 |
|
ISIS 3521
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)
| Synonym: | | DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) | | | | US brand names: | | Affinitac
Affinitak | | | | Code names: | | CGP 64128A
LY900003 | | |
| Previous: | iron sucrose injection, IRX-2, Iscar, Iscomatrix, ISIS 2503 | | Next: | ISIS 5132, isoniazid, isosulfan blue, isotretinoin, Isovorin |
|
|
