National Cancer Institute
U.S. National Institutes of Health | www.cancer.gov

NCI Home
Cancer Topics
Clinical Trials
Cancer Statistics
Research & Funding
News
About NCI
NCI Drug Dictionary
Page Options
Print This Page
Quick Links
Director's Corner
Updates from the Director

Dictionary of Cancer Terms
Cancer-related terms

NCI Drug Dictionary
Definitions, names, and links

Funding Opportunities
Research and training

NCI Publications
Order/download free booklets

Advisory Boards and Groups
Information, meetings, reports

Science Serving People
Learn more about NCI

Español
Información en español
NCI Highlights
Virtual and Standard Colonoscopy Both Accurate

NCI Responds to Hurricanes

The Nation's Investment in Cancer Research FY 2009

Cancer Trends Progress Report: 2007 Update

Past Highlights
You CAN Quit Smoking Now!
Search for
# A B C D E F G H I J K L M N O P Q R S T U V W X Y Z All

ISIS 3521
A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)

Synonyms:DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA)
Protein Kinase C-Alpha Antisense
US brand names:Affinitac
Affinitak
Code names:CGP 64128A
LY900003



Previous:iron sucrose injection, IRX-2, Iscar, Iscomatrix, ISIS 2503
Next:ISIS 5132, isoniazid, isosulfan blue, isotretinoin, Isovorin

A Service of the National Cancer Institute
Department of Health and Human Services National Institutes of Health USA.gov