HIV BLAST Examples

All BLAST outputs begin with a listing of the best matches to your query sequence. The listing looks like this:

Sequences producing significant alignments:           (bits) Value

Z29296|HIV-1|HIVI1035|B|NL|-|HIV-1 DNA, V3 region...   541  e-154
L21486|HIV-1|HIVM21S2|B|US|-|Human immunodeficien...   454  e-128
U95417|HIV-1|HIVU95417|B|IT|-|HIV-1 clone 12 isol...   454  e-128
U95413|HIV-1|HIVU95413|B|IT|-|HIV-1 clone 8 isola...   454  e-128

The fields of information in the above listing are delimited by "|" characters. The fields in each line from left to right are GenBank Accession Number, virus type, common name, subtype, country of origin, year of isolation (usually blank), definition line from the GenBank file.

Following the list of best matches there appears an alignment of your query sequence to its matches. There are two different styles of alignment to choose from in the pop-up menu on the BLAST search submission page.

Pairwise:

Score = 541 bits (273), Expect = e-154
Identities = 273/273 (100%), Positives = 273/273 (100%)
Query: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
 
Query: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120

In the alignment above the query is matched against a single subject sequence and the identities are shown by the vertical bar ( | ) character.

Master-Slave with identities:

Query seq 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
Z29296    1 ............................................................  60
U95417  433 .............a.........g......g............................. 492
U95414  433 .....c.................g......g............................. 492
U95413  433 .............a.........g......g............................. 492
U95411  433 .............a.........g......g............................. 492
U95410  433 .............a.........g......g............................. 492
L21486   49 .............a.........g......g............................. 108
L21468   49 .............a.........g......g............................. 108
U95419  433 .............a.........g......g............................. 492
U95400  430 ............aat........g.............g............c......... 489
U95392  430 ............aat........g.............g............c......... 489
L21480   49 .............a.........g......g............................. 108
Z67943    4 ....................................g...................g...  63

Here the query is aligned against ALL sequences producing a BLAST match and the identities are shown by the dot character.

Occasionally you may see lines in the alignment that look like those below.

QUERY    121  ccaggcagagcattttatacaacaggagaaataataggagatataagtcaagcacattgt 180
AF105870 121  ............................................................ 180
                                                   \                       
                                                   |                        
                                                   a                    

This means that an "a" nucleotide occurs in sequence AF105870 at position 157. The sequence of AF105870 in the region of this insertion reads tagAgag, where the "A" marks the inserted "a". If you choose to download a file of all or part of this alignment the insertions are handled as follows. The insertion is placed into its sequence and gaps are opened in all other sequences at that point. In the example above the alignment in the region of the a insertion would look like:

QUERY    tag-gag
AF105870 tagagag

Links

BLAST: return to input page.
BLAST references