
- Alekshun MN, Levy SB. Regulation
of chromosomally mediated multiple antibiotic resistance: the mar regulon.
Antimicrob Agents Chemother 1997;41:2067–75.
- Koutsolioutsou A, Martins EA, White DG, Levy SB, Demple B. A
soxRS-constitutive mutation contributing to antibiotic resistance in
a clinical isolate of Salmonella enterica (serovar Typhimurium).
Antimicrob Agents Chemother 2001;45:38–43.
- Piddock LJV, White DG, Gensberg K, Pumbwe L, Griggs DJ. Evidence
of an efflux pump mediating multiple antibiotic resistance in Salmonella
enterica serovar Typhimurium. Antimicrob Agents Chemother 2000;44:3118–21.
- Casin I, Breuil J, Brisabois A, Moury F, Grimont F, Collatz E. Multidrug-resistant
human and animal Salmonella Typhimurium isolates in France belong
predominantly to a DT104 clone with the chromosome- and integron-encoded
ß-lactamase PSE-1. J Infect Dis 1999;179:1173–82.
- Renau TE, Leger R, Flamme EM, Sangalang J, She MW,
Yen R, et al. Inhibitors
of efflux pumps in Pseudomonas aeruginosa potentiate the activity
of the fluoroquinolone antibacterial levofloxacin. J Med Chem 1999;42:4928–31.
- Tran JH, Jacoby GA. Mechanism
of plasmid-mediated quinolone resistance. Proc Natl Acad Sci U S
A 2002;99:5638–42.
- Aarestrup FM, Wiuff C, Molbak K, Threlfall EJ. Is
it time to change fluoroquinolone breakpoints for Salmonella
spp.? Antimicrob Agents Chemother 2003;47:827–9.
- Nikaido H, Basina M, Nguyen V, Rosenberg EY. Multidrug
pump AcrAB of Salmonella Typhimurium excretes only those ß-lactam
antibiotics containing lipophilic side chains. J Bacteriol 1998;180:4686–92.
- Breuil J, Brisabois A, Casin I, Armand-Lefèvre L, Frémy S, Collatz
E. Antibiotic
resistance in salmonellae isolated from humans and animals in France:
comparative data from 1994 and 1997. J Antimicrob Chemother 2000;46:965–71.
- Threlfall EJ, Ward LR, Rowe B. Resistance
to ciprofloxacin in non-typhoidal salmonellas from humans in England
and Wales. Clin Microbiol Infect 1999;5:130–4.
| Table.
Antimicrobial drug susceptibilities of the Salmonella enterica
Typhimurium isolates |
|
|
Isolate
|
MIC (mg/L)a
|
|
|
NOR
|
CIPb
|
CTM
|
CTX
|
|
|
NCTC
12416
|
0.06
|
0.016
|
0.06
|
0.125
|
|
A
|
32
|
16
|
0.06
|
0.06
|
|
B1
|
32
|
32
|
0.25
|
0.125
|
|
B2
|
32
|
32
|
1
|
0.25
|
|
B3
|
32
|
32
|
1
|
0.25
|
|
C
|
32
|
32
|
0.25
|
0.125
|
|
| aNOR, norfloxacin;
CIP, ciprofloxacin; CTM, cefotaxime; CTX, ceftriaxone. |
| bMICs of moxifloxacin
were identical to those of CIP. |
|
