![](https://webarchive.library.unt.edu/eot2008/20090117145515im_/http://www.cdc.gov/ncidod/eid/images/spacer.gif)
|
![](https://webarchive.library.unt.edu/eot2008/20090117145515im_/http://www.cdc.gov/ncidod/eid/images/spacer.gif) |
Letter
Anaplasma phagocytophilum,
Sardinia, Italy
Alberto Alberti,*
Maria Filippa Addis,* Olivier Sparagano,† Rosanna Zobba,* Bernardo Chessa,*
Tiziana Cubeddu,* Maria Luisa Pinna Parpaglia,* Mauro Ardu,* and Marco
Pittau*
*Università degli Studi di Sassari, Sassari, Italy; †University of Newcastle,
Newcastle upon Tyne, United Kingdom
Suggested
citation for this article
To the Editor: Anaplasma phagocytophilum (formerly Ehrlichia
phagocytophila), a tick-transmitted pathogen that infects several
animal species, including humans (involved as accidental "dead-end"
hosts), is the causative agent of human granulocytic anaplasmosis (HGA).
It is a pathogen of veterinary importance responsible for tickborne fever
of ruminants and for granulocytic anaplasmosis of horses and dogs (1,2).
HGA was first described in the United States in 1994 (2)
and is emerging in Europe (3). Although only 2 human
cases have been reported in Italy (4), serologic and
molecular findings have shown A. phagocytophilum infections in
dogs and Ixodes ricinus ticks (5). Incidence,
prevalence, and public impact of HGA and horse granulocytic anaplasmosis
are, therefore, unknown for this geographic area. From 1992 to 1996, an
average rate of 13.4 cases/year/100,000 inhabitants of tick bite–related
fever of unknown etiology has been reported on the island of Sardinia,
Italy, which is considerably higher than the corresponding national average
value of 2.1 cases/year/100,000 inhabitants. Moreover, 117 cases of tick
bite–related fever, whose etiology remains obscure, have been reported
from 1995 to 2002 in the central west coast area of the island. Local
newspapers occasionally report deaths as a result of tick bites, although
no HGA-associated deaths have been documented in Europe.
This study investigated A. phagocytophilum in Sardinia. From 2002
to 2004, veterinarians based on the central west coast of the island were
instructed to collect EDTA blood samples when a suspected case of tick
bite–related fever was found at their clinics. A total of 70 blood samples
were collected from 50 dogs and 20 horses that showed tick infestation
and symptoms consistent with tickborne disease, such as fever, anorexia,
jaundice (only in horses), anemia, myalgia, and reluctance to move. Genomic
DNA was extracted from the buffy coat obtained by centrifugation of 2
to 4 mL of blood, as previously described (6). Furthermore,
DNA was extracted from 50 Rhipicephalus sanguineus ticks removed
from 30 dogs. Primers EphplgroEL(569)F (ATGGTATGCAGTTTGATCGC), EphplgroEL(1193)R
(TCTACTCTGTCTTTGCGTTC), and EphgroEL(1142)R (TTGAGTACAGCAACACCACCGGAA)
were designed and used in combination to generate a heminested polymerase
chain reaction (PCR) for the selective amplification of 573 bp of the
groEL gene of A. phagocytophilum. The final 50 μL PCR
volume of the first PCR round contained 5 μL of the DNA extraction,
primers EphplgroEL(569)F and EphplgroEL(1193)R, and HotMaster Taq DNA
polymerase (5u/μL, Eppendorf) according to the manufacturer's basic
protocol (Eppendorf AG, Hamburg, Germany). Heminested PCR was performed
by using 5 μL of each of the first PCR products and primer EphgroEL(1142)R.
To confirm the PCR diagnosis, amplicons were digested with the HindIII
restriction endonuclease (predicted digestion pattern: 3 fragments of
525 bp, 21 bp, and 27 bp). Anaplasma phagocytophilum DNA was obtained
from strain NCH-1 and used as positive control in PCR reactions. Sequences
were obtained by cloning the PCR products into the pCR2.1-TOPO vector
(Invitrogen S.R.L., Milan, Italy) and using the ABI PRISM Big Dye Terminator
Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City,
CA, USA), according to the protocols supplied by the manufacturers. Sequences
(AY848751, AY848747) were aligned to the corresponding region of other
species belonging to Rickettsiales by using ClustalX (7).
Genetic distances among species were computed by the Kimura 2-parameters
method by using MEGA, and were used to construct bootstrapped neighbor-joining
trees (8).
Of 120 DNA samples, 1 tick, 3 dog, and 3 horse samples generated the
predicted band of 573 bp representative of the groEL gene of A.
phagocytophilum. HindIII digestions confirmed PCR diagnosis
(Appendix Figure). Two different groEL sequence
types were obtained from 1 dog and 1 horse and confirmed by BLAST (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html)
queries as A. phagocytophilum groEL sequences (average identity
99%; average E value = 0), indicating that sequences did not reflect contamination.
Bootstrapped neighbor-joining trees confirmed the identity of the new
sequences obtained, which are closely related to HGA strains isolated
in Europe and the United States (Figure).
The molecular approach applied in this study established A. phagocytophilum
in an area of Sardinia characterized by a high prevalence of tick bite–related
fever in humans and animal species. To our knowledge, this is the first
evidence of A. phagocytophilum in Sardinian dogs and horses and
the first documentation of infection in Italian horses caused by pathogenic
strains. Therefore, these findings suggest the emergence of Anaplasma
phagocytophilum in Italy. Ixodes ricinus ticks are indicated
as vectors transmitting A. phagocytophilum in Europe. Although
only 0.3% of 4,086 ticks collected in 72 sites of Sardinia (9)
have been identified as Ixodes, other tick species are better represented
on the island (Rhipicephalus, 67.2%; Haemaphysalis, 24.1%;
Dermacentor, 4.9%). A. phagocytophilum in 1 Rhipicephalus
sanguineus could indicate a role of this tick in the epidemiology
of HGA. Finally, these data indicate the presence of a potential threat
to human and animal health and suggest activation of further epidemiologic
surveillance and controls.
Acknowledgment
We thank Sandra
Edwards, University of Newcastle, UK, for critical reading and final
editing of the manuscript.
References
- Dumler JS, Barbet AF, Bekker CPJ, Dasch GA, Palmer
GH, Ray SC, et al. Reorganization
of genera in the families Rickettsiaceae and Anaplasmataceae
in the order Rickettsiales: unification of some species of Ehrlichia
with Anaplasma, Cowdria with Ehrlichia, and Ehrlichia
with Neorickettsia, descriptions of six new species combinations
and designation of Ehrlichia equi and 'HGA agent' as subjective
synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol.
2001;51:2145–65.
- Chen SM, Dumler JS, Bakken JS, Walker DH. Identification
of a granulocytotropic Ehrlichia species as the etiologic agent
of human disease. J Clin Microbiol. 1994;32:589–95.
- Parola P. Tick-borne
rickettsial diseases: emerging risks in Europe. Comp Immunol Microbiol
Infect Dis. 2004;27:297–304.
- Ruscio M, Cinco M. Human
granulocytic ehrlichiosis in Italy: first report on two confirmed cases.
Ann NY Acad Sci. 2003;990:350–2.
- Manna L, Alberti A, Pavone LM, Scibelli A, Staiano N, Gravino AE.
First
molecular characterisation of a granulocytic Ehrlichia strain
isolated from a dog in South Italy. Vet J. 2004;167:224–7.
- Pusterla N, Huder J, Wolfensberger C, Litschi B, Parvis A, Lutz H.
Granulocytic
ehrlichiosis in two dogs in Switzerland. J Clin Microbiol. 1997;35:2307–9.
- Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The
ClustalX windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucl Acid Res. 1997;25:4876–82.
- Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2:
molecular evolutionary genetics analysis software. Bioinformatics.
2001;17:1244–5.
- Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks
infesting domestic animals in Italy: current acarological studies carried
out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl
1):39–40.
Suggested citation
for this article:
Alberti A, Addis MF,
Sparagano O, Zobba R, Chessa B, Cubeddu T, et al. Anaplasma phagocytophilum,
Sardinia, Italy. Emerg Infect Dis [serial on the Internet]. 2005 Aug [date
cited]. Available from http://www.cdc.gov/ncidod/EID/vol11no08/05-0085.htm
|