Skip Standard Navigation Links
Centers for Disease Control and Prevention
 CDC Home Search Health Topics A-Z
peer-reviewed.gif (582 bytes)
eid_header.gif (2942 bytes)
Past Issue

Vol. 12, No. 3
March 2006

Adobe Acrobat logo

EID Home | Ahead of Print | Past Issues | EID Search | Contact Us | Announcements | Suggested Citation | Submit Manuscript

PDF Version | Comments Comments | Email this article Email this article



Case Report
Conclusions
References
Figure
Table

Dispatch

Pneumonia and New Methicillin-resistant Staphylococcus aureus Clone

Fabien Garnier,*Comments Anne Tristan,† Bruno François,‡ Jerome Etienne,† Manuella Delage-Corre,§ Christian Martin,* Nadia Liassine,¶ Wim Wannet,# François Denis,* and Marie-Cécile Ploy*
*Laboratoire de Bactériologie-Virologie-Hygiène, Limoges, France; †Centre National de Reference des Staphylocoques, Lyon, France; ‡Service de Réanimation Polyvalente, Limoges, France; §Service d'Anatomie Pathologique, Limoges, France; ¶Bioanalytique-Riotton, Geneva, Switzerland; and #National Institute of Public Health and the Environment, Bilthoven, the Netherlands

Suggested citation for this article


Necrotizing pneumonia caused by Staphylococcus aureus strains carrying the Panton-Valentin leukocidin gene is a newly described disease entity. We report a new fatal case of necrotizing pneumonia. An S. aureus strain with an agr1 allele and of a new sequence type 377 was recovered, representing a new, emerging, community-acquired methicillin-resistant clone.

Necrotizing pneumonia associated with Panton-Valentine leukocidin (PVL) is a recent described clinical entity. It mainly occurs in children and young adults (median age 15 years), is fatal in 75% of cases, and is associated with a median survival time of 4 days (1). Necrotizing pneumonia is often preceded by a viral-like illness with signs of rhinopharyngitis. Viruses such as the influenza A virus have been isolated concomitantly with the PVL-positive S. aureus (1). Clinically, necrotizing pneumonia is mainly characterized by a rapidly extensive pneumonia often associated with pleural effusion and progressing towards the acute respiratory distress syndrome. Major associated signs include hemoptysis and leukopenia (<2 × 109/L) (1). The severity of necrotizing pneumonia could be due to the products of the PVL genes, which are present in all S. aureus strains associated with this disease. The precise pathophysiology of the disease is unknown, but PVL causes tissue necrosis and leukocyte destruction. This toxin has been linked to primary skin and soft-tissue infections such as furuncles and abscesses (1).

Necrotizing pneumonia is mainly associated with PVL-positive methicillin-susceptible Staphylococcus aureus strains. Only 1 of the 16 cases reported by Gillet et al. (1) and 6 of the 40 cases of necrotizing pneumonia reported in the literature were associated with methicillin-resistant strains (MRSA). These PVL-positive MRSA correspond to clones that have emerged worldwide and cause community-acquired (CA) infections in patients with no risk factors. These CA-MRSA clones have a continent-specific distribution or worldwide distribution described by Vandenesch et al. (2). CA-MRSA clones that have spread worldwide share SCCmec type IV, the smallest cassette containing the mecA gene coding for methicillin resistance. The major European clone has a sequence type (ST) 80, as determined by multilocus sequence typing, and an agr (for accessory gene regulator) allele of type 3. agr is a global regulator controlling the expression of virulence factors in S. aureus, and has 4 alleles (3). PVL-positive CA-MRSA isolated in Australia have an agr type 3 allele and are of ST30 or ST93. The PVL-positive CA-MRSA isolated in the United States are ST1 and agr allele type 3, but some are ST8 or ST59 and agr allele type 1 (2). Here we report a fatal case of necrotizing pneumonia involving a 59-year-old woman infected by a new clone of PVL-positive CA-MRSA.

Case Report

A 59-year-old woman with an unremarkable medical history was admitted to Limoges University Hospital (France) in December 2003 for acute respiratory failure. She had a 3-day history of flulike syndrome with fever, chills, cough, and myalgia and had been prescribed nonsteroidal antiinflammatory therapy. On admission, she had dyspnea, nonproductive cough, and rales in both lungs. Her arterial pressure was 60/30 mm Hg. Skin rash and diarrhea were absent. A chest radiograph showed diffuse alveolar infiltration of both lungs, without pleural effusion. Laboratory studies showed leukopenia (leukocytes = 1.66 × 109/L), mild thrombocytopenia (115,000 platelets/mm3), hypoxemia (PaO2/FiO2 = 61), and lactic acidosis (pH = 7.29, lactates = 4.45 mmol/L). Empirical antibacterial chemotherapy combining ceftriaxone, ciprofloxacin, and gentamicin was started on admission, and mechanical ventilation was immediately necessary. Repeated tracheal aspiration was highly productive and showed hemoptysis and sustained intraalveolar plasma leakage. Despite fluid resuscitation, continuous catecholamines perfusion, dortrecogin alfa (activated) administration (Xigris, Eli Lilly and Company, Indianapolis, IN, USA), and aggressive care, her hemodynamic status deteriorated rapidly, leading to multiple organ failure and death <24 hours after admission.

Necropsy showed hemorrhagic foci in both lungs. Histopathologic studies showed total destruction of the respiratory epithelium covering the bronchi and bronchioli, together with abundant gram-positive cocci, absence of viable polymorphonuclear cells, and extensive necrosis of the alveolar septa. These lesions were characteristics of necrotizing pneumonia.

S. aureus was isolated 3 times, by culture of blood (LIM-48), lung necropsy tissue (LIM-49), and tracheal aspirate (LIM-50). The 3 isolates had the same antimicrobial drug resistance profile (resistant to oxacillin, kanamycin, tobramycin, and gentamicin) and the same pattern by pulsed-field gel electrophoresis after DNA digestion by SmaI (data not shown).

Influenza A virus was detected by polymerase chain reaction and immunofluorescence on the tracheal aspirate, but culture on cell lines was negative. The influenza A virus has been shown to be capable of destroying the respiratory epithelium from the trachea to the bronchioli (1), allowing the PVL-positive CA-MRSA to adhere to the basement membrane (4). PVL may diffuse locally, attracting polymorphonuclear leukocytes by its chemotactic activity and lysing them by its leukotoxicity.

Figure
Figure.

Click to view enlarged image

Figure. Pulsed-field gel electrophoresis (PFGE) pattern and phylogenetic tree of 4 strains ST377...

Because the clinical manifestations corresponded to those of necrotizing pneumonia, isolate LIM-49 was referred (lung necropsy culture) to the French National Centre for Staphylococci. The isolate was screened for staphylococcal toxin genes, agr alleles, and the mecA gene as described elsewhere (Table) (3,5,6). The strain had an agr type 1 allele and the lukS-PV/lukF-PV genes encoding PVL (Figure), but harbored no toxin genes (sea through see, tsst, eta, and etb genes encoding staphylococcal enterotoxins A though E, toxic shock syndrome toxin, and exfoliative toxins A and B, respectively). The mecA gene was detected, together with SCCmec type V as described by Ito et al. (7). The spa type was 355 and the sequence type was ST377 (Figure). The single nucleotide difference between ST152 and ST377, which is not distinguished by using the usual primers determined by Enright et al. (8), was established as ST377 by using in-house primers (forward 5´-ggA CgA Agg TCA TgA TgT ATT TTT-3´ (nt 327–350), reverse 5´-CTT CTA CgC gCT CTC TTT TTA Ag-3´ (nt 564–586), according to the GenBank ID11211186 of the gmk gene) to amplify appropriate fragment. To our knowledge, this is the first description of such a necrotizing pneumonia–associated CA-MRSA clone. Three other ST377 strains were referred to the National Reference Centre for staphylococci in 2003. Two were isolated from patients in Europe (Netherlands and Switzerland), and 1 from an Australia patient (strain provided by G. Nimmo). The patient from the Netherlands had been treated for an abscess from which PVL-MRSA was cultured, and the Swiss patient had furunculosis. The 3 isolates harbored the SCCmec type V cassette, an agr1 allele, the same toxin gene profile, and macrorestriction pattern, spa type, as our isolate (Figure).

Conclusions

We report the identification of a new, emerging, highly virulent PVL-positive CA-MRSA clone that harbors the SCCmec type V cassette. This tends to confirm the continuing emergence of new CA-MRSA clones. The new clone seems to have spread rapidly in Europe, because it has been detected in patients in the Netherlands, Switzerland, and now in France. Since necrotizing pneumonia is rapidly fatal, as in the patient described here, cases of PVL-positive CA-MRSA infection must be recognized rapidly, especially in case of methicillin resistance. The therapeutic value of intravenous immunoglobulin containing anti-PVL antibodies has been reported by Gauduchon et al. (9) but must be confirmed.

Dr Garnier is a medical microbiologist at the Limoges Teaching Hospital, France. His research interests include molecular bacterial identification and bacterial resistance.

References

  1. Gillet Y, Issartel B, Vanhems P, Fournet JC, Lina G, Bes M, et al. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet. 2002;359:753–9.
  2. Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Hefferman H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis. 2003;9:978–84.
  3. Jarraud S, Mougel C., Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70:631–41.
  4. de Bentzmann S, Tristan A, Etienne J, Brousse N, Vandenesch F, Lina G. Staphylococcus aureus isolates associated with necrotizing pneumonia bind to basement membrane type I and IV collagens and laminin. J Infect Dis. 2004;190:1506–15.
  5. Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F. Bacterial competition for human nasal cavity colonization: role of staphylococcal agr alleles. Appl Environ Microbiol. 2003;69:18–23.
  6. Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29:2240–4.
  7. Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob Agents Chemother. 2004;48:2637–51.
  8. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008–15.
  9. Gauduchon V, Cozon G, Vandenesch F, Genestier AL, Eyssade N, Peyrol S, et al. Neutralization of Staphylococcus aureus Panton Valentine leukocidin by intravenous immunoglobulin in vitro. J Infect Dis. 2004;189:346–53.

 

Table. Primers used to screen for staphylococcal toxin genes, agr alleles, and mecA gene


Gene

Primer

Oligonucleotide sequence (5´–3´)

Reference


mecA

mecA-1

AAAATCGATGGTAAAGGTTGGC

(6)

mecA-2

AGTTCTGCAGTACCGGATTTGC

agr1

agr1-1

ATGCACATGGTGCACATGC

(5)

agr1-2

GTCACAAGTACTATAAGCTGCGAT

agr2

agr2-1

ATGCACATGGTGCACATGC

(5)

agr2-2

TATTACTAATTGAAAAGTGCCATAGC

agr3

agr3-1

ATGCACATGGTGCACATGC

(5)

agr3-2

GTAATGTAATAGCTTGTATAATAATACCCAG

agr4

agr4-1

ATGCACATGGTGCACATGC

(5)

agr4-2

CGATAATGCCGTAATACCCG

sea

sea-1

GAAAAAAGTCTGAATTGCAGGGAACA

(3)

sea-2

CAAATAAATCGTAATTAACCGAAGGTTC

seb

seb-1

ATTCTAATTAAGGACACTAAGTTAGGGA

(3)

seb-2

ATCCCGTTTCATAAGGCGAGT

sec

sec-1

GTAAAGTTACAGGTGGCAAAACTTG

(3)

sec-2

CATATCATACCAAAAAGTATTGCCGT

sed

sed-1

GAATTAAGTAGTACCGCGCTAAATAATATG

(3)

sed-2

GCTGTATTTTTCCTCCGAGAGT

see

see-1

CAAAGAAATGCTTTAAGCAATCTTAGGC

(3)

see-2

CACCTTACCGCCAAAGCTG

tsst

tsst-1

TTCACTATTTGTAAAAGTGTCAGACCCACT

(3)

tsst-2

TACTAATGAATTTTTTTATCGTAAGCCCTT

eta

eta-1

ACTGTAGGAGCTAGTGCATTTGT

(3)

eta-2

TGGATACTTTTGTCTATCTTTTTCATCAAC

etb

etb-1

CAGATAAAGAGCTTTATACACACATTAC

(3)

etb-2

AGTGAACTTATCTTTCTATTGAAAAACACTC

LukS-PV/lukF-PV

pvl-1

ATCATTAGGTAAAATGTCTGGACATGATCCA

(3)

Npvl-2

GCATCAASTGTATTGGATAGCAAAAGC


 

Suggested citation for this article:
Garnier F, Tristan A, François B, Etienne J, Delage-Corre M, Martin C, et al. Pneumonia and new methicillin-resistant Staphylococcus aureus clone. Emerg Infect Dis [serial on the Internet]. 2006 Mar [date cited]. Available from http://www.cdc.gov/ncidod/EID/vol12no03/05-1040.htm

   
     
   
Comments to the Authors

Please use the form below to submit correspondence to the authors or contact them at the following address:

Fabien Garnier, Laboratoire de Bactériologie-Virologie-Hygiène, EA 3175, Chu Dupuytren, 2 avenue Martin Luther King, 87042 Limoges CEDEX France; fax: 33-555-05-6722; email: fabien.garnier@unilim.fr

Please note: To prevent email errors, please use no web addresses, email addresses, HTML code, or the characters <, >, and @ in the body of your message.

Return email address optional:


 


Comments to the EID Editors
Please contact the EID Editors at eideditor@cdc.gov

Email this article

Please note: To prevent email errors, please use no web addresses, email addresses, HTML code, or the characters <, >, and @ in the body of your message.

Your email:

Your friend's email:

Message (optional):

 

 

 

EID Home | Top of Page | Ahead-of-Print | Past Issues | Suggested Citation | EID Search | Contact Us | Accessibility | Privacy Policy Notice | CDC Home | CDC Search | Health Topics A-Z

This page posted February 22, 2006
This page last reviewed February 24, 2006

Emerging Infectious Diseases Journal
National Center for Infectious Diseases
Centers for Disease Control and Prevention