|
|
ISIS 3521 A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, ISIS 3521 hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. Check for active clinical trials or closed clinical trials using this agent. (NCI Thesaurus)
Synonyms: | | DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) Protein Kinase C-Alpha Antisense | | | US brand names: | | Affinitac Affinitak | | | Code names: | | CGP 64128A LY900003 | | |
|
|