RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 2.18 kb. This primary library is not normalized (normalized library is NIH_MGC_255) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library is a normalized (primary library is NIH_MGC_254) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 2.0kb. This is a non-normalized primary library (normalized primary library is NIH_MGC_366) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.8kb. This is a normalized primary library to Cot5 (non-normalized primary library is NIH_MGC_365) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

UI-R-BO0 is a subtracted library derived from a mixture of 9 individuallytagged and normalized libraries comprising 9 brain regions: thalamus (12%), cerebellum (10.5%), hypothalamus (9%), medulla (12%), pons (9%), midbrain (12%), cerebral cortex (10.5%), corpus striatum (13%), and hippocampus (12%). The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-BO1 library is a subtracted library derived from the UI-R-BO0library, consisting of a mixture of the following tissues: thalamus, cerebellum, hypothalamus, medulla, pons, midbrain, cerebral cortex, corpus striatum, and hippocampus. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-BT1 library is a subtracted library derived from a mixtureof the following tissues: hippocampus, thalamus, midbrain, medulla, corpus striatum, cerebral cortex, and testis. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This is a normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTAATGGACGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DY1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTAATGGACGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_DY0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCATTCTTGTATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCATTCTTGTATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_DZ0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

This is a subtracted library from a normalized rat cartilage library (NCI_CGAP_DY1) and a normalized Swarm rat chondrosarcoma library (NCI_CGAP_DZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGCCGATTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FS1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGCCGATTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_FS0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.54 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.7kb. This is a non-normalized primary library (normalized library is NIH_MGC_432) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.55kb. This library is normalized to Cot7 (primary library is NIH_MGC_431) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

The UI-R-BS0 library is a non-normalized library derived from 13 dpcwhole embryo tissue. Insert sizes range from 0.5-2.0 kb. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library consists of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone within the mixture. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the normalized pooled UI-R-E1 library (consisting of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone within the mixture. The UI-R-E1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-E0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-E0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-BU0 library is a subtracted library derived from a mixture(50% of each) of two libraries: UI-R-G0, a normalized library from rat ganglia (derived from a mixture of trigerminal ganglia, nodose ganglia, and dorsal rod ganglia), and UI-R-Y0, a subtracted library derived from a normalized rat eye library (whole adult eye without lenses). The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived frmo an individually-tagged normalized whole-eye (minus the lens) library. The driver for the subtraction consisted of a pool of previous libraries: UI-R-A0, UI-R-A1, UI-R-E0, UI-R-E1, UI-R-C0, and UI-R-C1. The UI-R-Y0 subtracted library was constructed as follows: PCR amplified cDNA inserts from previous library clones from which 3' ESTs had been derived was used as a driver in a hybridization with the normalized whole eye library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

RNA obtained from pooled heart tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2 kb. This primary library is not normalized (normalized primary library is NIH_MGC_234) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

RNA obtained from pooled heart tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_233) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

This non-normalized library has the tag GATTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag GATTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This is a non-normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This is a normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This non-normalized library has the tag GAACC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag GAACC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This non-normalized library has the tag GAAGC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag GAAGC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This non-normalized library has the tag GTGTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag GTGTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This non-normalized library has the tag GAAGG. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag GAAGG. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This non-normalized library has the tag CAGCGA. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This normalized library has the tag CAGCGA. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-BJ0 library is a subtracted library derived from theUI-R-AA1, UI-R-AB1, UI-R-AC1, UI-R-AD1, UI-R-AE1, UI-R-AF1, and UI-R-AG1 libraries. These libraries represent tissues from rat atrium at 16.5 dpc, ventricle at 16.5 dpc, AV canal at 16.5 dpc, atrium at 15 dpc, ventricle at 15 dpc, AV canal at 15 dpc, and ventricle at 13 dpc. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-BJ0p library is a subtracted library derived from theUI-R-AA1, UI-R-AB1, UI-R-AC1, UI-R-AD1, UI-R-AE1, UI-R-AF1, and UI-R-AG1 libraries. These libraries represent tissues from rat atrium at 16.5 dpc, ventricle at 16.5 dpc, AV canal at 16.5 dpc, atrium at 15 dpc, ventricle at 15 dpc, AV canal at 15 dpc, and ventricle at 13 dpc. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

The UI-R-C4 library is a subtracted library of a series, ultimatelyderived from a mixture of tissues from rat placenta, adult lung, brain, liver, kidney, heart, spleen, ovary, muscle, and 8-, 12-, and 18-day embryos. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

RNA obtained from pooled kidney tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_236) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

RNA obtained from pooled kidney tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_235) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.0kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This a primary library (normalized library is NIH_MGC_247) and was constructed by Open Biosystems. Note: this is a NIH_MGC library

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.6 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_246) and was constructed by Open Biosystems. Note: this is a NIH_MGC Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.8kb. This is a non-normalized primary library (normalized primary library is NIH_MGC_368) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.4kb. This is a normalized primary library to Cot5 (non-normalized primary library is NIH_MGC_367) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

RNA obtained from pooled lung tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.3 kb. This primary library is not normalized (normalized primary library is NIH_MGC_232) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

RNA obtained from pooled lung tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.3 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_231) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.5kb. This is a non-normalized primary library (normalized library is NIH_MGC_430) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.1kb. This library was normalized to cot 5 (non-normalized primary library is NIH_MGC_429) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection .

This library consists of a mixture of individually taggednormalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the UI-R-A0 normalized pooled library, consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-A1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of approximately 3840 UI-R-A0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-A0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library consists of a mixture of individually taggednormalized libraries constructed from rat hippocampus, thalamus, mid- brain, medulla, corpus striatum, cerebral cortex, and testis. This library was subtracted using a driver consisting of a mixture of all clones from UI-R-A0, UI-R-A1, UI-R-E0, UI-R-E1, UI-R-C0, UI-R-C1, UI-R-C2, and UI-R-C2p. The library was constructed as described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the UI-R-A1 normalized pooled library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture) and the normalized pooled UI-R-E1 library (consisting of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The UI-R-C0 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-A1 and UI-R-E1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-A1 and UI-R-E1 libraries in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the UI-R-C0 subtracted library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the UI-R-C1 subtracted library, derived from the UI-R-C0 library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C2 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C1 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library derived from the UI-R-C1 subtracted library, derived from the UI-R-C0 library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C2p subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C1 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

This library is a subtracted library of a series, ultimatelyderived from a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos, after a series of subtractions to reduce the representation of cDNAs from which ESTs had already been generated. The UI-R-C3 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C2p clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C2p library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

RNA obtained from female overies animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7kb. This primary library is not normalized (normalized library is NIH_MGC_252) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

RNA obtained from female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.5 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_252) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.23 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). .

Tissue was collected from two pooled placentas from the 21st day of pregnancy. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.25 kb fragments for an average insert size of 2.05 kb. A normalized version of this library is also available (NIH_MGC_270). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Mammalian Gene Collection library.

Tissue was collected from two pooled placentas from the 21st day of pregnancy. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.25 kb fragments for an average insert size of 2.15 kb. Library was normalized to Cot7. A non-normalized version of this library is also available (NIH_MGC_269). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Mammalian Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Constructed by Invitrogen. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Invitrogen. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pool of 3 primary libraries: NCI_CGAP_Pr30 (ventral prostate from 11 wk male, 3 days post-castration, average insert size 2 kb), NCI_CGAP_Pr40 (ventral prostate from 11 wk male, 5 days post-castration, average insert size 1.6 kb) and NCI_CGAP_Pr41 (ventral prostate from 11 wk male, 7 days post-castration, average insert size 2.5 kb). Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pool of 3 primary libraries: NCI_CGAP_Pr39 (dorsolateral prostate from 11 wk male, 3 days post-castration, average insert size 2.7 kb), NCI_CGAP_Pr29 (dorsolateral prostate from 11 wk male, 5 days post-castration, average insert size 2.2 kb) and NCI_CGAP_Pr42 (dorsolateral prostate from 11 wk male, 7 days post-castration, average insert size 2.2 kb). Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

Cloned unidirectionally. Primer: Oligo dT. Pool of 2 primary libraries: NCI_CGAP_Pr46 (ventral prostate from 10 wk male, average insert size 2 kb) and NCI_CGAP_Pr47 (dorsolateral prostate from 10 wk male, average insert size 2 kb). Constructed by Invitrogen. Note: this is a NCI_CGAP Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This is a primary library (normalized library is NIH_MGC_249) and was constructed by Open Biosytems. Note: this is a NIH_MGC Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.4 kb. This primary library is normalized (primary library is NIH_MGC_248) and was constructed by Open Biosystems (Huntsville, AL). Note: this is a NIH_MGC Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.35kb resulted in an average insert size of 1.8kb. This is a non-normalized primary library (normalized library is NIH_MGC_434) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.35kb resulted in an average insert size of 1.85kb. This library is normalized to Cot7 (primary library is NIH_MGC_433) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.4 kb. This primary library is not normalized (normalized primary library is NIH_MGC_238) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 1.9 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_237) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This is a primary library (normalized library is NIH_MGC_251) and was constructed by Open Biosystems. Note: this is a NIH_MGC Library.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.6 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_250) and was constructed by Open Biosystems. Note: this is a NIH_MGC library.